Hordeum_vulgare Locus poly:1:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:SNORD14
Hordeum_vulgare
poly:1:SNORD14
chr1H
snoU31b, SNORD14
1001..1091, 1413..1537
2536
TCCGGTCCCGCCGTCGCCGTCCGCCTCGACCTCTCCGGTCCCGCCGTCGCCGTCCGCCT
CGACCTCTCCGTCGCCGCCGTCGCCTCCACTGACTCCCGCGACTCCCGCCGTCGCCGTCC
GCCTCGACCTCTCCGGTGCCGCTGCCCGACGTCCGCCTCCACGCCGCCGCCGCCGTGCTC
GACCTCCGCCGCCGCCGTACACCGGTAAGCTCTGCCACTGACCTAGGGCCGGCCCTTGTT
GAGGTCTACCTCTCCTTCCTTCTCCTCGTCGCCGTTGCACTGCTGCCATGTCTTTCTCCT
TATCTGATTGTAGTTGAGAACAAATTAAGAACAAATTGTTATACCTTCTGTAAGAGTGTT
TGTTTGTTGGTGGCCAAGGATTAAAGTAAATTAATAGACAAGCATATGTCTGAATTTTCT
TCATGTGGAACGATCTAATCTTCTCTATGAGGCCAATGATCTTGCTCATTTATTTATCTG
TAGTTATATTTGATTCGTTTTATTTCTTCATGGTGCTGATGATGATTAGTGTGAACCTTT
CTCAATGAAATCACAAATGATTACATAACCTACTGCCTTCCTTCTGAGGCATCATGATTC
CTGGTATTCTATTTCTGTTTTTTTTTTGTCTTTTGTTTTTATTTCCATTGAATTGTTGTG
TGCTCCACGTCAAGTGATGATTACAAGTGCATAGTTCATATTGAATTGTTGTGTCCATTG
AATTGTTGTGTGCTCCTGGTATTCTATTTCTGTTTTTTTTATTTGTCCTTTGTTTGAACT
AAACTAATTAAATCATTTTCTATTAGACTAATAAATATGCTCTTTTTTATTTGCTTTGAT
GTGAGCAGTGATGAGACAATTAAATAAATATGATCTTCCAGGTGTGATTATCAATCGCTA
CGTTCTTGCTGAGCTCCTATCCTGTTGTTTTTGTTAATTCAGTTTGGTTTCCAGAGGAAA
CTTTTATTGTGATGGTTGACATGATTTTTCCAATCCTTTTTGAGGATGATGATTTCATAT
TTGTCGCCCCAGTCTTAGGGTCTGCAATGTTGTTGGATCTGTGCTGATTGACATACTTCT
GAATCTGACTCTGTAGTAGATGATTTCATAGTTTGCTGCACCCTTATACCCTCCCATACA
ATTGCAGATTTGTTTAATTCTTGTCTTCCAGTTGGTTCTGTTTTCAATATATACTTGATT
TTTCCTTTGGTGATGGCAGTGACGATTTGCAAATATTCAAGCTCAACAGACCAAATTACA
GGTTTTCTCTCAGGAGTTGATTTGTATGCCGATTATCCCGCTGAACCGAGCCGTCACCAA
AGGAAAAGTCAATTGACGAAATTGATTTTGTTTGCAATTCATTATTCTTCTCTTTTTGTG
TTTGTTTTTGTTTTCTGTTTTTTGGTGATGTAGTTGCGATGATGATAACAAGCTCCCTCT
TCTGAAAGCATTGATATTCCCGGAGCCGCCTAAGAGCTTTCGCCCTGCCAGGCTAGAGAG
CTAATGCTGCTAATTCCTTCCTTGGATGTCTGAGCCTAGTTCACATCTCCCCATTTCGTA
TTTGTATCAATTTTAGTTTCTTTTTTTTGCTGCTTGTTTTTCAAACATTTTGCTTTCTTT
GTTTTTTGCCCAGCCAAGTTTTATTCTCTGAAGCTGATTTTATATGCTAATTAAGTGATT
TGAAGGCTGTTTTGAAATGTAGATGATAGTTTTTCAATTACCTTTAACAATGTTCTCTTC
TTGAAATATATTCAATAAAACATTTCATACATTGTCATCATCAGTACCACGTGACGAATT
CTACATTGACTCTTATTTTACATGATGTCTTTACATGATATATCTAATAAATCTTAACCA
TTAAATTTTAAATCTAATGGCTGAATTAATCTTGATGATGCCATGTAGAGGAGTCAAACG
TGATTTCAATTGGTAGAATATTCCGTAAACTTTTCCGTAAACTTTCCGGTTCCGTAAATA
ATTTTGCTAAGTTAAATTCTTGTTACTAGCAGGTGTTGAGCTATGGATCCCCAAGAACCA
CATGATCAGCACGCCGATCAGCTCGCGGGAATGGGTGAGGCGGAGAAGGAAAGATACATG
TGCCAGATGATTTTTGAAGATGCAACAGCCATATATCATGATGACGACGGTGGAGAGGCG
TTTAGCAATCAATTTTTGAACGACTCCGGTGACGGAGCTGAGAATATAGAACATGTAGTA
GATGCAGAAGTGCCCTCCGGAACAAACTCTGCCAATGTATATCTCAAGTCACTGTTGACG
CAACAATTAATTTGTATTGCACTTACTAACGAATCATTATTTTTCCGTTTAGGCGCCCTC
CGGAACAGCTAGCGCAAGTACTGATACAAAGTCGAAACGAGGCCCGGCCGCAAGGTTGAA
AGATACTGCAAGGTACTCGATCGATAAAGTTGCTGCTGATGGCAAACCACTGGAACCCCC
AGAAACTTATCGCAAATTTGTAAATCAGTGCGGAGTTGTTGTAAGAGACCTGGTCCCGAT
CAACTTAATAGAATGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved