Hordeum_vulgare Locus mono:snoR28
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:snoR28
Hordeum_vulgare
mono:snoR28
chr7H
snoR28
1001..1079
2078
GGAGGACTGCCGCGTCTGCTTCCGCGCCGGCGGCGGGGTCATGGTGGAGTGCGATGCCT
GCCTCGGCGGCTTCCACCTGCGCTGCGTGCGCCCGCCGCTGCGCCGCGTGCCAGAGGGGG
ACTGGGCGTGCCCGTACTGCAAGGCCGAGCATGAGGGGAGGGCGATGGACAGGCCCAAGC
CGCCGGTCGGGAAGAAGATCAAGAGGACAGCCAAAGAGAAGCTTCTCGCCAGCGATTTAT
GGGCTGCGCGCATTGAAAGGTTAGCGGCACTAGTTTTTTTTCTGTGGCGAAAAGTTCAGT
GAATTGGTTTCCTTACATTCGTGTGATAATTAGCTATAATTGGTCTCGTTTGGAAAAGTT
TGCAAAATTGGAAGCTTGTTGGCAGTTTGCTGTAGTGATGGGCTGGTGGCTACTGATGTG
CTTTCTGAGAAATGGATGTGGAATAGTGTATCTGAATGGTATAATCGCTGAGAATAGGAA
CTGTAGAACATTGCTTCCAAGTGCTAGGCGATGGTGCATAAACTTAACTTTAGATGTGGA
GTTTTCATTGGAGTTAGGTGCAAGACATTGTTTTGTTTTGTGTCTGATCCCTCCTTCCAA
CAAAACAAGAGTTCAATCTACAATGTTGTTTTGGGATGGTAAAAGAAGGCAGGAATATGC
TTTCAGACATGCTTGTTGTTACAATGATACTTACTGAATAGCAATAACATGTAACAGTTT
ACGGAGGGAGCCAGATGGAGCATTCTGGGCAAAGGTGAGGTGGTACACTATTCCTGAAGA
GACTGCAGCAGGAAGGCAGCCACACAATTTGCGGAGAGAGCTGTATCGTACCAATGATGT
TGGAGACATTGAGGTGATTATCGTTTTTTCCTGTCTATGTTTGGTTCCTCAATTTTCCAT
GTTTATTGATTCTACTTGCTTTCTTCTTGTGGCTTTTACAGATGGAAACTATCCTTAGAC
ATTGTTTTGTCATGAGCCCCAAAGAGTTTAGGGATGCCGCTAATGACGGAGATGATGTAT
TTTATTGCGAATATGAGTATGATATACATTGGCATAATTTTAAGCGTCTGGCAGATATTG
ATGATGAACCTGAGGTATATCTTCTGAAACGTCAAAGTTGTGAAACTCTGTTTATAGAAA
TCTGGATCTTCATTGTGGTATAGTGAATAATCTTGTCCCTGCTCTATTATGTAGACAAAA
GAAGATCCCAGTGACGAGCCTTACAATGCTGCTGATGATTATAACAGTGATACCGATGTA
GATTCAGAATACGATGAGGAGGATGAACCGGCTGCACGTTGCTCAGCCAGAAAGAACCAA
TCTAATGAGAAAATTTTGCCTGCTGTACTAACTCTTCCTCCCTTTCCCTCTATAATTTTG
CATCGCTTTACTGAAATGCCTGTTTGTTTGTAGAATTCATGGAAAGGGAGGATATATGGC
CTGCAAAAGATTGGAATCCGTAAAATACCTGAGCATGTTCGGTGTCATCAAAAGACTGCT
CTGGAGAAGGCGAAAGCTACCTTGTTATTGGCCACTCTTCCCAAGTCATTGCCTTGCAGG
GATAAGTATGGCTATTCATGTTTGTTGCATGTTTCATCAGCTTCTTATGCAAACTGTTAC
TGAGTAGAAGTCTTATGCCAGAGAAATGGAGGAGATCTCGACATTTGTGAAGGATGCAAT
TTGCAATGACCATTGTCTAGGACGCTGCCTTTATATTCATGGTGTGCCTGGTACTGGCAA
GGTAACCAACCTTATTTCATGGCTGTCATGATGGTTTGATTTCTTTTGCTGTGGCTGAAC
GCTAAACTGCATTTTCTGCACCTGCTTTGTTTATTGGCAGACTATGAGTGTACTTGCAGT
CATGAGGAGGTTGAGATCTGAATTTGATTCTGGAGCTCTGAGGCCCTATTGTTTTATAGA
AATCAATGGTCTCAAATTAGCTTCTCCAGAGAATATCTACAAGGTATACAAACTTCTAAG
TTGGTTAAGAAATGTCAAATTCCTACTCGAGCATAGCATACGCATTCCCTTATCAGTCAA
CATAAACTTATAACAGCTCCACTTCATTGAATATGCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved