Hordeum_vulgare Locus mono:7:Plant_U3
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:7:Plant_U3
Hordeum_vulgare
mono:7:Plant_U3
chr6H
Plant_U3
1001..1220
2219
ATAGTTGTGATTCCCCAATTTGTTGTTTTTAGGGTACTGAGCCTGAATTTCTGTGTTCC
GGAGCAACCTGTATAGATAGCAGATGCACATACTTGCAGGATTCGTCGACGAGCAGCATT
CTGTTGTTGATCAGGTTATTGACATTCGTCGTCGCCCTGCCTTCACGAACCAAGGGGGCT
GAAAGTTGCTTCCTTCAAATGTTTTGTAGCGACTTATTCCTTACTACCTGTTTGAGAGAT
GCTGATAAATTATTCCTTACTGCCTTTTTCCTTTCTGAAATTTATTATTCCTTACTGCTG
ATCAGCGGATATTGACAAGTAAGTAGAAAACATATCTACCATCATTACTGCTCTCGACTG
TGTATGCATGCGTGGATTACAATCGCAGCAGCGGATATTAATCTTAACAGATAGTAGTAT
CAAATATACTAATTCCTATTCTAAATTGACGCAGATTCATTTAGATACACATGGTTTTAC
ATACTAAAACACATCCATGGGTGTCTAGATAAATGCGCGTCAATTAGGAAAGGAGGGAAT
GCCAGTTAATGGCTGATGAAATTCAACTATGAAAAACTCATCCCAGTGTAGTACTTTTGA
ACAGCTGGGTGAGCAAAGGATATAAATGCAACAAATGTAGTTCACCAAACTAGTGTATGT
TCTGTCTGTTCATGTTTCAGAGTTACAACACGCCTGTTTTTCTCTCAGTTTTGTGCTTGC
ATTTATGTTTTCCATTTCTTTAAAACCTGGTAGTGTGTCTGCTACTTTTGTGATGGTCGA
CTGTAATTTCATTAGACATGAATGCTAAATAAAACAAAAATACAAGGTGTCATGAATAAA
AGTTACAGTAAGCATTGTTCAAAATGAGTATGTATTAAAAGTAGTTCAAAATGAGGAAGC
GCAGCACTGCATGTATGCATGCCTGCTTTCTAATTAGTCCCACCTCGCTTGTTTAGGCAA
CTCTAAACCAGTTTATAAGGCGAAGCACGGCTTACTACAACACGACCTTACTTGAACAGG
ATCTGTTCTATAGGCTCGTACCGCTGCATCCTTTACCGATAAGGAGGCAAGCACTTCAGT
CTGGTTGATGCATTCTCACCTCTAGGCCAGAGCGTGATTAACGGCATTGATGCACGATTG
GTGTCATCTGATGGTTGTAGAGGATCGTTCTTGCCTAGCTCACACTAGTGCAGGGTGGCC
TAGAGGTTGTCTGACAGACTACAAAATTCCTTTTATTTTCCTTTTGCAATTCCTCTGCAT
CCAAGCGCGAACCAAACCATAGATTCAGTGTTCAAGTGCGACCGCAAGTCCAGCGGATGG
ATCATCTGAAATTTGCCACTACTGAGATTCAGAGTAGCACTGAGATAATTTCACTACTGA
ACTGGGAGAGAAAATTGACCAAGATGGGTGACAAACATAAATAGACTGGTTTCCGCAGGA
GTAGTCTTCGTATACAGGACCTGAATACATATTTCAGCACACACAATTTATTTTACATAG
ATATGTGTTGCATGAAGCTCCTAACCCAAACTCTGAAGATGTGGTCACTTGTGTTCTGGT
TAAGAGTAATCGATTGCTTACTTAAGAGTTTGAAACATTATCCAAAAATCCATGACCCAG
ATTATTGCTAGAGCTAGGTAGTAGGACCAACAGGAGCTTGCAAACTGTCTGAAAAGAAGT
CATCAATTGCTTCTTATGTCTGAAATTCTTCGGCTGCAACATCATGGATCTTCAATATTA
GTTACTACTCCTTTGAGAAAACTGCAAGCATGTTAAGGAGGGAAAATGGGAAAAAAGTTC
CCAGTAGTGTTGCTACTTTTTTATGGCAATCCAACTGCGAAATTTAGAGCAAGGCTCCCT
TTTTTCTTGCGGAAAACTAAGTTCAGTGCTTATATGTCAACACTTCTCTGCACTCCTTCA
AAGAAAGAAGGCTTATTGTTTGCTTGCTTAAGACTTTGAAACAATATCATAACAATCATA
TCCAAGATTAATGCAAGGCATAACTAGAAGTACACGTTTTCATATCCAAGGCTGGCACAT
AGTTCTTTGATAGTCTGATTGTACCACTGTCGGTCGGGATTCTGAGTTTATAAGGTTGGT
TCCACATGTTCGATTACTCAAATCGACAGCCAAAGGATTCTACATTTTATAGAGTAATTA
TGTATTCAGTTAAGTAGCGAGAGGATTGACAACATGACCAAGAAACAATACGGCTCTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved