Hordeum_vulgare Locus mono:snoU31b
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:snoU31b
Hordeum_vulgare
mono:snoU31b
chr1H
snoU31b
1001..1091
2090
AGGTTTTAAAAAATTGTTCTTCAAGTTTGACTTTTTTCAATATTGTTCTCGATTTAAAT
TTTTGTTATGGATTTAAAAATGTTTGGAAAACTTTTAGAAAATTGTTCGCGATTCCAAAT
TTGTTCATGATATTTCAAACTTGTTCTTGGTTTAAAATTTGTTCTCAAGATTCATAAACG
TTCGTGCTTTAAAATATTGTCCGCGCTTTGTAATTTGTTCTCCGTTTTAAAAAATGTTCA
AAATTGTTTGCGCTTCCAAATTTCTTTGGGGTTTTATAAAATTGTTCTATGTTTCAAAAT
TTTGTTCTCAAGATTCAAAAAATGTTCGTGCTTCGAAATTTGTTCAGGATTCTGCAAAAT
TGTTCCCGGTTTCAAAATCAGTTCCTAAGATTCCAAAAAGTCCGTGCTTTTAAAAATTGT
TCGCGCTTTCAAAAAAAATAAAATTCGTGCTTCCCAATTCGACGCGACAAGCGGCGCATA
GGAAATTCTGGCAGACTGTACACAGCATGCAGAACCGGAACCAACGATCTGGGCCTCCAG
ATAAAAAACGATCTGGGCCTCCAGGTCGGGCCATAGGTTCGCCCGCCACACCACGGCGTC
TAGAACCCACCCGGTCGCCTTTATAAGCGCACGAGACCTCCCCTCAGCAAACCCTCCCTC
GCTGCGCCGCCACTCCCGTCCCCAGCAGCCGTCCCATCTCCTCGTTTTCGCCGGAAACAA
ATTTGCGCATGTTCCTTTTCTTCTTTCGACCAATCTAATGGATTCTTTGTTTGCGTCCGT
GTGTGTGTTTCCGTCGCCTCTTCTTTCGGCTGCGAGAGCAAATCCACTCTCGGCGGCCTT
GTTCTGGAGGCGCAGATCGACCCCCGTGCAGCAGGGGGCGAGATGCATTATCCCGGCCGC
CATCTCCGGCCAGGATCTTCTCCCCTGCAGCGCGCACATATCTTTCCGTGTAGATCGCCG
GTTTTTCCCCACGCCCACCTTGCCTTGCCGACGTGACCACGGAGCGTGATGACATGGATT
TTTGTCGCCCCAGTCTTAGGATCCGGCTCGCCGGACCTGTGCTGATTGACATATGTTATC
TAATCTGATTCCACCGTAAATACCGTTAGCCATCTGGATGTCTCGATCTTTTTTTATATG
AAGGGCTCGTGATTTCAACAATTTGTCCGTACCATCTGATGCATCTGATGATCCACATTT
GCTAAAGCGTCTCTGAGGCCCTTCGATTCGGTTTTTGTTCTTTTTAACGAAATCCTGTTT
CTTGGTCAGGCAACAAATTAGAGTCTCTGATGCGCTGTTTCCCGTAGCGACTTCGGTGCT
GTACGTTGCCGAGAGTGAGGCCGGAATAAGTTATCATGTGTGCCCCGTCCCGCGTACGGG
GTGCGCATCCACTTGTCCGACAGTTTTATCTCATGTTGATTTTTGTTTCCGAGCTCTTCT
TTTTGTGCCGTTCTTTTGCTTTTAGTTAGAGGCCGTTTGCAATAATCATTTAATTCGACT
ATTTGCGATGAGCAAATGCAGGCATATAGAGATTCTCATTACATTTTCTTTTTCATTCTC
TGAACAAAATACAATCAAAACGGGAATATGGATTGAAGCGGTGTAAAACCAAAATGGACA
ACTAAAATTGGATGTAGTTAACCAGACTCATGATGTAAATGGAGAATGCAAAATCTGTAG
CATAAACAAGCTGACAGATCCTACCTACCTATCCGTCGGAGTTTGCTGGGAATTCACAGC
ACAAAACATAAGTAAACGGTTTTAGGGGTATGGTTCACTCTGAAAGAATTCTAACAGTAT
TTAAGTTCGTTGCCGGGTTAAGAGATAAATGCATGATAAAGACATCTTTCAGTAATATCA
TCATGAGGTCAAATCATATTCGATAGCAATAACAAACCAACTACAACGAGTAGTGAGGTC
CTAAGCTAAGCCTTGGCTAAACTGGGAAATTTTAACCAACATGTTTGTTTTTCTTAAAAT
TGCAAAAGTGAACTATGTATTCCTAGAATGTGTTATGATCCCACTATCCCAGTATGCAAG
GGTATGAGGGGAAAACGGGAAAGGTTCGCCGCTGCGGGCTGCGATGGTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved