Hordeum_vulgare Locus poly:1:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:SNORD14
Hordeum_vulgare
poly:1:SNORD14
chr3H
snoR11, snoZ152, SNORD14
1001..1100, 1153..1247, 1700..1821
2820
ATGCATCAAGACCTCTGTTACGAAATAAATCTTATTGCAAAAAATAATATAACAAGACA
TTTGTTGCAAATAGAAAAAACTACAACACGCCATTGTTGTAATAATGAAGACGTCAATCG
GGCGCATGATCCGTCAAATATGGCCGCTCACAACCGGGCTGATCTTTTAAAAATATCATA
TAAAAGATCAACTGGCAGGTGCCTAGCACGCCCCATCTAAAAAGCTTACTTTTTTTTTTC
ATTTGAGGGGTTCTTAAAAACACATTTTTTGAGAAGTTTTTCAAAACTCACATTTTTGTT
GAGAAGGTCTCGCAGTCGAAGCCCTCGCGGTTCATGTTTCACACCTGGGCCGGACTGGGT
CCGGTTACGTTCCCCATCTTATGGCCCAGGTCAGCCCGGCGGAAGCCGAAACCCTAACAA
GGAACCCTGCTAGGGCAATGGCTATATATAAGCAGACCCTCGCACGATACAATACCATCG
TGGGCGCGCCGCCTCCTCACCCCCCGCCGCAGCTTCCTCAATTCTCTTTGCGGTTCGTCG
ATCTTATTTTGTGCGCTCGATTGCTTCCTCCCATCCTTGTTTTTCTCGATTTGAATGTTT
TTGCGATGTCCGGTTCTTGCAAGATCAGCTTCTTGTCTGGATCTCGTTACCCACGATCCC
AGCCAATCGGCAAATCGTCCTGCCATCTTGCTAGATCGAACTCCAAGCCGGCTTTCAACT
CACCTGGATCTGATTTCTCGATGATTTTCCGGGCCCTTTCCGTCGGCACAGCACGTAAAA
TCTTCTTTTTAGTTTTTTGAAGAACAGCAAACTCACTCTGTCCCAAAGCTTCTCCGTGTT
TTGAGGCAATTTCTTCGTTTGCGAGATGGATTTGACCCAGGCATCTCATCCGCGATGGAG
GTACTCTTGTGATCTCGTGGAGGTGTTTTGGACACATGTCCTCCGCTACTAAGTAGTTTT
AGTTATCTAGGTACTCTTGTGTGAAGTGAATTGGATATGGTTGGCTGGTGATGATTCAGG
TCCGAAAGGATCTTAGCGGATTTCGGTGAGGCGGATTCGTCCGCCGTTGATCGTTCATGT
TGTTACACACACTGAAGCCTTTATACCTTCCATTATCTTCTATCGATTTCATTGCCGTTT
GCTCTGTTCTTGTGATGCGATGATGATTCATATAGGTTTTTGGCAGTGGTGGCAACTGTC
ACCGTGAGCCTCCAAACCAAAAACGACTTCTCTTTCCACTGAGCATTGCTTAAATTTGTT
TCCTTTTTGTGGTACATCATCTTGTCTCCGTGAAGAGCTCTAGACCAGGAAGTGCCGTAT
GACACTGTAAACAGCAGCTGCTTCTCTGCTGCTGCAAGTGTCCGCCCCAGTAGCATAACC
TTTGTGGTTTGCTCTGGGATGGAATACCATTTGCACCGGCTTGATTCAGCTGTGTGCGTG
ATTTGAAACGGGTCTCTGAGGGGCTTCAGAAATGATGTCTGTTTTCTAGCAACATTTTGC
TTGCCCTGTTTTCTTGGGCCCGATGCCACGTCTCAGGTAGCCACAAGCCTTGACCAGAGA
TGCTACATTGTGCCAACAAAGATTTTCACATTTGATAGGAACCTGTGGCTGTCATACAGT
CGGTACACAGAGCCGTTTTTTGTGATTACACTTCTTTATTAATTGTGTACTCAGGTTGTA
CTAGATTATAGGGAAATCAATGGCGATGATGATAGAACTAAGGCTTGTTTCTCAAAACAT
TCGCAGATGCCGCCTAAGAGCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCTGCTAATTC
CTTCCTTGGATGTCTGAGCCATCATGATTTCCACAATTTAATATTGCTTTTGTTTTCTCT
GATCTTTCTTGCCTTTCAGGTTTTTCATTCTCGAAGTGGAATGTATGTTGCTATAGACTT
GTAGACTTCATTCAAGCTGCTTTGTAGAATGCAATACTTGTTGAAACTGAAAGGAGTAGG
TTGCCATCGGTTGAAACAGTGTCTTAAATTGTTAGACCTTCAGAATGTTAATATCATAAC
TAACCTTATGATCTGGATGTCGTTCTATTCTATGACATAACTTGTAACATTTGTTTCAAG
CTTGACATCACATAACAGTGTTTTTCTTATGGAAGTTTTTGTTATATTTTCACATCTGTC
AAAATGTTCCTCCAAAAACAGTGTGGCAAATGGTGTAGTATTTGTATGTGAAAGACTGAA
ATCTTTGACATGTTTATGATTCATGAAACTCTGCTTGTTATGTGATGTCACCCATTAGTA
AGCATGTCACTCTTGTTGTTGTTGTCTTACTGTTAGTTTAACTTTACTATGAAAAAATAT
GCTGAATGTCTGGTTTAACCTGTACCACTTTGATCAAACATGAAGCTGCTGATGACGATG
AGGCATGGATTTTGTTAGGCCTTTTTAACACTTGGATCGACTTGGCAGCCTCCGCTGAGC
CAACGCAGGGGGAATGTTGTATTTGGTACCTGTTGTGAACAATACTGCATACCGAACTGT
CTCTTGCGCTTCGCTCAAGACTTTCTGAACTAGCGTTCTGCCGTATTTCTTGAGAGTTCC
ACCTTCTGCATCCCTATACGGCCTCCCTCCCCCTCCTTTGGCCGGCTCTTGGTGGGATTT
AGGTCTGGATTTGTAGTGAGTGCAGCTGCGGTTGTTCAACTCTCCCTTTGGGCCATGCTG
ATGGAGAGAAGGCAGAGGCAAAGATCTGTGACAACGAATCCTTTGGCGGCAAACATAGGC
CTATCCGGTTTCGTCTCCATTCCTCCCTCGTATTTTTCTGTAATTAATCAAAACAGGTGC
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved