Hordeum_vulgare Locus mono:snoR31_Z110_Z27
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:snoR31_Z110_Z27
Hordeum_vulgare
mono:snoR31_Z110_Z27
chr6H
snoR31_Z110_Z27
1001..1097
2096
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCTGG
AGGATGGCCGTACTCTTGCTGATTACAACATCCAGAAGGAGTCCACCCTTCATCTTGTCC
TGCGTCTCCGAGGAGGTATGCAGATCTTTGTGAAGACCCTTACTGGCAAGACCATCACTC
TGGAGGTTGAGAGCTCAGACACTATTGACAACGTCAAGGCCAAGATCCAGGACAAGGAGG
GCATTCCCCCGGACCAGCAGCGTCTTATCTTTGCTGGCAAGCAGCTGGAGGATGGGCGCA
CCCTTGCCGACTACAACATCCAGAAGGAATCCACTCTTCACCTGGTGCTCCGCCTCCGAG
GTGGTCAGTGATTGCCCTGGGTACTCTGGTGGGTGGCCCCTGTTGCTCATGTGAAGTGTC
AGTCTCGTTTGTGTCAAGTTCTACAGTGTCTGGTTTCATGTTTCATGGATCATCGAGTCC
CAGTGAGATGTGTTGGTTTCGTTTAAACAGTCATGGATCATCGAGTCCCAGTGCGATGTG
TGTTGGTTTCGTTTAAACAGTTGCTGGTATAGCAGTACGGTCAAGTATGAATAAGTGAAC
TTTGAACTAATCTGCCTATGCTCATTTTACTGTTGAAATTGATATCTTCCGGTTGAATTG
GTTGCCTCTAACTAGTTTTATTCTTTTGCGGCTTTTGTGGTTGCCCATCTGAACTGTAGC
TTCAATTCCATTCTACTTAGGTTCATTTATTATTTGGTTCTATTATGTTCTGTACTTCTG
TGGAGTTTGTTGTGATGAGGACAAACAAGCTTCTTTGCCTTTTCTACCATGGTCATAGGA
ACATGTCTTTCTTTTTCTTGTTTAATTTGATTTATGTGTTCAGTATCAGGTGATGAAACC
TTGAAACAATCTTAGGACACCTTCTGACACAGTGCTGTTATCCTGTGAATGAGAAGTCTA
TATCTTCTGATGATACTAAACGCATATTGTTTGGCTCCCTTTATTTTTCTTCATGTTGGA
ATTACAGTCAAATTTTGAAGTTTAGCTGCAAGTTCTTGGTTTGACTTTGACGTGCTTGTC
TTGGTTGGGATCCCCATCAGTATTCTAATCTGGGCCTAATGGTCCTTCTCTGGTAGCTAC
ATGCATTGACCAGGGGATCTATAATTGGGCGCAGAATCAGTTTTCACGCTTCGATAGGAA
CCTGAGATTCATTCCAGTTAGTCCACGGAGCCTATTTCTGTGATTAAATTGCCTCTCTAC
TATAGTTTGTAGTTGATTTGTTACTGGGAGAAGTATGGCAATGATGAGACCTTATCCTTC
CTTGGATGTCTGAGGGCATGTATGAGTCTCATCTTCTTTCTCTTTTGTTTTCTTTGGTTC
TCATCTGCCTATCTTTTTGCTCTTCATACTGTTGTTACATGTTTTTCCTGGATATTGTGT
ATATATATTGGCAGACGGTGATAAAAAGCATGAACAAAGCACACCATCTTTCAGGACTGA
TTGGTGTGCTCTCTGTGCCATGCTGTCAAATCTGCAATTGACGTATGCCCTCCAGATTTC
TTTCAAAAGATAGTTTTATATTCTTTGGCTATGTTCCTTTTTCTGGAAACAGATATGTTG
AAATTTTAGAGACCTGGATGTTTGTATCTGTTCATGTTTGTCCGGTGATGAAGAACATGT
TAATAATATCATATTTCGGGACTGATTGGTCGCTATGTATCCATGCTACCATTCTACAAT
TTCTGAAGCCAAATCGAACGTCTTGTCTTCTTATAGTCGTAGTTATTGCATCATCTATTC
TTGAGTACTCTATATATTTCCACAAACCTTGGATATCTCCCTTTTTGTAGCATGAACTCA
CATCCTCAAATGTTCTGTTTTGTCAGCGCACTTATGCAATCATGAGTTCTTTCATACGTA
GATTTGGTCAATTCCACAATTCATGCTCTTAGCTTCTGTATCAACAGTCTGAATAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved