Hordeum_vulgare Locus mono:snoZ159
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:snoZ159
Hordeum_vulgare
mono:snoZ159
chr1H
snoZ159
1001..1097
2096
GATCTCCATCGTCATGATCTCCATCAACGTTTCGCCATCGGGGTTGTCGTGCTACTCAT
GCTATTACTACTAAAGCTACGTCCTAGCAAAATAGTAAACGCATCTGCAAGCACAAACGT
TAGTTATAAAGACAACCCTATGGCTCCTGCCGGTTGCCGTACCGTCGACGTGCAAGTCGA
TATTCACTATTACAACATGATCATCTCATACATCCAATATATCACATCACATCGTTGGCC
ATATCACATCACAAGCATACCCTGCAAAAACAAGTTAGACGTCCTCTAATTTTGTTGTTG
CATGTTTTACGTGGTGACCATGGGTATCTAGTAGGATCGCATCTTACTTACGCAAACACC
ACAACGGAGATATATGAATTGCTATTTAACCTCATCCAAGGACCTCCTCGGTCAATTCCG
ATTCAACTAAAGTTGGAGAAACTGACACCCGCCAGTCATCTTTGAGCAACGGAGTTACTC
GTAGCGATGAAACCAGTCTCTCGTAAGCGTACGAGTAATGTCGGTCCGAGCCGCTTCGAT
CCAACAATACCGCGGAATCAAGAAAAGACTAAGGAGGGCAGAAAAACGCACATCACCGCC
CACAAAAACTTTTGTGTTGTACTAGAGAAGACATCTACGCATGAACCTAGCTCATGATGC
CACTGTTGGGGAACGTCGCATGCGAAACAAAAATTTTCCTANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCATGAACACCTATTCTACAATTGCCCAGTGATGCTTAT
ATCTAAACAAATGATGTCCTGATTATACTTGATAAAACAAGTGAAGCTTAATACTATTAT
CCTTGTTTGAAATTTATCTATCCGTCCAATGATATCACTCTGAGGGACACTTTTGATAAT
TTTTATTTTATTTTAACTTGTACTGGACCTCATGCTTAAAGCTGTCCTATGATGATCAAA
CTTAATAGTTTTGTTCTTCTGATGTGCTATCTCATGGCGCGGTGTGGAAGCAATTTGGAG
ACCTGAACTGAGGAAATGCTTAATTGTATCTTTTGTACCCAACAATTACCAATTTTACTA
TTTATTTTATGTTTTTTCCACTTGTAGTTTGTGATGAAGAACATGTTTTGTGCTTGTTGC
TTCACGACTGGATGGATGGCCTGTTGTCAATAGTTTGGCCATCCTGTAGAGGGAAGCATA
GATGAACCGGTGACACTGGCCAGCATTAAACAACATGACGCTCTATCAAACTGCGTCTTG
TTACCTGTCTTCTGGCACATGGATAACATCTACATATTTTTATTTACTAACATTTTATTT
TTTTATTCTTCCTTCGCACGAAAATAAGTGATTTATACAAAACTTTATAAAATTGAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved