Hordeum_vulgare Locus mono:snoZ43
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:snoZ43
Hordeum_vulgare
mono:snoZ43
chrUn
snoZ43
1001..1103
2102
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAACAGAAAAAAAAAATCAAAATCAAC
ATTAGTAAAATTTAAGATAAGAGAAAGATAGAGAAGAAAATTTTGAAATTATCAAAAAAA
CTTAAAAAGATCTACGGATCTTGCGATCGTATAGCACCGGTCGAAGCCGGATAGCAATAC
GTCGATCTTTTACCTCCGCAGACCCGATGGACCAGCGCTAACTGATTCGTGACCGCATCG
TCGGTGATCACAGGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAGGTTCGAGCGGCA
TGCTAAACGCGCGCTGGGCCACCCTCGTCCGCGGCCCATTAGCTAAACGGGTGATTTTCT
CATTGACAACGGGCCACCTAAATTGATTTCGTCCTTCCAGGCTTGAGGTCTAATGCTGCT
AATTCCTTTCTTGGGTGTCTGAGGCATGTTGATTTTACTCATTTGAATCCTTCTTTGTCT
CTGCTTTATCGTTATGGTGTGAGGATATTTCTGTGATATACTTGCTTTGCGAGCATATTT
AATCCGGACCTAATTTCTGATCCTTGGAATTTTTTAAACTGAACTATTCCCAAAATGATT
GAGAAAATTGGACACCATTTGGTTTGTAAGATAACTATTTGAAATAATTCACTTTTGGAG
TTCATAACCATCAGATTTGGAACTAACTCATTACATGTACAAATTTCTGATGAAAGGCTT
CTTACACCACAAATGAAATATTTTAACCCTCATGGGTGTTAAGATGAATGTGGTTCGTCC
ATTATTATCTTGATTCAAGAGGACCATTTGATTTTTTGATAGGACAGTGAAGATTGATAT
TTGGCCAGGTTCGTAGTAACTGGCATTTGTTTGCCTTGCCGACCATACTGCTAGTGCTAT
ATCATCACCTATATTCCGAGTCCTCTAAATTAATTTGTTTGATGTTTGGTGGCTGATGTC
TCATTTGTTTTGTGTGTAAGATCAATATGGTCGGCGATCCATATTTTTACGTTATAAAAT
TGTTGCTTCTTACCTANGCTCCTATAGCTGACGGCAATTACAACAACTTTTGATCCAACT
ATTCGTATGTAGTCTCATGTTCATTTTTGTTCGACCATTACACTTATGATTCTAATATTC
CAAGTCACATTCTTATTCCTGGGATGGCCTACGTCCGCTCTGTGGGACGGAGGAAGATTC
GAATCACATATTTTTCTCTTGCGTATCCATGAAATTCCTCTAGAGTTGTTTTCGCAAAGT
GGTCGGCAGATATTGGTCTGACAACAATTTCCCTGACCTCTTCGCTGAACTCCAGGCTTT
GCCTCCGAATCTCCGCCCCACTAGGTGACTGACTATTGGGGTGCTTGTCTGTATACTATG
GACGGTTCGGAATAAGCTTGTGATTCAACGTTGACCTCCGTGACATGCTACTACGCGGTC
TTTTAAATATGTGGCTTTATGCAGCTTTGGCGGCCGCTTAGCCGTCCGCGAGACCATGAC
GCCGTCAACAACATCATTGCCCATCTTCGGGCGTTGGCTCCCCGCTTGGCGCCGCCGCCC
CCTCCTCCACCACCTATGTATAAAGTTTATGCAGCTTGTTCGGCGCCGCTATATTTTTCT
GTTTCTTTGGGCTTGTTAAGCTGTGCCCTCAGCAGAACCTGCGTACCTTGTGTTTGTGCT
ACTTGCGTGCGCTGTGCGTGTGTGTGTATGTGTGTTTGTCTTGTGGTTATTGTTGGACAT
TATTCTTTGGTGGTTTGTTTTATTTATAAAGCGAGGCGAAAGTCTTTTTCGGTAAACAAC
AATGTATAAGTATTAACACTGCCACTACATCCTATCTTACTCACACTCTTATGTCTCTTC
TATTAAAGGACAATCTGTCGCCGTCGTGATGGTTAGACCTTCTTCTATCAATCGACCTCT
CCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved