Hordeum_vulgare Locus mono:snoR64
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:snoR64
Hordeum_vulgare
mono:snoR64
chr4H
snoR64
1001..1102
2101
CGCTGGGCCTACTTCGTGGATGCCTCACCGCCACCTCCCCAGATTGCAGCCGAGGACCT
CCTCTCCTATCCCCACCACACCGGCGACTTCTTCTGCTCCAGCCCACCATCGACATCCCG
CCTCCCCTTCTCCTTCTCTGCCTCCTCTCCTATCCCCACCACACCGGCTGCTCCGCCCGC
GACCACCCCTCGGATCGATCCGGAGGCCGGAGGGGCGACTCCCCCACTGCGTCGGTGATG
CCGCACGAGCGGGGCGGCGCGGCGTCCGCCGTCCCCTCCTCCGAGGAGGACGCCTTGTGA
GTCTGCCGCCCTAACCCCCCCTCTAGGTCGGTCCAGTAGACGCTCCGTCTGTACGCCTTC
GGTGGTCTCTTTTTGTATCTCAGTTCCGCGGCAATGGCGGTGGAAATTCCGGCCCGTCTG
GTGCCAGATGCGGCGTGGTCCGCGGAACCGCAGCAGGTCCCCGTGTGCTCGCCGGCGTGC
GTTGAATGCGAGCGCAGAGATGGGAAGGGATGAGCAAGTCCGCACTTCTCGACGACCTGA
ATCCAGTCACCTGTCCATGGGGTGGATTGACTGTTGAGCCGATTGGCTGCTCGCAATGGC
TTGAGAAGTTGCACTGCCTCAGTGCAATTGCCATCTAAATTCTGTATGAACTCCACGATA
GCGACCATCACAGTCAGGGGTGGTGCAGAAACAGAGATAGTTAGCTGAGTTAGCATTTGC
GTTATTACTGTATAGTCCTTATCTGTTATGTTTTTGGCAATGACGATGTTCCCTCAGTAT
TTATAATCCTTCTTTTACTTAGGTTTATCGATTTAGTACATGAAGCTCCCCTGTCTAGTC
ACCGGGAGCCCAGGAGCATAGTTAGTAGCACCTTGTATTGTATATTATTGGATGCATAGT
TTGATCTCCCAGTGGGAGTTCTTAGGTTCTGTTGATGCCTGTGGTAGCGAGATTATGGGT
TCTATGTGATTTATTTTCTCAATGTTGTTTCTACGGTTTGCAAAATGCTGTGATGAATAA
TGAAATCTACAATGCATGTCAAACTTCGGAGATGCCATTTATTTGGCATTGATGATATGA
TGTTTCATATTCTGAGCTTTTACTGTACTTTGACACATGTTGGGGATGTAACCTGTGGAT
GACCCGCCCTAGTTGGGCCGGGTTATCCATTGGGCGACTCATCTAAGCATTTAGTTGGGC
CTCGTTTNCGTGTCTCTCCTGCTTAACCCCTTTGAGTCGCCACCAAGGTGCGATGGCTCC
CGTATCAAGTCCTTTCACGAGGACACCTGCCGTGAAAAAACCACGACAGTTGGCGCCCAC
CGTGGGGCCTGCGCACGGTGGAGTTGAGTTCTCAAAGGGAGCCCTACCAGGGTTTGGGAG
TTACGCGACGGCGCTCATGACTCGGAGCCGCCGTGGGATAACCTACATCGACAACCAGCG
ATGGGGACCTGAAGCGAATTCGATTGAATCTGGCTACAGGGTCCCCTTCGGCAAGATCAA
CATCTTCATCGGCATGATCGGATCATCCGTTCCTGAGCCGGACATCTCCACCGACATCGT
CGAGCCGGCCAGGTACGTCCGCCCAGTCATAACACAGAATTTAACTCGCCCGGTCTTTGT
GGGGTTCACGCAGGGATTGGAGGAGCCAGAGCACTTGGTGACTCAGGAAATTACCCCGGT
CAACTGAGATGATCAATCGTCCATGGGCGACTCAGATTCCATCCGGTCTCTTCATGGGGA
TGGTCTCCGAGGCTTGTCGCTGGCCATGGATCCGGAGGTCCTTGACAGAACACGCCGCCA
GATCGCCATCTACATGGCTGGGGCGACTCAGCCCACACAAAACCTTACTGGAGGCGATGG
GACCGGCGAGACGTCGAGAAGTCCAGCCGCAGTCCTGGTAAATTTGGCGGCGGAAATCAC
GAGACTAATGGCGACTCCCCTCACACCAGAGAACCAAGAGGAGATAAACGCAATGTTAGC
AAAGCTCAGAGAGGCGGTAGCAAAGGCCCACCAGGATGCTGAGATGGAGTCCGCCAGGAT
CGAGACTCGACAAGCCCAAATTGCTGCCGAAAGAATGCGCTCAAACACTGACAACTGGCG
GC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved