Hordeum_vulgare Locus mono:4:snoZ101
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:4:snoZ101
Hordeum_vulgare
mono:4:snoZ101
chr4H
snoZ101
1001..1099
2098
TCCGCTCTAATCTCAATTTTTTCTTTTGTGAATGAACGACGACCGATATATCCTATGGA
TGATTTTGGTCTCTTGCAACTCTGTCTTGGGCCTTTATTTTATCACTGCATGCTACATGG
TTTGGTAATGGTTCGTGTTATATACTTATGATGGGAGGGATTTTGGCTTATTAATAGTGG
CTATCAATCCAATAACAGACAATGCTTACAAATTAATCGGTGTAGTGCTGCTGTGTACGC
ATACCTTGTAGGGAGTCATTCATCATGTGTTGGCAATTTTTGTGATAAGTTGTGGATGCT
TTTGGCCATGAAGAGTGGATATCGTGGCTCTGAAACTACTCTTTTTATCAGTCTAGTCTT
GATTAAATCCAGATTGTGTGTACTTATAGATGAAGACTTTTTTTTGTTGGTACTTGCTAA
CTGGTGGGCTGTGTGGGATTATGTAAGATGTTTATGTCAGGTGATAAATGATTCTGTGAT
GAATTTGGTGCTCTGTTAAGAGCAATCACTTGGGTTTGTTCACTCAAATGACATCATATT
CTTGCAGTTTAGTTCTTAGTCATAAGTGGCAATGTGTGGCTTGAGTGAATCTTTAGTGTA
CTTTTTTTTGTGCCTGTGTTGTATGACCCTAGTGCCATGGAAGGTATCTCTCTGCCCCCT
CTATGTGTCATGTTATGCTTTGGGTGGGTGCCTTCCAATTTTCTTATTGCACATGGCATG
CATGTAAACTCAAAATTTCTCCCTGTTTGTTTGTGTACGATGAATACTTTTGTTGTCTCT
CTCTTGTGATGATATATGTAGTTGCACTGGCTAGTGAGATGAGGATATAATTACATTATT
GATGGATGATATGATGTCCAATGAATCATGTATTAGCTCTATCTGATCACATCCCATACT
GGTTTTATTCTCTGTCTTGCACCAAATAAAACTTTGCAGTTTGTCTAGTTTTTCTTATTT
AATTTGTCGCCAGTTTTTGTTTTGTTTTGTTGAGAGTGGTGTCGATGCAGATGAGGAGAC
ATAAGTTTATGGGCAATTTGCGTCTGTGGCATTTCTGTGATGCCACACGCATTCTCATCT
TGGAGATCTGATGCACCCACCTTACACACGTTTTTTGTGTTCTTAGTGCCTTTCTTTCAA
AAAATAATTAATTGGTGAGAGATTAGATGATGAATGAGATTAATTTCCCTATTGGCTTGA
TTGGGAGATATGATGGCCTCTACTGAACCGAATATGATCATCCTCTTGTTTCTGAAAGAA
CACAATGTGTTCCTGCTTGCCCCATCATGTTCCTTAATCATGTTAATTGCACTTCCTTAA
TGATGTTCCTGCTTGCTAATTGTTCTTGATTTTTGTGGTTACATACAAACTATTCTCACT
TCTGAGCTTTCATTTTTTTGTTTTGGAGAAGAGCCTTCTCATGCACCGGCAGCAGCAAGT
TTTCTTCCCAAGCAAGGTTTTCTCAAGGTATACTAAAAAAACAATCTAGACCATGTTACT
CATGATGAGAATGATGAAATCATGCTTCTTCTTTTTTGGATACATACAATTGGTTTCTGA
TATGGAAATGCTCATTATTCTAGTGCTAGGGTGGATGGAGATGAAGATGCATTTCAAACT
GTGCTAGAGTTCCATGACCCGCTAGACAGAACTCACTAGTCAACTAATGCTCTATTGGCT
GATGGCTGCTAGTGCTAGGGTGGATGAAGATGCGTTTCAAACTGTGCAAGGAATGCTCGT
GTTGTCAGGAGTTTCGTGAGCACGGTAACTTTGATGAGGTAAAACTTTCGTTACATCATT
AACCTGCTCACTTTTTACCACTGGTCAATGTCTGAAAAACAAGGATCATATAGATTAGCT
TTTCTTAGTTGCTGATTTGTTTTTGAAAATTGGTTACTATAGTTCTTTCACTATTAGCAT
GTACACTTGTCCTTACTGGTGCTGTGCCTCAACAGTCATTTTATTCAAGAGTGCTCTAAA
TCCATTGCGCATATGAGATTTTAACAACTTAATCTGGTTCCACTATCTTGACAAATTTGT
GCAAAATGTTTCCAGGTACTCAACCTATTGATGCACATGGACATGATAACTCTCTAGCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved