Hordeum_vulgare Locus mono:1:snoZ199
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:1:snoZ199
Hordeum_vulgare
mono:1:snoZ199
chr2H
snoZ199
1001..1083
2082
TGCCAGACGCGGCGGAGATGCGCCCGCACGCGGACACGGGCGAGCGGCTACGAAGCGCG
GAGATCCTGTTCTGCGGCGAGGTGTAGGGCCCCGAGAGCGTCGCCTTCGACCCGCGCGGC
CGCGGGCCGTACACGGGCGTCACCGACGGCCGGGTCCTCGTCTGGGACGGCGCGCGTTGG
GCCTACTTCGCGCACGCCTCACCGACACCTCCCCAGATCGCAGCCGCTGACCTCCTCTCC
TATCCCCACCACACCGGCGACCTCTTCTGCTCCAGCCCCACCGTTGACATCCCACCTCCC
TTCTCCTTCTCTACTGGCTGCTCAGAGGGCTCGAGGACCCCGGCTTCGGCAAGCGTCGGA
ACAAGACCCACACGCTCTGCATCAGCTGCGGCCGCCGCAGCTTCCACCTCCAGAAGAGCA
CCTGCTCCTCGTGCGGCTACCCCGCCGCCCGCATCCGCAAGTGTAAGCTCCCCACTCCTC
CTCCCTCCCACGTCCTCCGTTCTAGATCTCCAGCTCTGTTACTGTTATGCACCACGTTCT
TGATGTTACCACGGGCTTATTAGGATGTGGTCGGCGTCTCGCCGTGGTTGTGAGAATTGA
GACGTTAGCAGTTGATTCAGTCATCTCAGTTCATAATCTATCTACATGCTCTGTTTGGAT
GATGGTGGTTGGATGCATAGTTTGATCTCCCAGTGGGAGTTCTTAGGTTCTGTTGATGCC
TGTGGTAGCGAGATTATGGGTTCTATGTGATTTCTTTTCTCAATGTTGTTTCTGTGGTTT
GCAAAATTCCGTGATGAATTATGAAATCTACAACGCATGTCAAACTTCGGAGATGCCATT
TATTTGGCATTGATGAGATGATGTTTCATATTCTGAGCAAAAAAAATCATATTTTCTTCT
GGATAATTGCGAGACTTTAGCTTTTATTCGTCTTCTGTGTTTCCCTATCTCCATAGTTAG
TGGTGAGTACTTGTGTTGTCCATGCATGCTTTTGCTTGTGTGGTTCAAGTGATGAGGAAT
AAACTGCAACAATATGATGGAGCTAAGCTCCTCTGATTCTTAGTATTTAAGTATCCGATG
ACACCTCACCCTCACCATGTGTTTTTCTATGATGTCAACATACTGAAGGAAGTCCTGCCC
GTTTCTATCGATCGTAATCTGATATGATTTGATGTGTTGAACTGTTGTGTTGGTCGTCAA
TTTCAGTTGGATCCGGTGAGAAAACTAAAATTTTATGTGACAAGAACCCAGACATGCATG
CATGCACCGATTTTCTTTTTTATGTCTGAAATGATTTTCTTTACTGGTTTTATGCACGTC
CTATACCTTCATGTATGGCTCGGGTCAGCAGAAATATGTTGCTTGGTTGATTTTTTTGTA
TGATGTGATGTTCGGTCACTTGCAAAAATAAAACATTTATTCAAGTCAGCGAAAATATGT
TTGCTCACTCACTTAATGTAAGTTATAGTTTGTATATGTCATCTGTCATATGTGTATATG
TATAGGTTTATCTTACTTGTGTTGTGGCTGCTTATGCTTTGCAAATCCTCTTAATCAAAT
CATATAGTATTTGAGCTAATAGCATGACATCCTACCTCGGAAAGGTGGGGGGTTGACCGG
TTGGAAAAAAAAGAAAAAAACTGTATCATGTGTGCAGAGCATAGTTATCACATGAGACGA
TGAGTTGTATTAGGCACAGACAAGTACAACTTTACTAAAGTTGAGACACTTATTCTGGGA
TAGAGGGAGTACATTTTTATTTCTGTTGCACTAATGTGGTTTGGGATTAAGGTCAATGTT
TTGGGGTATGTGATCTTGGTGAAAATATATTAGGTGCACACAATAGTTTGATCTTTGATT
ATCAATGTGCAGCGCTCAATTAAGTCCTCTATGATCCTTTTCACAGTTTTCTTTTTTTGG
AAAGATCATGTTGTCTTTTCATGACTTACATTTGAGCCTATGAAATATGCTAAAATTGTC
TATATTTCCTCCTCAAAACCATGGTGTAGGTTAAATTGACCTTGTTAATGTTCTATTTCA
TTGTGAGTTGCTTACAATGTAAAATTCATTTCCCATATATGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved