Hordeum_vulgare Locus mono:4:snoZ279_R105_R108
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:4:snoZ279_R105_R108
Hordeum_vulgare
mono:4:snoZ279_R105_R108
chr7H
snoZ279_R105_R108
1001..1110
2109
TATTAAACTAATGTTTTGCTCTGAACTTGAACTCTGAATCATTGCTGGGTTTGTGGGTT
TGACTTGGTTGTGAGCTGCTGCTGTGAGCTGATGTAGCCGTGGAACCATTGACCGGCTGT
GACCACTGCTAGCCGTGGGATTAATTTAAACGCTGGATGAGAGGGGGCAAGGCACGCCGT
GACCCGGCTCTGTCAAGGCGTGGGATCTTAGTCCGAGCCACCTCCGAGCTGCAGCCGGCC
GGCCAGCTAGCTAAGCAGTGTACACATCTGAGCTACAGCCGACCAGTTAGCTAGCTAGAC
GGTACACAATGCATACATCTTAGCTACAGCAAGATAGAGTTCCAGTCGCTTCCCTGTGGC
CGAGCAGGTTCAGTCAGCCACGCTGCGGCCGAGTAGCTCCAATCGGCTACGCTGCGGCCG
ATCGGCTTAGCTGCAACCGAAGGTGTATTATTCTTGTAAATAATGAAAATTGTGTATTAT
TTATCAATTTTAATTTCGAAAATGTATTATTAAAAAAATAGCGAAAAACTGAGGCAGAGG
GACTTCGAACAACTCCTTAGTCCCACCTCGATTGGAGGGAGTGGAGCGTGTGGACGCGCG
GCCTTTAGAGCATCTCCAACAGGCGCCCAAAAACTGCTCCGCGTGCTAAAAGATTCGTTT
TTTGGGCGCCGGACTGCTCCAGCAGAAGCTGCAAAAACGTAGCGCGCGCTAAAAACTTTT
GGGCGCGCGTTCAAAAACGCTATCGCGCGCAGCATATTTGGTACGCCGGCTTGCGCGCGC
AGCAAACTCTGAGCGGCTGCAGATGGGACCGTTGGATCGGACTGGATTGGGCGCCGCACT
AGCGCGCGTCTGTTGGAGATGCTCCGGTCCCCGCGCTTCAAAACTGCTACAGTGACACAC
TAAAAAATTTATTGGGCGCGAATTTTTTACGCTGTCGTTGGAGATGCTCTTAGAACGGGA
CTGGATGCGACCATCAATAGCATGATCCTTCATGCAGGGGAGGGAAATGACGAGAGTGGT
ATAGGCTTGCTAAATTATACGAGAGGGGTGCCCGCCCCCAATAAGCTTGTTACGATACTG
GGGCATCTCTCTGATTTATCATCTGATCCTAAATGTAAAATTTAAAACATTTCTAATTTC
TTATTTTTTGATCTTTGCTTATTTTTAATTGATTTGAAAGTCTTGGTTTCAATTTGATTA
TTTCTTTTTTGCTTGTTTGCTTATCATTTTGTGGTTGACGTTTTGATCGTAAGCCCAGTT
CAGCGTGTATTGTCGGAGTGTACAAAACATCTTATGTTTTTTTTAACACACAAAATATCT
TAAGGAGCCCCTAGGGATTAGAATCCCTTACGTTGTATCAGACTAGTCATTGGCCATAGG
ATGAGAAGGTAATACCTTAGAATGATAATATAACGACATTTTTTTTTGAGAAAGCGCAAA
GGACCTTTGCGGTTCATTATATTGAAAAGATAGAGTTTGTTACAATCCTCCTAGGAGGCA
GGATAATATAACGACATGGAATAATAAAAATTATAGATAAACTGGAGACGTATCAGCATC
ATTAAGCTTAATTTTTGTTCGTCCTCGAATAGGTAAATGATGAAACAAATTTTTTGATGT
GGAATGTTGCCTCACATGTTCATCATATTCTTTTTCTTTCAGCATGAGCATATGGACTTA
TAGGTAGTAGATTGTATCTAGTTTGCCCATAGAATGTGAGATGATGAATAAGGTGTTGGT
TAATTTACATACAACCTTGCTTTCTTTTCTCATTTATTGCATGATATATCATCAAAAATC
TTATATGTCTAAATCTATCAACAAGTATCATACAATCATTGAAGATGCAAGACTCACATA
AAAATTAGCATGCTTTGCATTATTTATTTGCGGCTCTTTCTTTACCACATCCTTCCAGAA
AACATTAAACAACTAGCTAGCTAGGATATACTATGTTGTAAACTGTGATCCAAAATTCTA
CACATCCTTCTCGGAGATCGGCTCAGTGAGCTTCAGACCCCAAGACATGTCTTCACAAGC
CCGGACATGAGGCACTAGATTACCCGTGTCGAGGATTTTGTCGACTTCTTTTCTGGTGCA
CTCGAAGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved