Hordeum_vulgare Locus poly:1:snoR44_J54
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snoR44_J54
Hordeum_vulgare
poly:1:snoR44_J54
chr1H
snoR44_J54, snoZ159, snoZ159
1001..1095, 2129..2225, 5253..5349
6348
GATTATTAAGCTTCAATTGCCAACAGTGTACGTCTTTAGATGTCATAGGATGTAACTGT
TGTCCGCCCAATGTTGTTGATAAGGTCGACCATGACCTGCTTCCAAGTACTACCATCAAA
GATCCGAATTGCCAACGAGAAAGAAAGCCAGTTTTCAAAACAGATATATCTTGGTGAAAT
AAAAAACATCACAGAGATTCCCATTATAGACATAGTCTGCCATAACCCTGAAATTCTGGG
TTCTGATGTCCCTGTCTTGCTATCATCATTTGTTTTCTTTGATCCCGAAACAAGAAATGA
AGTAAAAGGTCAATATCAAATTGGGTATGAGAACCAAATTGACAATAAATAATGTCCTTA
AGACTACTATACCAGCTTCAAGGAGGGGAGCAGGAGCCACCCTCTCGGCCAATCTGAATA
GCAAAAGTTTTACTATCCGAGCAACGCAACACCTCCAATGCCACTGCAATGGCAAGAGGC
TGCCTAAAACGTCGCTCGTCACAGAACAATAGTGTTTTATAAATGGAATTTAGTTTANNN
NNNNNNNGACCAGCTTCAAGGAGGGAAGCAGGAGCCACCCTCTCGGCCAATCTGAATAGC
AAAAGGTTTACTATCCGAGCAACGCAACACCTCCAATGCCACTACAATGGCAAAGAGGCT
GCCTGAATCGTCGCTCGTCACAGAACAATAATGTTTTATAAATGGAATTTAGTTTATGTT
CTTAAGACTACTAGATAAGCTTCAAGGAGGGAAGCAGAGCCTCCCCCTCAGCTAATCTGA
AGAGCAGAAGATTTACTATCCAAGCAACAGCCTCCCCTGAGCTAATCTGAAGAGCAGAAG
ATTTACTATCCAAGCAACGCAACACCTCCAATGCCACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCATTTCTTGTTTGTCGATCAAAGAAAACAAATGACGATAGCA
AGACACGGACATCAGAACCCTGAATTTCAGGGTTATGACACACTACGTCTATAATGGGAA
TGTCTGTGATGTTTTCGATTACCCATAAATCTGTTCTGGAATCTGCTTTCTTTCTCGTTT
GATGTGAATGCTTGAAGCAGGTCATGGTTGACCTTATCAACCACATTGTGCGAACAAGAG
ATGGATCCAATGACTTCAAAAGCCGTACAATGTTGGCAACTGAAGCTTAATAACCCTACA
TGAATATGAACAGATATTTTTGATTGAAAAAACACTGAACATGATTGAAGAAATGTTGAC
ACAAGTGATGGAATAAAAACCATGTAAAAATAATCAAATCAACCATTCATGAACACCTAT
TCTATCATTGCCCAATGACACTTATATCTAAACAAATGATGTCTTGATTATCCTTGATAA
AACAAGTGGAGCTTAATACTATTATCCTTGTTTGAAAATTATCTATCCGTTGAATGATAT
CACTCTGAGGGACACATTTTTTGAGATTTTTTATTTTATTTTAACTGGTACTGGACCTGA
TGCTTAAAGTTGTCCTATGATGATCAAACTAAATACTTTCGTTCTTCTGATGTGCTATNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACACTGTTGGCAACTAAAGC
TTAATAACCCTACAAGAATATGAACGGATGTTTTTGATTGAAAAAACACTGAACATGATT
GGAGAAATGTCAACACAAATGATGGAATAAAAACCATGTAAAAATAATCAAATCAGCCAT
TCATGAACACCTATTCTATCATTGCCCAGTGACCTTATATCTAAACAAATGATGTTTTGA
TTATCCTTGATACTATTATCCTTGTTTGAAAATTATCTATCTGTTGAATGATATCATTCT
GAGGGACACTTTTTTTGAGATTTTTTTAATTTTAACTGGTACTGGACCTGATGCAGCTGT
CCTATGATGATCAAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGATT
TTTTTTAACTGGTACTGGACCTGATGCAGCTGTCCTATGATGATCAAACTAAATACTTTC
GTTCTTCTGATGTGCTATCTCATGGTGCGGTGCGGAAGCAATTTGGAGACCTGAACTGAG
GAAATGCTTGATTTTATCTTGTCTACCTAACAATTGCCAATTTTACTATTTATTTCATGT
TTTTTCCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGTAGTC
CCCGAGAGTAATTTTACTCAGGTTGGGTAGTAGTAGCCTCGTAGGCTTGTTTTTGTTATG
CAGCTCAATAGGGCGGACCTGTTCAAGCTTCATGCCAGTGGGGTCACTCTTAGTGAACCC
ACTAGGTGTAGTCCCCGAGACCACTATCGACTTCTTGCGTCGGCAGGGGTCTGAAGAACT
TTGGGCTGTTATTGTTTTCCTNNNNNNNNNNCCCGAGACCGCTGTCGACTGCTTGCGTCG
GCAGGGGTCTGAAGAACTTTGGGCTGTTATTGTTTTCCTTGTTGAATGTGTCTAATCTTC
TCTTCGCGCTGATTTGCAGAAGACTTGCGAGATGGGATCAGCGTACAATGCTCTGAAAGT
TGAAAAGATTCAGCTTGATGCGGAACTAGAGGCAGCTGTGCATGACTTAGTTGGCGTGAA
GGGTGCTCTTGCTGAACGAGAGAAGTCCTTGGAGGAGTCCCGTGAGGCAAAAAAGGCATT
GGTGGCCGAAAATGAGAAAGTGGGCAAACAAAGAACTGAGCTGATGGGGCAGATGAAGGT
GATGAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGAGTGCTTGTTGACTTTGTGTTTCATTCTGCGCTTAC
TTTCTACTCGTCTTGTCTTTGCAGATTTTTGTATGGACGCTGAGGCTGAAGCAGCTGATG
TTGANNNNNNNNNNCTGCGGAACTAGAGGCAGCTGTGGATGACTTAGCTGGCGTGAAGGG
TGCTCTTGCTGAACGAGAGAAGTCCTTGGAGGAGTCTCGTGAGGCAAACAAGGCATTGGT
GGCCGAAATTGAGAAAATGGGCAAACAAAGAACTGAGCTGATGGGGCAGATGAAGGTGAT
GAACAGTCGTTGCATATCACAGGAGAAGTACGTCAGTGACTGGGCTAGGAAGATGATTGC
GCTGCTCGGTGGTAAGTTTATTCCGAGTGCTTGTTGACTTTGTGTTTCATTCTGCGCTTA
CTTTCTGCTCGTCTTGTCTTTGCAGATTTTTGTATGGACGCTGAGGCTGAAGTAGCTGAT
GTTGAGCAGTCGGTTATTCCGAACGTTCCACCTGACGACGAAGCCAATCGAGACATGCTC
CGAGCGCACATTCGCCTTGGCAAAGTGGGACCTTTCATCGGTCGCCTAAGAGAGGTCGTC
GGCCGAATCGACAAGGAGCTGTGGCCCGAAGACGAGTCCCGGCGGGAGATAGAAGGGTTG
ATGACTCGGCTGGAGGACGTCCCGAACCGAGTGCAGGCGTGGAAGAAGTCCGCTGCTCGC
TGCGGTGCGGACGTGGCGCTGTCGCTGGTCCGAGTGCACTACAAGGAAGCTCGCGAAGAG
AAGCTGAAGGCGTTGCAGGTCGCCAACACGAAGAAGCTTCGATTCGAAGATTTCATGGAG
ACCTTCCTTGAGAGCGCCACTCGCATCGCAGACGGGATCGACCTCGACACTTTCGTGGAG
CCAGCCAGTCCCAGTGCCAGTCCTGACGATGCTTGAAAAACTTGACCTCGGTATGCCGAG
TGGTATTTGTATCAAACTTTGGCCAGTGCTGTTGGCCGTCACATTCGTGGTTCGGTGTGG
ATAAGCTTGATCTACACCGAATCGACTATCGTTGAACCAACTTTGAATTCGAATCGAATA
TTTTGCTCTTCCTTCGCCAAAAAATTGTTGACACGATTTTGGCTCGTGGTTTCTGTTTGG
CGTTTCTTGGTGAAGCCAGTGGCAAACATGCGGAGCATGTAGTTGTCAGTTGTCTTGACA
TCTGCATGAGCGTCAATGAGGGTCTGCTAAGCCTCCGAGTGGATCTGTAGGATACACTCG
AAGGGAGTCTTTTTACTTAGGTGATTCTGGTTCGCAGCTAAGTCTCCGAGTGCGGCATGT
CGTGCGTACTCGTAGCGAGTTGATACTCATGTAGTTGTCAGTTGTCTTGACATCCACATG
AGTCTCGATGAGGGTCTGCTAAGCCTCCGAGTGGATCTCGAGGATACACTCGAAGGAAGC
TTTTTTACTTAGGCGATTCTGGATCCCAGCTAAGTCCCCGAGTGCGGCATCTCGTGCGCA
CTCGGAGCGAGTTGATACTCATGTAGTTGTCAGTTGTCTTGACATCCACATGAGCCTCGA
TGAGGGTCTGCTAAGCCTCCGAGTGGATCTGGATGATACACTCGAAGGAATCTTTTTTAC
TTAGGCGATTCTGGATCGCAGCTAAGTCCCCGAGTGCGATGTTTAGTGCGCACTCATAGA
AAGTTTGTACTTAGGCGATTCTTAATCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTAATAACCCTACATGAATATGAACGGATATTTTTGATTGAAAAAACATT
GAACTTGATTGGAGAAATGTCGACACAAGTGATGGAATAAAAACCATGTAATAATAATCA
AATCAGCCATTCATGAACACGTATTGTATCATTGCCTAGTGACGCTTATATCTAAACAAA
TGATGTCTTGATTATCCTTGATAAAACAAGTGGAGCTTAATACTATTATCCTTGTTTGAA
AATTATCTATCCGTTGAATGATATCACTCTGAGGGACACGTTTTTCGAGATTTTTTGTTT
TATTTTAACTGGTACTAGAACTGATGCTTAAAGCTGTCCTATGATGATCAAACTAAATAC
TTTCGTTCTTCTGATGTGCTATCTCATGGTGCGGTGCGGAAGCAATTTGGAGACCTGAAC
TGAGGAAATGCTTGATTGTATCTTTTGTACCCAACAATTGCCAATTTTACTATTCATTTC
ATGTTTTTCCACTTGTAGTTTGCGATGAAGAACATGTCTTGTGCTTGTTGCTTCACGACT
GGATGGATGGCCTGTTGTTAATAGTTTGGCCATCCTGTAGAGGGAAGCATAGATGAACGG
TGACACCGACCAGCAATAAACAACATGACGCTCTATCAAACTGCGTCTTGTTACGTGTCT
TTTGGCACATTTATAACATCTACATATTTTAGTTTACTAACATTTTATTTCTTTTGTACT
TCCTCTGCCTGAAAATAAGTTATTTAAAAATGACTCAACTTTGTACGAACTTTATAAAAT
TGAGTTAATTTTAAGTCACTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGCAGGGCTCCGCCCGAGCTCCGCAGAAACGCGATCTAGAGGAAAAACCGTGGAGG
TATGTGGTCGGGCTGCCGTGGAAAACTCGTCTCAAATCAGCCCTAAAACCTCCGTATATA
TAGGGGGAAGAGGGGGAGCCTTGCCTTGGGGTCCATGGACCCCTAAGGGCTTCAGCCGAG
CCAAGGGGCGCAGCCCTCCCCTTCCAAACCGAGTCCAACTAGGTTTGGAAGGAGGAGTCC
TTCCCCCTTTTCCCACCTCCTCTTTTTTTTCTCTTTGATTTTCTTCCTATGGCGCATAGG
GCCTCCTTGGGCTGTCCCACCAGCCCACTAAGGGCTGGTGCACCACCCCCAAGGCCTATG
GGCTTCCCCGGGGTGGGTTGCCCCCCCCCCCCCCNNNNNNNNNNACAGAAACGCGATCTA
GAGGAAAAACTATGGAGGTATGTGGTCGTGCAGCCGTGAGAAAATCGTCTCAAATCAGCC
CTAATTCCTCCATATATATAGGAGGAGGGAGGGGGGGCCTTGCCTTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved