Hordeum_vulgare Locus poly:1:snoR77
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snoR77
Hordeum_vulgare
poly:1:snoR77
chr1H
snoR77, snoR44_J54
1001..1137, 1211..1304
2303
GGATTGTTGAAATTTGGAGGTGGGCCTTAGGCCCATTAGAGAATTTCAGAAAAATCTAC
AAGGGCCCATGTAGGTGGTGGCATGACAAGGTGGTGGGAGTTTAGTCCCACCCCGCTAGT
GGAGGAGAGTTTGGACCCCTTTATAAGGGTCTCTCTTCCACATGCTATTGGAGAGTGAGA
AGAGAAGGTGCCCTCGCGCACTCCTCCTCCGCCGCCCGCCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTGTTGCAGCTCAGAGGGAACTTGTTCTTTCATGATTTAC
TCATCTGAAATTGAAGGTGAAAGCACACATTGCATTAGGCAGATCTTGCTGCCGCACACA
TGTGGGACTACCACAGATACTTCAAGGATCAAGAGCGCTTGGATTGCAAAAAAATATGAA
GATATGATCAGGAGTGACCCAACCATGAATATAACCGCTCTCATAGATGTTGTGATGAGA
GAACATGGAGTTTAAATATCCAAGCACATGGCATATAGGGCGAAGAATAAAGCTCTTGAA
GCTATAGAAGGACATGAAGATATGCAATATCTACGTATTAGAGATTACTTGCAGACCGTA
ATGGACAAGAATAATGGTTCTAGATGCCATGTAACAACAATCCGGCCTACAAACAAACCT
AAAAAGAACCCACGTTTTCATGGTCTCTTCTTTTCTCTACATGCGCAACTTGAAGGGTTT
AAGAATGGATGCAGACCTTTCATCGGGGTTGATGGATGTTTTCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAAGCTTGTCTAGTAGTTTTCAGAACGTAACTAAATT
CCATTTATTAAACACTATTGTTCTGTGACGAGCGACGATTTAGGCAGCCTCTTTGCCATT
GCAGTGGCATTGGAGGTGTTGCGTTGCTCGGATAGTAAACCTTTTGCTGTTTGGATTGGC
TGAGAGGGTGGCTCCTGCTTCCCTCCCTGAAGCTGGTCTAGTAGTCTTAAGGACATTATT
TATCGTTAATTTGGTTCTCATACCCAATTTGGTATTGACCTTTTTCTTCATTTCTTGTTT
GTCGATCAAAGAAAACAAATGACGATAGCAAGACAGGGACATCAGAACCCTGAATTTCAG
GGTTATGACAAACTACGTCTAAATGGGAATCTCTCTGATGTTTTCGATTACCCATAAATC
TGTTCTGGAATCTGCTTTCTTTCTCGTTTGATGTGAATACTTGAAGCAGGTCTTGGATGA
ATTTATCAACCACATTGTGCGAACAACAGATGGATCCAATGACTTCTAAAGCCGTACACT
GTTGGCAACTGAAGCTTAATAACCCTACATGAATATGAACGGATGTTTTTGATTGAAAAA
TGTTGACTGCTATAAACAAATGAGAGAATAAAAACTATGTAAAAACAATCAAATCAACCA
TTCACGCACACCTATGCTGTCATTGCCTAGTGAAGCTTATATCAGAACAAATGATGTCTT
GATTATCCTTGATAAAACAAGTGAAGCTTATACTATTATCCTTGTGTGAAAATTAATTAT
CCGTTGAATAATATCAATCTGAGGGACACCTTTTTTGAGGTTTTTATTTTATTTTATCTT
GTACTGGACCTGATGCTTAAAGCTGTCCTATGATGATCAAACTANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAACCCTACATGAATATGAACGGATGCTTTTGATTGA
AAAATGTTGACTGCTATAAACAATTGGCGGAATAAAAACCACGTAAAAATAATCAAATCA
GCCATTCATGCACACCCATGCTATCATTGCCGAGTGAAGCTTATATCAGAACAAATGATG
TCTTGATTATCCTTGATAAGACAAGTGAAGCTTATACTATTATCCTTGTCTGAAAATTAT
TTATCCGTTGAATATTATCCTTGATTTTTTATTTTATTTTATCTTGTACTGGACCTAATG
CTTAAAGATGTCCTATGATGATCAAACTAAATACTTTCGTTTTTCTGATGTGCTATCTCA
TGGTGCGGTGCGGAAGCAATTTGGAGACCTGAACTGAGGAAATGCTTGATTGTATCTNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved