Hordeum_vulgare Locus mono:7:SNOR75
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:7:SNOR75
Hordeum_vulgare
mono:7:SNOR75
chr6H
SNOR75
1001..1088
2087
CTATCCATTGTTCAAGACGGAGCTTTCTGCATCCAAATCAACCAATGACATACTTGTGC
TACTTAACTAGATATTTTTTCAATGAAAAATGTTGCGCCCAACATCTAGTTAAGTTGCAC
ATTTGCTGACGTGATCCTGTATTGGTTGTACCTTAACAGGTTATGGCCAACTTTGCGGAG
AAAATTAGACTTGCTGGAAATCAAAATGTGATGGTCTGTGAGCGAGGCTCTGGGCGTTGG
GACTATCGGTTCAAATGTCATGTAAGCTCCTATAAGTTGTATACCTCACATACTTGGAAT
AGCTTAATATCCGAGGGTGTATGTTTTATCTTATATTGTTTCCATATTATGAACTTATGC
TTAGTGAAAACTGACAACAGTCAATAACCAGTGAGAGTATCTTACTATATCATGTCCAAT
AATAATTACTATAGTATTCCATGTTGCCTTGTTTTTTGACACGCTGAGTGTTCCCCTTCA
TCTTTAGGTATACTCTGCTAAGTTTTTATCAGCTTTAAGGTTGAGTACTGGGTTGCGCTT
CTTGGTAGCGTAATTCAGCGATGTACGTTGCCTAGAGATACTTTGGGTTAAGATTCTAGC
ATGAACCATTCTTTGAGATGGTTTTTGCATTCAACTTGGCCATACATATCTTAGCACTAA
ACTGAATTTTGTTTGGATAATGGTATTTGGGATGCCATGAGGTATCTGATGCTAGGTCTG
CTTTCATGGCCTTGTTTCTTGTTAGATTGGCGGACATCGAGAAGCAAACGGGTTTTTGCG
ACACTGGCTGCTCTCATACAAGGAGTTTCCTGTTACTATACCTCGTTTACACCTATCAAC
TATATTGTTCTTTCTGCAGCTGGTTTCTGTGGTTGATTCATCAGTGATGATCAACACTTA
TTAGGTGTCTCATGATACTGTATATTATTAAACCGTGCATCTTCGGCATCTGAAGTCATG
TTTTTGTACCTCTACCCACTCTTAATTTTTTTAGTTGGTTCTCTCTGTGATGATGAAAAC
AGATCACGAGTCTGATGTAATCCATTCTATTAAACCATGTTGACAATCGAGGCATTTGTC
TGAGAGAGCATTAATTCATTTGTTTTTATTTTTATGTTTTCAAATATGATTGTTTTTGAC
ATTAAGACACACAGTTTGTGATCTATTTGATGATAATTTCCTCCTACTTATTCTGAATGT
CCAGTAAGCAACACATTTTGTCATGGATGCTGTATAGTTGTCTTGTCTTAAGTAAATAGA
AACTCCTACACCATTTTTTGTTTGCTGTGAGAAGTGATGATAACATATCCATACCACGTT
TCTGCACTTACTGTGATGATCAATTGCTTCTTTCCTTGGATTATATGGACCTGAGGATAC
TTTCCCCAAATTATCGACTATGACTATACAATGCGTTTATAAACAGGTTTTGCTCTACTA
TGACACATACGCTTTGAAGCTTCAACGTATTAAGAGTGTCTTTATAAACCTGTAGGTATC
AGGTCTTTGGATAGTCGACATTGTAGACAAGTTTTTCTCTACTATAACACATATGTTCTA
TATGATTAACTGACCGATAGGTGGACTGAAGTATGCTACATTGCTATTGTAGAAGAGACG
CTAGTTCTTAGATTATATTAGTTTTACCTTAAGGCTGTAATCCCTTATATCTTGTTAGCA
TATTTTGTAGACATTATTTAGTTCGTTGGTGTCTTGATACTTCTGAAAAATCATTCAACT
TAAGAAGCCACTACCGGCGTATATATACTATATATAGCTAACTGTTGCTAAAATGAGCTT
TTCTTTAAAAGTTTATAAGTTTTCTAGTTTTCCATTCAAACTTATCTAGGCGTTCATAAG
TAAAATGTGCAATCATGCCTTACTCTTTGATATTGCAATTATAGTGCCAGCGCTCCGTGG
GAAGGATTATGGGAAGACAAAAATGAGTTATCCAGATTACACTCAAACAGAGTCACGCCT
CCAATACAAGGTTCTTACGCTGCCATCGATGATTCCTGCATAATACTCAAAAGTTCAGAT
TTAACAATTCTCATGAGGAATTGTAGGACTTGCGGGTTGGAGATGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved