Hordeum_vulgare Locus poly:1:snoR8a
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snoR8a
Hordeum_vulgare
poly:1:snoR8a
chr1H
snoZ43, snosnR60_Z15, snoZ43, snoU31b, snoR77Y, SNORD14, snoR8a
1001..1097, 1472..1566, 1648..1744, 1814..1902, 2584..2665, 2786..2905, 3144..3231
4230
GAGCACACTGTATTAACGATGGCATGTAATCAAGTAAAAGTAGGTGTCTCACACACATT
GCTTATCTGGTTTAATCTGTACAATTGGCACTGTATTAACGATGGCATGTAATCTGTACT
TTACACCATCTTATGTTCTTTGTGGGTGTGCTTGTATTTCTATTCATTATTCTTTAATTT
TTTTCTTCTGGCTGTTCGAATTACCACTTAGCCTTTAACGTGAACAAACTGTCTCATTGA
GGCGCCTTACTGTGATACTGTGTGAGGTTTCCTCCGGCAGATTCTTGGATTAATTTTTAT
TGCGGGGTAGATCCTTTGACTAATTCACCTTTCTCACAATGCTGTACTTGAAATCACCTT
TGACATCTTGCCATTATATCATTGGTGCTCCATGATCACAATCTTCGTATGGTAGCAATT
CCAACATGACACCGGCTAAAAATGTCGGGTCAAAATTTTAAAAAATGCGACATACCACTC
TTGTATTTCGACGCCATACTTTGACCTCCCTTTCTCGGACTAGTATTTTTATCTTGCACT
AGCAAATTGCATCGAGAAAAAATATATAAAAAAAACAGAGGTTTTCAATCTCTATAGGGG
TTTGATATATTTTTGAGAACATGTAGGGGCTTAAAAAAGGCTGATTATATTAGGAGTAAC
AAACAATAGGTGTGCATGGGTTCGCCTGGCCCGTTAGTTCTGGGCCTACGGGCCGAGCAG
ATTACCCCGAACGCATCCAAGGGAACGGAGCGAGCCACGACGCCGATCCAACGGCACGGG
TCGGCCGGGCGCCCCCTGTAAAACCCTAGCGCCCTACAGCCACTCTATATAAGCAGTAGC
GAAGGGCAGTTCTTCCCACCGCCGCCACCACCTCCCATCTCACTCTCATCAATCAGGTTC
TTTCTCCCGTCTCTGTCCTTCTGGAGATCTCGATCAGGATCTCTCTTCTGTTTCCGTTCA
ACTTTTCGGGATTTTAGTGCTTGTTCTTGCATCCGGTTTGTGGACGGTGACGATTGATAT
TTGGTCTCGTTCGTCGTAACTGGCAGCAATCTGCCTTGCCGACCATCCTGCTATATCACC
ACCCATATTCCGAGTCCTCTCTAATGGGATCAAGAAACACTTTCCCCTCTGCTAGTTTCG
TCTCTGGTTTGTGGTTTTTGATTTTTTTTCTTTCGTTTTTGCGATGGCCGAGGATTAAAC
AAAATTATAGACAAGCATATGTCCGAATTTTCTTCATGTGGAACGATCTAATCTTCTCTA
TGAGGCCACTCAACTTGCTCATTGCTTTATTTGTTGTTACATTTTTCATGATTCTGTGGT
GCCGATGATGATTAGTGTGAACCTTTCTCAATGAAATCACTAATGATTACATAACCTACT
GCCTTCCTTCTGAGGCACCACATGTACTGGAATCCTACTCCCGTTTCTTTTCTGCCATCT
TTCTTGATCATCCTCTTGAATTGTTAGTTTGGCAAGGTCGAATGATGATCACAAGTGCAT
AGTTCATATGATCAAATCGTGATTACTTGAACAAAAATAGTCTTTCGCTCCTATCTGATG
ACCTTGCAACCTACCCCTTTTTCAGGAGAATCAAACAGTTTGTGTGTTCTTTTGGTTGTT
TTCTTTTGCATCATGAATTTGTTGTCGAGGACGGTGAAGATTGATATTTGGTCTCGTTCG
TCGTAACTGGCATTTATTTGCCTTGCCGACCATCCTGCTATATCACCACCCATATTCCGA
GTCTTCTTCTATACATATTTTGAATTGCTATTTGTTTAGATTGAACATAGCAAGCAGATC
TATATTCTAGTTATGAGGATGATGATTTCAAATTTGTCGCCCCAGTCTTAGGGTCCACTT
AGGTGGATCTTTGCTGATTGACATACTATTAAAATCTGACTTGACAAATCAATTTTGATT
TTCTATTATTTACTAAATTCGGTGATGGCAGTGACGATTTGCAAATATTCAAGCTCAACA
GACCAAATCACAGATTTTCTCTCAGGAGTTAATTTGTATGCCGATTATCCCGCTGAACCG
AGCCATCTGATACCCTTATTTTTAATCGGCCTTTATTTTCTTTTGTTCCCATTTTTCTGA
CTGATCTGTTTGTCTCCTTTGGAGAGTGTAGTTGCGATGAGGATAACAAGCTCCCTCTTC
TGAAAGCATTGACGACATTGCTGGCAGAATCGAACCATTTAAACAATGCCACCACTGAGC
AACTATATATTTCTTAAATCTTTTTGGCTGATATTATTCCCTTTCAATTTAGACGAACTG
TCTGGATTGTGAAGAAGTATTGATGCATAATCCAACACTTGATCCGATGGGTGGCCTGAG
CTGCCTGTGTGATGTCATCTTTGCAACTGAATCCATTAGAGATCAGATTTTAATTATTAT
GTTCTACTTGATTTTGTCAGTATCATGTGATGAGACCTTCATCAATCTTAGGACACCTTC
TGACACAGTGCCTATTTTCCTGTGGATGAGAAGGCTTTTATATTCTGATGATACACTTTG
TTTTCTTGGATTTTCTAGTTTTGTGGTTAATTGGCAGTTTTTCCTTACATAGGAGAAGTA
ATTGATGCCTGTGATGATTAGCTTTATGTTGGAATTACCGTCTGATTCTTAATGACGATA
TTTTTGCGGCTTTCTGAGGCATTTAATCGCGCTAATAGCTTCGGGTCTTGTTATGAAGTT
TTAGTATGTGTTAAATATAATTCTGTTGAATATATATGGGATTCCTTTCTAGGTTCTCTA
TGATTTGATCAGTTGGGTATACGTTATGGCAATGATGATAAAATTTAGGCTTGTTTCTCA
ACATTCGCAGATGCCGCCTTAGAGCTTTCGCCCAGCCAGGCTTGAGAGCTAATGCTGCTA
ATTCCTTCCTTGGATGTCTGAGCCTTATTATTATCCCCATACGTTCTGTTACATTGGAAG
ATCTTATCTTGTTTGTTCTGTTGGTTTTCCATTTGGAGCTTTGTTTCAATGTTTGGCTGC
TGTCCTTGCATCCAAGTTTGCAATTCTCCTAGAGATATAATGCAGGTGGCGCTTATAGCA
CAAATCCGTCATAGATAGATCTTGTGTTACGCTCGCCCCCAAATTCAAGTTTTTTGTCTT
GTGATCTGGTAGAATGGACGTGTTTTTGGTGCAGTGATTATAAAACATTCCTCGTACTGA
AGGGAAGCCCCCAGTGAACGACATCTATACACCCATAGAATCTGAGCACCAGTGAACAGT
CTTTCGAATTTGTATTCGTTTTGTTGTATATGTATATTTTATTTGACGTGGATTTATTCG
TTCAGCACTGATAATCTTGTGCAGGGCTGATAGCATCGTGGTTCATTCTTGACGTGAAAC
TCAGTTGAGATGACTGCCTCCTGTTCAGATACAACTCTACAGAACTGTTCCGTTTGTGAC
TAGGGCATTACTGAATAATCCTTCTGAACTCACAATACTGTTTCCATTTCTGTCGTAGAA
TTTATCCCTTTTGAAGCAACATATGCTCTGACATAACGTGCTTCATCCTGTTGAGTAGAG
TTAATGATGTAATTTCATTTTGTTATCAGTGGAATACTGATTCGTGATGTAAGTTATGCA
TGGACAAGTGCAAGACATTTGTTTGTATGCAGTAATAAAGTAATCTGCGTTGCCTTATAT
CTTGTAAAACGTTTGTTGTTATTGATGGTGAATTAGAGCAACTCCAGCTGGAATTTTTGT
CTAAAAGAACTCTTAGCCTAGTCAATTTGTTTGGAAGGGCGACTGGGGCCTGCCGCCACG
CCCTGAGCGATGCCCTGGGATGGAACAGACTGGAGGCATTGGGGCCCTGCCACCACGCAC
TGAGGCGGCTGGCCTACAGGCTGGGCCCTGCCGCCACCGCTTGGGGCGGCAGTCTTGCAC
GGTGCTGCCCCCTTCCCCGCCCACAGCTTTAAACGTTAAAGCGCGGTAACCTCAATTACA
CGCACTTCCCACGGTAAACGTGCCCACCGACTAAACAGTGCCAATTACACGCATTTCCCA
CGTTGAACGTGCCCACCGACTAAACAGTGCCACACCGACAGCTTTAACGCTTCTGATTCC
CACGTTAAACGGCGCTGATTTAAATGTGCCCACCGACGAAACATCGGCCTTCTAACGGCT
CTGATTTCCACGTTAAACGCCGCTGATTCAAAAGTGCCCGCCGACGAAACAGTGGCTGGT
TACCCTCCTTATTACCCTCTTGTCATTCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved