Hordeum_vulgare Locus mono:12:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:12:snoZ103
Hordeum_vulgare
mono:12:snoZ103
chr4H
snoZ103
1001..1096
2095
GGAAGAATAAAAGGTTATCGAGATCAGATATTACAGAGAATAAACAAGAACACCTAGAT
TCCCCGAAGAACATTGCTCTGGGCGTTGGGACTATCGGTTCAAATGTCATGTAAGCTCCT
ATAAGTTGTATACCTCACATACTTGGAATAGCTTAATATCCGAGGTTGTATGTTTTCTCT
TATATTGTTTCCATATTATGCACTTATGCTTAGTGAAAACTGACAACAGTCAATAATCAG
TGAGAGTACCTTACTATATCATGTCCAATAATAATTACTATAGTATTTGATGCTGCCTTC
TTTTTTGACACGCTGAGTGTTCCCCTTCATCTTTTGGTATACTCTGCTAAATTTTTATCA
GCTTTAAGGTTGAGTACTGGGGTGCGCTTCTTGGTAGCGTAATTCAGCGTTGTACGTTGC
CTAGAGATACTTTGGGTTAAGATTCTAGCACGAACCATTCTTTGAGATGGTTTTTGCATT
CAACTTGTCCATACATATCTTAGCACTGAACTGAATTTTGTTTGGATAGTGGTATTTGGG
ATGCCATGAGGTATCTGATGCTTGGTCTGCTTTCATGGCCTTGTTTCTCGTTAGATTGGC
AGACATCAAGAAGGAAACAGGTTTTTGCGACACTAGCTGCTCTCATAGAAGGAGCTTCCT
GTTACTATACCCCGTTTACACATATCAACTATATTATTCTTTCTGCAGCTGGTTTCTATG
GTTGATTCCTCAGTGATGATCAACACTTATTAGGTGTCTCATGAGACTGTATATTATTAA
ACTGTGCATATTCGGCATCTGAAGTCATGTTTTTGTATCTCTACTTATTCTGAATGTCTA
GTAAGCAACATATTCTGTCATGGATGCTGTATAGTTGTCTTGTCTTAAACAAATAGAAAC
TCCTACACCATTTTTTGTTTGCTGTGAGAAGTGATGATATCATATCCATACCACGTTACT
GCACTTACTGTGATGATCAATTGCTTTTTTCCTTGGATTATATGGACCCGAGGATACTTT
CCCCAAATTATCGACTATGACTATACAATGCGCAAATGTAATCCCATCAGGATTTCAAGC
CAGAAATCTGATCCATCTTTTATGTTTTACTATTGTCTTCTTGTTAATATTTTGAGTGCT
AGCCAGGTTTCCTTTCTGCAATCTGGCTAAAGAATTACCCCAGTTGACACCAGAAATCAA
CTCAACATCAAAGCTCTATCTAAATCAATAATGTTCTTTGGTAGTCCCTTTTTCATGTTT
TCATTTGATTCGATCTAAAACTTCTAAAGGTAATAAATTAGAGTCTCTGGTGCACTTATT
GATAGCGTAATTTAGTGATGTATGTTGCCGAAAGGATTTTTTGGGCTAATATTCTTACAC
CCTGGTTTGCACTTGGTTATCACAGTAATGTGGAGTAGCTTGTTTTGTATTATCTTACAT
GTCTGCTAATTATTGTGTCATTGACTCCTGCTTGTGTCAATGCTTAAATTCCTCTAGTAA
AGCGAAAATACCATAAAGATATTAAGTTTGCTTGTCTGCATTTCCTTTGTCCAGAATTTC
CTGGAACAATCTTAGATAGTTTGAAGTTTCATTTTCAGTTTCTGTGACCTGTTTAGGTTG
GACTAATTGTACTCCAGAATTTATATCTCAGGATTTTTAACATCATCTTCAAGATGAAAA
CAAATCTTTTTATTTCTAATATTTTTTGTATTTGTTTCCTTTTGATTGATTCATGTGCAG
TGTAATGTTCTTATAGGTTGATAAGTTGTGGCATCTCGAGCATGCCTCATAGGAGAGCGG
AATGAAGTCCACTGTACTGTTGGGACTGTAGCAGATGTGCCATTGTTCTATTGTGTAATT
TTGTTCATTCTTGCTATATTCCTGTGTAAGGAAATGTATTCATGAGATGATTTATTGTGA
TATGTAAACTTGGGATATATATTTTGTCATGTTATATCATGGATGATTTTAATTTGACTT
GGACTTTTCTTGATTTCAATATGAAATAGTGTTGGATTTAATACTGGACAAATAATTGGG
TTGAAAAGGCCCAACAAATTGAAATGAATCCAAATTCTGGAACAAAAAGTTGCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved