Hordeum_vulgare Locus mono:2:snoR101
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:2:snoR101
Hordeum_vulgare
mono:2:snoR101
chr7H
snoR101
1001..1053
2052
ACGCTAACTGACAAACCCAAGGAGACGGAGGAAAACCTTCTAAGGTTTCTAAGAGATCA
AAATTTCTGTGACCACATACTGTTTCCATACAACTTCAGGTGAGGGTCTTTACTCTGTTG
TGTCCATTCACTTATAAGTGTAATTGATAAGTTATATATATATATATATACACACACACA
CATGTGCAGCTTTCATTGGATTCTGTTGGACATTCAAATTGATAAGGGAAGAGTTGATGC
CTTCAACCCATTATCGAGACCCTTGGAACAGTTCCAAAGCCTGCAGGACATGCTCCAAGG
GTAATTTGAATCATTCTTGCGCTCTATCGGTCTCTTTCGATGATTTTCTGATATATCAAT
TAATGAAAACTTAGCAAATCATTATCCTTGTCGGGCAGGGTTTGGAAGCGGTTCAAGTGC
GTGACTCCCGGTAACTTTCCTGAGAAGCTGACCTTTAGAGCGGCTCAGGTAAGTAGTAGT
ATGATATACTTCTATTAATTTTCAATACATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCACTCCCTCCCGGCTAAGGTATGCCCGCCTCCCAAAACAGTAAGCGCA
TACATTTGTTGCGGATTTTGTTTCCCGCATGAGGGTTTCTTCACCCCGGACCCTAATTCT
ACCGCTCCAAATCTTAATTTCATGCCCAGATTGGTTGGGAAATATGTTAATTTGAGAACT
TGTGTACTTGAGGAGGCTTCGGCTGCCATCATTGACACCCCCCCCCCCCCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCGCTTGATTCCTTGTGCACATGCAGATCTCTGAACTTCAGGTA
AGTTCTTATGCTGACAGTATGAATCATTGATGCACTGTACTATGTTTTTTTGGTATTTAA
GCGTTGATTTATTGTTTTCTTGTTACTTTGGAAATGGACAGGTACTCCTGCAAGCATAAT
CCCTGGTACTCCTGCATATCTGCTGAATCCCTGGTATCCTGCCCGACATGTATATTTTGC
CAAATGTGGGATTATGCATACATGGATTCTTTTGCTTAAGCATCTTCTTAAATACCACTA
ATTGGATTATGTATGTTGGATCATGCACCAACGTATTCTCTTGCAAACTCGTACAGAAGT
GCTTCGACACTTAACATTCTTTGTAGTCCGGTAGTTCTCAATTTCTCATATATGGCCATG
CTGTGTCAGTCTACTACTCTAACATATCATCTCCAGTATGCAACAGTAGTACTGTCTAAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCTTATTGCACCCCCATT
AAGAATAAATACGTATCCGGTTTGCGACTTAGAGTCGTCCGGATCTGTGTCAAAGCTTGC
ATCGACGTAACCTTTTACGGCGAGCTCTTCGTCACCTCCATACACGAGAAACATCTCCTT
AGTCCTTTTCAGGTACTTCAGGATATTCTTGACCGTCGTCCAGTGATCCACTCCTGGATT
ACTCTGGAACCTACCTGCCATACTTATGACCAGGCTAACGTCCGGTCTAGTGCACAACAT
TGCATACATGATAGAACCTATGGCTGAAGCATAGGGGAGGAGCGCATATGCTCTCTATCT
TCATCAGTTGCTGGGCACTGAGTCTTNNNNNNNNNNTAGGTACTTCAGGATATTCTTGAC
CGCTGTCCAGTGATCCACTCCTGGATTACTCTGGGACCTACCTGCCATACTTATGGCCAG
GCCAACATCCGGTCTAGTGCACAACATCGCATACATGATAGAACCTATGGTTGAAGCATA
GGGGACGGAGCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved