Hordeum_vulgare Locus poly:1:Plant_U3
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:Plant_U3
Hordeum_vulgare
poly:1:Plant_U3
chr5H
Plant_U3, Plant_U3
1001..1221, 2361..2580
3579
ATTTGCTCATATGGTGGTTAATGAAATAGTCGGTCAGTTACATCGCTGAACATTTGGTT
GGAACTGGTTCTTCTGGGTTTTTTACAGGTAAACTTCTGACATTTGTGTTTGCTCAACTG
ATTGTCGAAGGCATATGACCTGTTATTGTCAACTCTTCAGGCCAAATGTTGAGAAACGGG
TTCCCGTCAAGAAGGTTCTTCAAGACAAGCGATACAAAAACAGGGAATTGCAAATTAGGC
ATTGTTGGTCTTAAGCATTACTTCTTTTCAACCACCGAAAGGGATGACCTTTATCACAAT
CTTGTTGTCCAGTTTGTTCCAAAGACAGTAAACCTGATGGTTAGACATACAACAGAATGA
ATCACTCACAGAGTGCCCCTCATTTATGTCAAACTATACACTTATCATGTCTGACATGAC
TTCGCAGTTAATTTTTTTGAACGGTGTCATGCTTTGCACAATTGTCCTCCATCTATAATG
TTTTACAAGAAACTATTTAATATTAACCTTTGCAGTAGGCATACTTGGTACCATAATTAT
CTACATGCTGTCATGTGGAGCTCGTGGTACATACAGTAGTTTTTTTGTTACTAAATACGG
AGTACATTCGTATATGATATGTTCCCTAATTAGTTGCATCACTTTTTTGTCCTCATTGCT
GCTCTACTCTAAACTTATGTTCCAGACAAGCCTACAACTGAGTCAGCCTGTCAGAGTTCT
ACTGTGTTTGGATAGATGTTCTAGTGCAACTTTCTTCTTGTATGGATGTTTAGTTAATCA
TAAGGTCTCATTTTCTTACTACCTCCGTGACAGATGTTTCTCACATGGGCCGGGCTCTCT
CTGCCCAGCAGGCAGCAACAGCCCAACCTCATGGGCCAGCACCCACCACGAGTTCCAGCG
AGGGGGTGTTGCTGCCTAACACTAACACTAAAATTAGTCCCACCTCGCCAGTTTGCAGGG
ATCGGAACCAGCTTATAAGGCGAAGCGCTTGAATTGGTAGCACGACCTTACTTGAACAGG
ATCTGTTCTATAGGCTCGTACCGCTGCATCCTTTACCAATAAGGAGGCAAGCACTTCAGT
CTGGTTGATGCACTCTGACCACTGAGCCAGAGCGTGATTAACGGTCAGGATTTCCCTGAT
GGGGCAATCCAACGGCTGTAGAGGATCGTTCCTGCCTCTCTTCTGACTGTGCAGGGTGGC
CCAGTGGTTGTCTGACAGACTTCAAATCTTTTTTTTGCCTTCTACTACTATTTTTTGACA
GCCAATGCTTCTATGATTTGAACTTCATCAGCCGCTTTTTTTTTAATACAATCCTGGGTC
TCTGAACATAATGTGCGGTTTGTTAGTCCCTGTCGATGCATTTCAGGATTTATTGTAGCT
ACAATTTGGTCGATTGCAAGTACATTCGAAGATTTATAAAAGCTTGCATAGTAGTGAATG
CAGACAGAGTAAAGAGTATATGGCCTCACTGAATAATGAATATGGCTCTGCTTGATTTTG
CGCGTGTGTGTAATGAATCATTTTTTAGTTACAAGCATATGCGATTTAGAAAGTAATTCA
CTCTACCACAGAATTGCAGTGAATTTTACATCCTGGGAATGCTCCATTTGCAAGCATAAT
CTATTTATTCAAATATTGTAATTTATTGTAATTGTTGATATTTTCCTCTATATATTTGGT
CAAACTTAGAAAGAATTGACTTTCATATGACAGAGGACAGAGGAGCAATATATGCAGCCT
CTTTCCCCTGGGGAAAGTGGAGTTTATCAGCCGGTTGAGATTACTGAGGTGAAATCTTGT
ACTCCGGCACTATGGCATTTGAAACTGTTTTATCCTGCGACGTGCATTCTTTACAATGAC
ATGCTCAGCCACAGTGCGTTGCAGTACTCCAACAAGGGAAATGATCAAGTGCATGAATCC
AAACAACACGGGCTTCAAGTTTCCCGCAAACTAAGGCTCGTCCGTGGGCACAAGGTAATG
TGTCATGCACAATTGCTGTTCTAGTTGGCGCATACTTTCGGAACAGAGATAGCTTTAACA
CTGATAAGTTTGCTGATAAACCGTGAGAAATTAAGGACCGTCAAAACAATTTATAGTTTC
TCAGATATCCCCGCCAAGAAAAGCATTCCTCGGATGCCATATATGCAACGAAAAAGAAAA
GAAAAGAAAATGGCACGCTTTTTGTTGTTGGTGGTGAGGGAGACAGTTGATTCTCAGATG
GGCCGAAAGTATGTGCCACGAGTCCTTGTAGCTCCCAGCGAGGGGGTGTTGCTGCCTAAC
ACTAACACTAACATTAGTCCCACCTCGTCAGTTTACAGGGAGCGGCACCAGTTTATAAGC
TGAGGCGCAGCAGATTGCAGCACGACCTTACTTGAACAGGATCTGTTCTATAGGCTCGTA
CCGCTGCATCCTTTACTAATAAGGAGGCAAGCACTTTAGTCTGGTTGATGAAGTCTGACC
TCTGGGCCAGAGCGTGATTAACGGCCAGGATTCCCCTGATGGGGCAATCCGACGGCTGTA
GATGATCGTTCCTGTCAGCTTAACACCTGGCTGGGTGGACCAGAGGTTGTCTGACAGACA
ACAAATCTTTTTTGTGAATTGTCTTGCGTTTCCATTTTTGGGATAGACAATGCTTCTATA
ATTTGAAGTTCATCACTCGCTTTATACAAGAAAAATCTTTTTTGTGAATTGTCTGCGTTT
CCATTTTTGGGATAGACAATGCTTCTATAATTTGAAGTTCATCACTCGCTTTATACAAGA
TGTTTCTTGTATAAATAACTGCAATCAATATCATGGGCCAATGAGAACTGGCCGAGCACT
ATTAGACCCAGGCTAGGCAAGAAATAATTATGCTGTAGGTTCACTTTTTTTTTTCATTGA
TTTGTTTTATGTGAATATTGTAAAGATATTCTGTTAGGGTCTGCTGTGTTGCTATCTTCA
CTGTGTGCAGCCAACCAAACCAAGATAGATTTGAGTGCAACCTTGTGTTGATTAACATAA
ATCCTTCTTTTTTGGCTGCCTTGTTTCATAAGTCTGAATCAATCTCAAACTTATCAATTC
AGTATTTTAAATTGAAATAGAAACTTCATAACCAGATTTATTTAACATGCACTGAGACCA
TTTTCATATGGACAGTTTTTGGTGGTTAGACGACTTGCTGATGGTTCACTTTTGTTGGAC
ACAATGTGCTGTTTGTTAGTCACTGTCGATGCATTTGGGGATTTATTGTAGCTGCAAATA
TATTTGAAGCTTCATAAAAGCTTGCATCTGTAGTGAATGCAGACAGGGTATATGTCCTCC
CTGAATAGTGAATATCATATTCGCAAGATGAGAATTAAACCTAGCTAGCACGACTATTAA
AGTAACAAAGTTCAGTGTATTTTTGGCCTCACGGACTCACAGACATCGTCCACCTGTGTC
CCTATAAATATGGCTCTGCTTCATTATGTGTGTGTGCGTGTGCGTGTGTGTAATGAATCA
TTATTTCATTGCAAGCATATGTGATTTGCAAAAAAAAGTGATTCAGTCTGCCGCAGATTT
GCAGTGTGTTTTACATCCTGGGAATGCATGGTTTTATCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved