Hordeum_vulgare Locus mono:3:snoZ279_R105_R108
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:3:snoZ279_R105_R108
Hordeum_vulgare
mono:3:snoZ279_R105_R108
chr5H
snoZ279_R105_R108
1001..1105
2104
AAACAAGATGGAGGTGAAAACCGTAGAACAAACTTTTATTTAATACTCCATTCGTCTCA
AAATAAGTGTCTCAACTTTATACCAGCTCTAGTATAAAATTGTACTAAGCTTGAGACGCT
TATTTTAGAACAGAGGAAGTAGTAGGAATATGTGAGGAGACCTCCTCCATTTCATTAATG
CCCTTTTTTTTAACACAGTACAGACATATATGCTCATATATATGCGCATACAATCACTTA
TATGAACGGACACACGCATATCTTATCCCTATGAACACTTGTGAGAGACTGAACCGACAT
ATCATCTTAAGATTTACGAAGTTATCGTAGCGTCTCGTCATCGACGGAAGCATCTCCTCC
ATTCAATGCGCATCGTCGAAAATTCTAAAATAAATCCAGAAATAATAGGCGCATCAACAC
TTGAACCGTGGTGGGCTGAAATAGCATTGTTTTTTTAACCACCCAACTATAAGTTAGTTC
GTCATTTCAATAATGCCCTCATGTGTAGAGTTTTTTTTTTTGAAGGCTGATGTGTACAGT
TGTTTATAAAATAGCGTGGAGTAATTCAGTTTCACAGTTGGAACCATCTCCACGCTATAA
GGTAATCAAGTTTTTAGCTTTATTTTTCGTGCTGGAGCCGGAAAAAACTGAGTATTACTC
CGTGAGTTCCAGTCACGCTATCCTTTTCAGATAACCACCGTGAGTTCCACTCAAAAATTA
AATAACCACTGTGAGTCACACGTCCATGGGCCTTACGTCTGACCTGTGGTGCTACACCGC
ACTTGCCGTTTCATTCAGCCCACACACACACAAGCATAGGACCATGGGCCGTTTGGGGAG
TGAGAGCAAGCAAGCATTTGAACCCGTTCGTTTGGCACCAGCCACGGCTGTCTGTTTCTG
TTTAGTCCCACACCGCTTGCTGCAGCGGAGGGTGAGCCTCCGTGAGCTATAAAAGAGTGA
GCGGGTGAGCCGTTGAAAAGCATGATCCTTCAGGCAGCAAAGGGAGATGATGAGCGGTGT
CAGCTCGCTATATGCGAGAGGGGTGTCCGCCCCAACTAAGCCTGTTACGACAATGGGGCA
CCCCAATGACTTACCATCTGATCCCGAATTTATTTATTTTTTAAAAATTTCTCTTGCTGA
GTTTGCTGCTTTCTTCTCTTTTTCCTCTTTGTGTTTTTTCTTAAAGAGGAATCGTCTCAT
ATAGATGGCAATTTGAGTCTGAATCTACTACTGCTACTCCTCCTACCTGCTGTTATTTGC
GCACATTCTGCTAGACTGATGACCAGCGTTTGCTTGATCAACCATAATTTGTGCTCGGCT
GCATTGTTAGAGGGGGTCCTTCTTTTTTAAAAAAATTAAAGGATGTCCTGAGAGTGGATT
CTTAAAGCACGGGCTTTCTGACACCCATTATCCTTACCTTTCAACATTGCTTTGAGATCC
ATACGATACAACTAACTTACAACATCAGATTTTCTCTTTGTTGCTTCATCTAAATAAGAC
AACGTCTCGACTTCAAACTTTGCAAGACATCAAAACAATCCAACTACAATGTGGGAAAAA
ACTTTCATATTTTTCGGCCCAACATAAATATACGAAATTACCTTTTTATATTAAAACATG
ACATTTTTTGTATTTATGATGCATGAAAAAATCTGGTGTTGTAATGGCTTCGACGTTTTC
TGGATGAGATGAAGGACTGAATCTCCCTTGTTTTGTTTATCATGGTCTGCTGCTGAATGA
AGCCTGAGACGTTTTACAGAGCTTGTTGTGCCTGCATGATGCTGGCATCAAGGAGCAACT
AGTGCGCTTGTTTTTTTATAGAGCTCTATATACCTTGCTTCTTTTCGAATGTTCAGTTTA
AAACTCGAAGTCAGTTGCCTGATAGATGATCTTTCTTTGCAGTTTATGGCCCAACGTGTG
TTTGTTTGAATGTCCTGTTGTTTGTTCATTCATGCATGGCGGCTCTGCACATTACTCCCT
CCGTTCCTAAATATAAGTCATTTTTAGAGGTTTTACTAGGGAACTACATACAGATGTATA
CAGACATATTTTAAAGTGTAAATTTCCTCATTTTGCTCTATATGTAGTCTCCTAATGGAA
TCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved