Hordeum_vulgare Locus mono:1:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:1:SNORD14
Hordeum_vulgare
mono:1:SNORD14
chr4H
SNORD14
1001..1112
2111
AATAGCAATCAGGAGGATCATAGCACCAGCGAAACTGAGGAAACAACACTAACTGCCAG
TAAAGAGACACCAAATGATCAAACTGGACCTCTCACAAACACTACTACTAACACGATCAA
GAAAAATCCAAAAAGGTACGTGCCAACATTATAAATCTCTCTTGCAGGTTCGTTTCATCC
AACATACATATTAACAGCTATCTTCACATGATTTACAGGACTGCAACCGACACAGCAAAG
ATTTCTACCTCGAGGAAGAAACTGCACCTTGACTGAAGAGACCACGCTTCATCAATTTTG
AAGCTACTAAATAAAGGCAGGAGTTTTGCGTGCGTCCATCCTTTCTGGATGTATTATGTT
TTGTTAATAATTATGTCCTCTGTGTGCGACATTTATTTCGAATTCCAACTTAGGTGATCA
TAATATTTAATATGCAACTTCTGGTTTATCCTTTCTGTACTCATCTTTGCAACTGAATCC
ATCCGAGTTGAGTGCTATTTTTTCTGAAACCTTGAAACAATCTTAGGACACCTTCATACA
CAGTGCTTACTTTTGTGTGAATGATAATGTTCTGATGTTATATCTTGTTTTCATCATTGC
TTACATTCTCTCTTCCAAGTTAGATCTATAATGCACTTGAAGCCTATGATGATTAAAACC
TATATCTTCCGTTCTTCTGTACTTTTTGCATTGTTAATTTTGTTCATCTTAAATTCCATG
TGAAGATTCTCAGACCATAGGAAGTGTCGTATGACACTGTAAACCAATATCTTCAGCTGC
TTCTGACATTGTAAACTTTGTGGTTTGGTCTGTTCCGAAATCTCTATTTGCAGCTGGTTT
GGTTCAGCTCTGTGTGTGATTTTAAGCGGGTCTCTGAGGGATTCTCTTGAATTCTGTTAG
CATTGTATATGGTTTGTCCAAATAGCTGGTTATTGTGATGATTTTTTATAATAGCTAACC
GGTTGTGATAAATATGATGTGATCAATTGGGGATGCATTTATGGCAATGATGATACGTTA
AAGACTTGTTTCAAAACATTCGCAGTTCCCGCCTAAGAGCTTTCGCCCTGCCAGGCTTGA
GAGCCAATGCTTATCCTTTCTGTAAGGACCCATACTTTCTGCAAGATTTATGTTTTGTTA
ATAATTAAGTCGTCTGCGTGCGACAATTTTTACCCACTTTAGGTCGTCATAATCTTTAGT
TTGCCACTTCTGCTTAATATGTTCTGTGAGGACCATTGTTCCCATATAAATGATATAACA
CAAACCTTCCTTATTTATCACAGATAATGATGTTGTGACTATTTCTTACATTATAATCCT
TCATCTCTTTTTCCATGTAACATACATTGTATTATAATACTTGGAATGTTGTGACTATAT
AAACTGCTTACTCAGAGTGTTTTGTGAAAATTATCTGTCAAGTTGCTTCACAAACAGAAT
ATGTTTTACAAGCAGTCACATTCTGCTCGACACTTGACTTCTTCACCTTCAGCAACTATG
TAGGATGTCTCCTCCCTGATAATTAGCTTATGATAAAGATGGTGTACTCTGAACTGAAGG
TACTTCCAAAAAACATTATGCCCGGCTTATGCATGTCATGACTTTCTTAATCGTAGATAT
GTGTCCATGATTGTTTTGTAATAATGCAATTTAGTAGAGCTGAAGGAAGGCCACTGGAAA
AATAAACCAGTAATTAGGAACTAGATTTGATTTCCATGATATTTGATGTCTATATCTGAT
TAGTGCTAATAGACAGAGTATTTTTTAACAGGACAATAGTCACGATGTGGATGCGGATGC
GATGGATCTTAAACAATGCATGACGAGTCACCCTTCCACTCGCGTTTTTGCTCAAAGCGT
GTAAGCATCCTGATACTTGATAGTTTGTACACATGAGCTCTATCTTACTGGAAACATTAG
TTAACAATGGTGGGGAAATGAAAATTGTTAATCGGAAGCAAAGATAGTAAACGAGACACT
GAAACTCGGTCTCAAGCAAGCTCTGAGTACTGTAATGCTCATGTAACAAAAATGGAACTA
TTTTGCATAATGATCGGACTAAGTTTTTTTTTGTCTAGAAAGTTGTTGGCCTATTTTTCG
GAGGGCTTAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved