Hordeum_vulgare Locus mono:1:snoZ155
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:1:snoZ155
Hordeum_vulgare
mono:1:snoZ155
chr4H
snoZ155
1001..1080
2079
TATAATGAAACAATGCAAAGGTTTTCCAAGTTTTAGATTTTTTTTCAATTTTTCATGCC
CATTTCAAAATGCGGTCACAAAGTCGGCTATGTCCTTTCCTAGCTAGTGGTTGAATCTTG
GAAAACTTTTGGTGTTTCTCTAATTAAATAGATACTTGTGTACCTAGAAATGATTTTTGG
GAAAAATAAAGAGCAAACTATAATGCAAGTGCAGTTCAAATTTGACCCGCTTCCATCTGA
TTCGACGAACATTTGTCTTTTTCACGAGAGGTGGATATGAGCTTTTGACACACAACCCAT
TTGGTCAATTGTACATTAAATATGGCCTAGTATTTTAGAAAAAACATTTGGTCCAATTTT
GCAACAAATATATGGTAGGTCCTTCACAAAGAACACATTTTAGGCACTAAAAAAATGGAA
ATATTGAATATTTCATTTAAAAAAATGTAAATAAGGTATAAAAAATATGAAATTTGACAT
GTTATTGGTTCATCATTCCTAGAAGGTGTGGAAAAATATTTGAGAAAATTTCCTAAATAT
TAACAGGTTTATTTTATCAAAAGTAATAGGGTAAAAAACACACTGTTGTTTGGTGATTCC
CTATTGGCTAAAATCTCCTTCTCTCGGATCAATGACATGGCACGGCAGCCAACCCCAATC
TCGCTAATCTGATCCGCCAAAGCCAAAGGATCCAACTTCTCTCAATAGATCAAAAACAAA
AAATTCAAACCCTAGTGTAGTCCCACCCAGACCGATCCACCCCTCCACTCGTCCCACCCA
GACTGATCCCCTCCTCCCGTCATCTCCCACATAGCCGCCGCCACTCACCCATCGCCTCCT
CCATGCTCCGCCGCACGGAGCCGCTAGGAGCCGAACCGTCGTCCCCCCACAGAGAGTGCT
GCCACTCGTTCAATATTTTTGCAACTTCTTCCCTGGTTTTTCTTGTTTTTTGCGTTTGAT
CTTTTTCTTTGGTATCGAATCGGGAAAGGAAATAAATACTCGGTTGATGTGATGATAATC
TTTCACAGAAAATCATATTTACTGTTGACCAAAATACACACTACAATTATCTAATCAACT
CCTGATTCTCTCTCAACCGATCTGTATTTGTTTTTGTTCTTTCTCTGGATCTTCTTGTGA
TGTATTTTCTTGATATCTTGAATTTCTCCGGTTATTTTCTGCCATCCATGCACAACAAGC
CGATGTTGTGGATGAGAAGAGGAAGGAAGCATGGTAATGTGCACGGATATTGACTGAATT
GGTCAACCTGTCTTCTCATCCTGACGCCTTCGGGCTTTGATCTCGCGGGCCTGGATTTGA
CACACACTATCGCTTACCCCATAACCATCATTTGATTGTCAGTAAGTACCTCTATTAATC
TGTTGGTAGTCGATTTCTCAGTAGCTCTATAGATATGTAGCTATGGAGCAAACTGCTCGT
CAAGTGACATCTGTTCGTTAGGCTTGGTGGCTAATTAGCCAGTTACACACCGCAACCACC
GCCATGGCAGCACTCTCTGTGTGAATGGTCAGTAATCCGACCTACATCTACTGGATTTGT
TCTGCCAATTGAAGTGACATTTTTTACTGTTGTCGCTGGGTTAGTTGGAGAGCTGATTTG
GTGTTCGTTTTTATTGGTGTGATCAGAGGAAGTTCGCGCAGCGGTCGGAGAGGGTCAAGT
CGGTGGATGTGCAGCCCATCGAGCCATGGCAAGTGATCGCGCCTTCCAGGCGTTCAGTGC
ATTTCGGCCCCGTTTGCGGTGTCGGTGATGCTTGTTATTACGATTGATAACTTGGTTTTA
TGGTTTTTTGCAATGGCGGAGGATCCTGGCGAGCTTGTACTCGGGGACTCTCTGCATTTG
GGATTACCAAACGCATGCAAGGCACTTGAGCTATTTTTATGTTCGGTTTTGTTCCTCTTG
TATAATCTTGAATCGCTTGAAGTACTGTTATGTACTTCAGTTGGTACTCATAACAGTCGA
TCAAGCACTAACACCACTAACACATGAATAGAACAGGATTAAGGTTGTCTCAATTCCTAA
CTCTAGATCTTGATTTATGATGTATTTTCTGTTGTTCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved