Hordeum_vulgare Locus mono:8:SNORD24
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:8:SNORD24
Hordeum_vulgare
mono:8:SNORD24
chr5H
SNORD24
1001..1087
2086
TGGAGATGCCCATTAATAGATATCAGTGTGAATGAGTAGGGATTGCCATACAAGAGATG
CACTAGAGCTATAGGTATATGAAAGCTCAAAAGGGAAACTAGTGGGTGTGCATCCAACTT
GCTTGTTCACGAAGACCTAGGGAAATTTTGAGGAAGCCCGTCATTGGAATATACAAGCCA
AGTTATATAGTGAAGATTCCCACTAGAATGTGGTACTAACAAAGCAAGAAGCTCTCAATC
ATGAAGAACATGGTGCTATCATGAAGCACAAGTGTGGAAAAAGATAATAGCATTGTCCCT
TCTCTCTTTTTCTCTTTTTTTGGGCTCTTAGGCCTCTTTTTATTTCATTTTATTTTCTCT
TTTTTTTGTTTTTGGGCTCTTTGGCCACTTTTTTTTTATTCAACACATGGGACAATGCTC
TAATAATGATGATCATCACACTTTTATTTACTCATAGCTCGAAGATCACAATTATGATGA
CTCCATAGGAAATGCCATGGAGTACGCCGACCACAGCGACTCGTCCGCGGCCAAGCATCG
CCGCCGCCGCCTCAACCAGGCCAAGGAGCACTGGTACGGCCCTCGATTGCCCAGAGGGTT
CTCCGTCGCAGTGCATGAGCGCGCCGGCCTACCGCCGGGCCATCAGGCGCGCCTGCTTCG
CCGCTGCCGCCGTCGTCCTCCGCGAGGTCCGCTCCCCTCTCCTCTGCACCTCATCCTCCT
ATTCCAATGTAGAGCCCTGGTTTCTCCGTGCTGCCTGTGCCGCTCGGATTCATCGACGCG
CCCTCGCCGAGTGTTCCAGCGCGGGGATTTTCTTTTGTTTTTCTTTTGTTTTGGCTTGGA
TGGTGAGGGTGAAGAAGAAAATCATTCGGATTCCCATTGATTTGTAAAAAAAATGAGATC
TCTAACCAACTACTACTGACTCGTCATCCAATCTACCAACTGTTGGATTCAGTAGTTTAT
TTCTTAATTGTTTTAGTGGTGCTTGTCCGTGTTTTCCATGGAGCCAGTGATGTTATCAAA
ATATTTTCTACTCTTGATGGGGCAATGACCCCATTTGATGATCACAACCACCAAGATCTC
TGAGGTCCTCCAAATCATCTTTTATTTTTTTTGATGATTCTCTATGCCTCAACATGGAAA
GTCCTCGGATGCACCAATTCTAAATGATGGCAACTCAGCCGCTTCGTGCTTCCCTGTGCA
ACGTTTGTAGCTCCCCTTGTACTGACCTGCTTTTCCATGTATTGCTGTGAAAACAATATC
ACTGTTGCTTCAGATTCGGTTCAGGAAACACGAGAATGCATATGTTTTCAGTAACATGCA
TAGAGTTTTTTTTACAGCTTTGCTCTGACAACAAACCCAACATAATTTCAGTACCATGTG
TGGAGAATATATAAAAAAGGCAAACAAAAGCTAAATCCGAAACTTAGGTTTTGTACAGGT
AGTATAGTTTCAGGCCAATTAAGATTTGAGACCTTGGTGTGCTTCTTTTACATATAAGTC
TGACGAAACAGAAGCAATATTGTTGCCATGGCTAATCAACAACAGGATGCGTGTGAGACA
ACCATACTGATAATCTAACTTAGTTTTTATCATGTGCTGAAAGTTAAAAATCACCTAATG
AGAACACCCAAGGTCATAATTCCATCCTGGCATCTCCTTGTTTTTCCAAAAAAACTTTTG
GAAAACACCTAATCTGTCATATATGTTCTTCTACTTCTTTGTTTTGATTGATTCCGTTCA
TTACCAATTACTGAGTATGATTTGTATTTCTGGTGGTATATCCTGATTGGCGGCATTCTT
GCCGACATATATGTTTTTTTCCTGCATTTGTGATCTGATTTTGGCGACCATGTTACTTCG
AATCTAACACAGATTACTTCTATTAGACCCTTGGATTCTCTGTATGTGCACTGTTCTTTT
CCTATTATGTACAATATCTATTTGATTGCTGAACAAACCATTGCTTGGATCTGGACATAT
GTCAGATTGAATTGGCTCACAAACAATTTTGTGAAAGGAGACTGAGCAGCTTCGACCTAG
TCTCAGATCAGTCTAGGTGCCCTCTGTTCTCCAATGCCCTTGTTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved