Hordeum_vulgare Locus mono:2:snoZ221_snoR21b
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:2:snoZ221_snoR21b
Hordeum_vulgare
mono:2:snoZ221_snoR21b
chr4H
snoZ221_snoR21b
1001..1093
2092
GAAAATAATTTGGTGTGTTGTTACTTGCTAGCTTAGCTTCTTCTCCTTGGTCACCTTTA
AATATTATAAAAGATTGAATTACAACAATCATGATTCCCATTCCGCTCTTTGGCAACCAT
AAATTTCCTATATACTTTTTGTTGTTCCTGACTGCAATGCTGCTAATGGAAGGAATGCCG
CTCCAAAAGTGAGTCATCGAGACTCGACATGGCAATCACGTTTCACCAAAAAATATTTAT
ATTTTTTTTTGTTTTCTGCTTGTGAATTTAAGATTTGTCACTGATGGATTATGTTTGCAA
AATGGATGCTTTGTGGATTCAAGCCCATGTTTCAGGGTGAGCCACTTGATGAACCAGATA
TAATATGACATCAATCGACAAAATCTAAGATATTGTATAAATTATAGTATGAGAAAACCA
GATATAATGTTGTTTAGTGCATGTTTATTTTAATAGTAAGGTCAATTGAGGTGTTCTTTC
TTGTGTTTACTGTTGTATATTACAAATCTGAAGTATTCTATATTATGCTTCCTGGACTAA
TACATGACATTGTGCTTCCTAGACAGGTAAAATGCTATGATTAGAAAAGTCATGCACCAC
TCTGGAGAGATTTATCTCTTTGTGGTGATAGAAAAACTAACAACCCATTTTATAACTGAG
CTGTCTCATGGATACCTACTTTTGTAATTCTTGTTTATTGGCCATTCTTGTTATAGATGT
AGTACTTTTTTTAGAAAATTTTTCATGCTTTTTCCATTGGGAAAATGTATTAGTTTTGAA
AATTAAAGTCTTAAGATAATGGTTGGTGGAATAATGTGCAGACCAGATGATGGTTGTTTT
TCAGGTGCGGTCCTACCATTGTCTCTATTGGTTGGTACTGTATTTTTCCTTTAGCCGCAC
AGTCATTCAATTTGTTTCCTGAACCTTGTTGCATTGCATATGAATTTCTTGGTTTTCTAT
TATTAATTTTGTGTGCAAAATAGATGCTTTGAATAAGCAAAAGGCTATGATGAGAAAAGC
CATGCACTACACTGAAGAGAACTATCTCTCTATGCTAATAAACAAACTTACAACCCATTT
TATATCTCAGCCGCCTCATGCATACATGCTTTTCTATTTTCTGTTTTTTTATTTCCTCTT
CTCATGGTATAGTCTAGTGCTTTTTTAGAAACTGTTGTCAGCTTTTGCCTTCGGGAGAAT
ACTGTAGTTTGGAACTGAAACTCTTCTATGATTAACTAGATTTGTTGGATAATGACTGAA
CTAGATGATGAGCGTTGACTATGAGCGATCCTACCATGATTGTAGCCTTGTACCAATGAT
ACAAATGGAACACTCTGCATATGTATGCATGCAAAATGGTTCTTCCATTTAGCAATATTG
AAGTACATTTGTAAAGTGCCAATGAATGTAAGAGAATTAATGATACAATGATACCAAGGG
CTTATCCTTTTTTCATTGTTATTTCAAACCAGTCCAGGACACATGGATATAAGGATTAAT
TGTGATTGGGAGAGAGGAATGGCGATGCTGAGTACAACTACTCTAGTTCAAGGTGTTCCA
ACGCACAGACAAGTAGGAGATGAGGATGAACATGTGTGATCATAAATCACTTGATTTGCA
TTACTCGTTCACAATACGATTTTGTTTAGATACATAGCTCTCATTGTTAAAAATATATGA
TATTACTAAAACGATAGAAAACGTACGGCTTAGATGTAACAACAGAAAACGTACGGCTTA
GATGTAACAACCAAAAAATAGTTAAAAAGAATGGCTATGATTTGGATAATAGAAGTACGC
ATAAGCATGTTTCCTTATCCCATACGATTTGTAAGGGTAAAAAAAGAATTGATAGGTGAA
TTAGTTAGACTAGCATTACACGATGAATTCATATGCAAGAACCAAGATGGAGTCCGAAGG
ACCAAACACATATAAGTGTCTTTCCTTATTGTATCATAATTGTGTTTTACGTGAACTCAC
CATTTAAGCACTAATGATAGGTATTGCCTCCATCAGAATTTTATATTTGTGGGCCAAGAG
AAAAACATACATGTACTTTTTTGGCTCCAGTAAGTTACATGCTAATAAAACGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved