Hordeum_vulgare Locus poly:1:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:SNORD14
Hordeum_vulgare
poly:1:SNORD14
chr2H
SNORD14, SNORD14
1001..1122, 1202..1319
2318
TTACCTTATACCAACAAATTATGAATAATACTGCACCAGCTGAATTAGAAGAAATTGAT
GTTACCATCAAGCTTGCTAATAGTGATACTATTGCACCAATTGGGATTGTTAGAGATGTT
GAAGTCTTGTGTGGGAAAATCCTTCTTGCTACTTCTTGAGCTTGCGTTGGTCTTCCCTTG
AAGAGGAAAGGCTGATGCAGCAAAGTAGATAAGTATTTCCCTCTGTTTGTCGAGAACCAA
CGTATCAATCTAGTAGGAGGAACAAGCAAGGTCCCAATCTTCGCACCTACACAAACAATC
AAACACTTGCACCCAACACTAAAAAGGGGTTGTCAATCCCTTCACACTTATTTGCAAGGA
TGAGATCTCATAGAGATAGATATAAGAAATTGCTAGAACGAAAAGTAAAACAAAAGCAAA
TAAATTGCAGCAATATATTTTTGGTATTTTTGGTTTATAGATCTGAAAGATAATATGGAA
AATAGATCCGGGGCCATAGGTTTCACTAGAGACTTCTCTCATGAAGGAAAATAATATGGT
GGGTAAACAAATTATTGTCGAGCAGTTGAGAGAAAAGCGAATAATTGTGAAGAGATCCAA
GGCAATGATTATGCATATAGGCATCACGTCTGTGTCAAGTAGACCTAAAAGATTTTGCAT
CTACTACTATTACTCCACACATCGACTCACTCCTATCTGCATCTAGAGTATTAAGTTCAG
GAAGAATAGAGTAACGCATTAGGTAAGATGACATGATGTAGAGGGATAAACTCAAGAAAT
ATGATGACAACCCCATCTTTTTATCCGTGATGGCAACAATGCAATACATGCCTCGCTACC
CCTTCACGTATATTTATAGCCCAGAAATTCTTAAATATTCTAGAAAAATTCTCTGTAAAG
TTTCAGGTCATTTGGAGCAAGTTATTTTTTCTTCCTTTTTATCAGTTTCGTGGAATTGCC
TATTTAATATAGTTGTAGTGCATTTGGTACTGGAAAATTTATGGAAATGATAATAATGTT
AAGGCTTGTTTCTAAAAAAAATTGCAATTGCCACCAAAGAGCTTTTGCCTTGCTAGGCTT
GAGAGTTGTTGCTGCTTCTTCCTTACTTGGATGTGTGAGCCTTGTTATTTCTCCTGGTCA
AAGTTGTGTTTCTCAATGGGTTTCAGCACTCGAAATATAGTATGTTAAATATGATAATGC
ATTACAAATGATGATAAAATCAAGGCTTGTTTCTCAAAACATTCATAGTTGCGAACTTAG
AGCTTTCGCTCAGCCAGGTGAGCGAGTGCTGTTAGATCCTTCCTTGAATGTCTCATGCAG
TCTTGGATGCCGTAATGCATTCCCGGTGGTGATTAATTCAAGTCTAGAATTCCAGTTTCC
GGGTATTTCCCTCTGAGTGATGTACCTTGCATACTAAGAGAGAAAAGACATAAGAATTGT
ATGATAATAATGGATAATGGACAGTATCAACACAAATATCAATAGCAATTCACGATGCAA
AATGAACATATATAATCCCCCAAGCTTAGACCTCGCTTGTACTCAAGCGGAAGCCAAGCT
AAAAATAGTGACCAAATGATTTGAGAGACAGGTGTCGATAAAAACAGAATACGAGCATGA
GAGCAACATGAATATTAGCATAGCAACAAGTATTTCGTCATATAACTTCTCATAAACAAG
TGATGATCCATTCAAAATGATTGGAGTATGAAGCATAAACTTTACTGGTAGTCAACAAAC
CATATTCTCAGTTATTGGGGCAATCATCGTTCATCATAATTCAGAAGAGAGTCTATGTAA
GAGCTTTCTTGTTGACAAGTTCACATACTCAACTATCATTTAATCTTCCATGATTGCTCA
CTTTCAAGGCATATTTTTGCATCTCATGTTTCCATGGGACACATAGGAAGATATGGGCTT
AAATGACTCGCCACCCAACTTATTTACCTGTAGGATAATGTCAACAGTAATGAATCATGA
TCATCCACATCCACTTGGATATCTAAATATGAATCTTTCCTCAACACATGGTGCTTGCTA
CTATAGGATTAACAGGTTGGAAGAGGGATAAACTTTATTGACTCAAGCACATAGTTGAAC
TCCTAAATGTAAAAGGTAGGCCTTTTGCACAGGGAAGCAGAGATTGTCATGCGCTTTTAA
TTTGTTGAATGTGTGAACTCTTAATGCACAGGAACGTCACTTTATATTGCACCTTACGAT
AGCAAACTTTTATATCCCTTTTATTTATATGCCATCACAAGATCGTACAAAGCTTATTTT
CCCTTGCAATAAAATACCATACATAGTTAGGAGCAATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved