Hordeum_vulgare Locus mono:snoR80
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:snoR80
Hordeum_vulgare
mono:snoR80
chr7H
snoR80
1001..1129
2128
GTGACTAGGGAAAGCCCCCCCCCCCTCGATCTCCGCCGACGAACCCGTGGTTTCGCCTT
CCCTCCGTCTGCCGTTCCAAAGGCCGGTTACAAGGAACGTATTTCTAGTATCTCGGCTCC
GGCTAGTAGATAGCTAGGATCTTAGTCCATACATGGGTGCCGTTCACACAGATGACAACG
TTTCTTCTTCGAGTCAATCTTTCGGGCGAGTTCACGGAGTGTATAAGATAGCATCCTCTT
TGTAAGGAAAGGTAAAAAAAGTGTAAGATAACAAGGAGTCCTCGAGCAGAGACGCCTCTA
TTTTTCTATTTCATTTGTAAGATGCCTAAATTTATTTTTTGATGAAGCAAAGAGACGCGT
CATTGTTTTTTTATAGTCTATCTAACAATGGTCGTCCAGCCCACACGTAGCGCGGCGGCC
CAGCGGAGGACCAATGCTTCGGCCCGGCCCGTTCGCACCCGAGGGGGAAAACCCTAGAAA
CGTCTGCCACACCTATAAATCCACACCACGCCGCCTCCATGTTCATCCACCTGCGGCTCT
CCCCCCTCCACCCGTGTGCACGCATCGCTCTTTCGATTTTCGTTTGCATCTGTTTCTTGT
TGGTGCTGCTCTAGATGGTAGATGAGATGTTTCTGCGGCGGTGATGACAAATTTGTGGAC
TAGAGTTTCTGATCCCGCCTCTTCAGCGGCATCTGCAGACAACCCCTTGGCTGTCTGAGC
ACCCAGATCCCATCCCATCGATCGATTCTGTTTCTTCTTTAGATTTCTTTTCATTCGGTG
TTCCTTCTCTGCGTTTTCGCCGTCGGCTGGTTTGGGGGTGGTTCGAGTAGCGGTGATGAC
ATCTATGTGGACTAGAGTTTCTGATGCTGCCTCTTCAGCAGCGCCTTTGAAGACAAACCC
TTGGCTGTCTGAGCTCCCAGATCCCCCAAATCGAGTTTTTTGGTTTGTGTTTGCCCTGTT
GATTTTTTTTCTTGGTTTTGAAGTTGATGCGCGCGTCCATTACCGATTCCGTGGGATGAT
TTGAGTTCCTCGCGGGGTAATGGCTCGGACGCTAGACGCGATTTTGTGGTGATATCCTGA
TTGGTGGCGTTCTCGGTGCCAGCTTATCCTGGAAACGCCTCATATATTCACCAACTTTGT
ACTTCTTTCATGTTTTTGGGATCTAAATGATGCGAAACTACGAAAGGGAAATCGTCCGTT
GAGGCGGCCATGTCAGTTCTTTCACATTGATAGGAAGATCTGATAGATTCCACAATTGTC
TTAAAAAACTTTTTCTTGTTTTCGATCTGTTAAGTGTGGGTGTGTATGATGAGATCACAA
GTAAAAATACAGTTATCCCTGTCTTACTTCCTTTGAAGGGTGCTGAGAATACTTTGAATC
TGACACAATGTACTCTGCACTGATCACTTGTTTTTTGCTCTTTTTTATGATTGTGAAGTT
GATCTTGGCCGGTGATGATTAGTATTGGTTGCTGAACAGTCAACATAGATTGTCTGTTCC
ATGACGACATTTTCGAACTAGGACGGTCTGAGGCCACCTTGATCGCCACACTTTTATGAC
TAACCATTGTTCTCCTGTTTTGCTTGTTTTTTTTTTTGCTTCTGTTGTTTGTGGTTGCAG
GGCGATTCTCCTCATGGCTGTAGCCTATTTGGCACTGGACAAGAAAAGTAGGAATAACAT
TATGTCTACATGAGCTATAGCTTGGTGATGTTACACCTATTTGTAATTGTATTTTGCAAG
GAAGATGTCATTAGGTTAGATTGTAATGTAAGTCTGTTTTGAGTGTTCCCAGCATTGTAA
CTTCGGTATTTTGTTGAAATTGCACATAATTACACAACGGAGTTGAGTGAACTACATCAT
GATGTTACCATGTTGAGACAATTCAGACCCATACTCTGTAACTCAACTATTATGTGTTCC
AACTTGGTTCATTTTTTTCCAATGTGTTTGTTGATGGCCATGTAATTTAAGCTGGGCATT
GCAAAAGAGCTAAATCAATCTGACCATATACTTTATGCATATCAGTCTTCTCTGTTATGA
TGTACCTGTGATATTTCAACACTCACTCTGAAGAATTAACATAATTTCATCACTAACATG
TCAGCTGAATTTAATCTGAGCTTTGTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved