Hordeum_vulgare Locus mono:2:snoJ33
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:2:snoJ33
Hordeum_vulgare
mono:2:snoJ33
chr2H
snoJ33
1001..1081
2080
GAGGAGAGACGGTTTGGGCTTATTTGGAACGAGATAATCGCCAAGTTCCGGGAAGAGGA
CATCGTAAGCGATCTTGAGGTGGAGCTTCTTCAGCTGCTACCTGCGCAACTAAATGTGCG
TGTAATCCGGTGGCCGTGCTTCTTGCTATCCAACGAGCTGTCCCTTGCACTTGGTCAGGC
AAAGGAATTCAAAGGAGGATCTGATCGCAGGCTGTGGAGGAAGATCTGCAAGAACGATTA
TCGCCGTTGTGCGGTTATTGAGGTATATGACACCACAAAGTACTTGCTGCCAGAGATCAT
CGAGGACCGAACCGAGGATCGTCGCATCGTGACACAGTTGTTCCATGAATTCGATGGATC
CATGGAAAAGGAGAGGTTCACGGCCGAGTATAACATGTCGGTGCTCCAAGATGTCCATGC
CGAGCTCGTAGCTTTATTCAGCCTGCTGCTCAAGCCCAACAATGATATGTACGAGATTGT
CAATGCGCTTCAGACTCTCTATGATGTTGTGGTTCGTGACTTCCGGGTCGAGAAAAGAAG
CAGTGAGCGGCCCACCAAACCTCTTTTTCTGGACAAAATCCTGCTGCCTGCTTTTGCTGA
GGAGAATGACACCTTCTACAAGCAGGTGCGCCGGATGCACACCATCCTTACCTCAAGGGA
CCATATGATCCATGTCCCAAAGAACCTTGGAGCTCGCCAAAGGATTGCCTTCTTCAGCAA
CTCATTGTTCATGGACATGCCACGAGCAACCAAGGTAGACAAGATGATGGCCTTCAGTGT
CCTCACACCGTACTATGATGAAGAGGTCCTGTACACCAGAGACCAGCTTTATAAGGAGAA
TGAAGATGGCATCTCGTTATTATACTATCTGCAGCAGATTTACCCGGATGAGTGGGACTT
CTTTGTAGAGCGCATGAAGCGCGAGGGGATGTACAGCGAAGAGCAGAGGTCAAGACATCT
CCGGCAGTGGGTCTCGTACAGGGGACAGACGCTATCCCGCACCGTGAGGGGGATGATGTA
TTACTATGAAGCTCTCAAGATGCTGACTTTTCTTGAATCCGCATCTGAACAGCAACAGAG
GCCGACGACCTCTGAATCCGCGTCTGAACATCCTCCATTGATTACTCGATCGAAGAAGAA
TTGTTCAACACCAGTTCTGGCTTCTACTTCCTCTAGCAGCGCATCTTCTTCACGTGCACC
ACCAGCACTGAGCAGAGCAGGCAGTGGTGCTGGTGTGAGCTCCTTGTTTCAAGGTAGCGA
TTATCGGACCGCCCCCCTTATGAAATACACTTATGTGGTTGCATGCCAGCTTTATGGTCG
GCAGAAAGCTAGAAATGACCCCCGTGCTGTTGAGATACTGGAGCTGATGAAGAAGTACGA
GGCACTGCGTGTCGCTTACGTTGATGAAAAACGCTCGGACGCTGCAGGTGCAAGTGAAAC
AGAGTACTTCTCCGTCCTTGTGAAGTACGACCAACTGGTCCACAGGGAGGTTGAGATTTA
TCGGGTTAAGCTTCCTGGACCGATGAAGCTTGGTGAAGGCAAACCGGAGAACCAGAACCA
TGCGCTCATCTTCACAAGGGGCGATGCGGTTCAGACCATCGACATGAACCAAGACAACTA
CTTTGAAGAAGCTCTCAAGATGAGAAACCTGCTCGAGGAGTTCAATCCTTATCGTCCGTC
AGCTCGCAAGCCAAATATACTTGGAGTTAGGGAGCATGTGTTCACCGGTTCTGTCTCTTC
CCTGGCCTGGTTTATGTCTGCCCAAGAAACATGCTTCGTCACTCTGAGTCAGCGTATCCT
TGCCAACCTACTCAAGGTTAGGATGCATTACGGCCACCCCGATGTGTTTGATCGTCTTTG
GTTCTTGGGCCGAGGTGGTATTAGTAAAGCATCCAAGGTGATCAACATCAGCGAGGATAT
ATTTGCTGGATTCAATTGTGCTCTCCGTCGAGGCAACGTGACACACCATGAATACATTCA
GGTTGGTAAAGGAAGGGATGTGGGGCTCAATCAGATCTCCATGTTCGAAGCCAAGGTTGC
TGGCGGCAATGGGGAGCAAACCCTAAGCAGAGATGTCTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved