Hordeum_vulgare Locus mono:2:snoR117
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:2:snoR117
Hordeum_vulgare
mono:2:snoR117
chr3H
snoR117
1001..1079
2078
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCTATATCTATATA
TACCTATATATACCTATACTAATTATAGGCTCCCTAAAAATGCACACGTAAATTAAATTT
TATGATCCATTCATCTAGCGTTGGATCGAGTTATTACGGTGTAGATTCAACCATAAAATC
CAGAGTCGAAAATTATTTTTTCAGCTGTAAAAAAAGAAAAAGAAAAAACATATCTCAATC
TCTACCTAATAATAAAGAAAATATTGCTTCTCGTTGTCCGTCTAAAAATTACACCTAAAG
TTGCCTGAAATTACCCACTATGCCACACATAAATTACCCCCAATGTTGTGTTCTTATAAG
TAGTGAGACCACATGGAATCACGTAGACGTGCGAGCCTTAGTGGGTACAATCCCTCTTCT
TCAGATTTTCTTCCCTCTTTTCTCTCTTTTTATGCTTATTAGTAAATGTGTACGCGTATA
TCCATATCTCAATGTATGTCTATGTTTCTCAGTTTGAGAAAAAAAATCTCACTTAGAAAA
GTAGACCTCACATGTCCAACAAAAACAAAGAAAGATAAAAGCAAAGATATGTCCAGTTGT
ATCAAGATCTGCATTAAAACCCAATATTTGAAATAGTGAGATAATCACCATAAAAGTAGG
CCTATACTATAATTAGAGGATCACATCTAAATCACNNNNNNNNNNNNNNAAAAAGAAAAA
GAAAATACCCACATGAATCTTCACGCAAGATCAATGATATAGGACTTACATGTGCAATAC
TTATCTCACGTTTAGATGTGTTTTAGCAAAACTGCTCGTAAAAAGAAAGGTGAAATATGT
CATTTTTTCTTTGATATGTACATCCGAGACATTCTAGGCTGAAGCTACTCCCGAAAAGGC
TGGAGTTTAATCCCCCACGGAAACAACTGTATCAATCATGAGTTCGTGTATCCTTCTCTT
TCATGAATTCCCTCTTGAGCATCAATCTACTCTTTTTTGGAGGCCTGTGATGTGAAAAAA
TTGTCCGTACTATCTGATATCTTTGATGATCCACATTTGCTAATGTATCTCTAAGGCCCC
TTGTGTTTGCTATCTGGTTTATGACTTTTGGTTTTGATTTTTTGCTACACTTCTTTTGAT
TGCCATAGTCAATCTCTGTTTTCTGAGTAGCAGTCATGATTTGAAGGCAGGCAACAAATT
AGAGTCTCTGATGCGCTAAACTCCATAGCGACTTCAGTGTTGTATGTTGCTGAGGGTGAT
TTTTGAATGAGATATCATGCGTGTGTCGTCTCATGTATGGCGTACACATCCCTTTGTCTG
ACACTTCTTAGCCTTGCCCTTTTTACGCAAAAAACATATGAAAATATTGCAGCTGGATGC
GTTGTATTTTTTCATTGCTCATTCTTGTTTACTCGGCCTTGCCTGCATCATGTTTTGTGT
GTGTTCATGCAGAAATCTGTTTGGGTGTCTTATCAGTATGCAATCAGTCCATACTATACC
CAAAATGATTCTCTACTAAGAAGGAACACGGGATGCAAACTACTGCACTGTCCGTGAAGA
CTGAAGGTCAAAATTAATTTACAACAAATTGTTTCACACACAAGCAAGGCAGATTCGTGA
TGTAATGGCAGGGGAAGGATTAGGACACAGGAGGGGCTACGCCCTACGCTATGCTACGGC
AGGAGGTTGATGTAGGCAAGGCAGGCACTTCACAAATCAGATGCCCTGTAGAGGGTGAGC
AGGGAGAGGAAGAGGTTGATGACGTCGAGGTAGAGCGCGACGGCGGGCCAGACGTACTCG
TCGTAGGAGTAGCGCTTGATGAGGTTGTCAGTGTCGTAGATGATGTAGCCGCAGAAGACG
AGCGTCGCCAGCCCGCCGTACACCATGAGCGAGATGCGGCCCAGCGGGAAGAATGCCTGG
ATGAGCGCGAACACCATGAGGATCATCACCGCCGCGAACAGGAACGGGCCCAGGAAGTTG
AAGTCGTGCCGCGGCTCGCCGCCCAGAAGGTGTACGCCGTCAGGCTCACCACCACCACCG
CCGTCAGGATGGCCGACTCCAGGATCACCTCCCCCTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved