Hordeum_vulgare Locus mono:1:Plant_U3
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare mono:1:Plant_U3
Hordeum_vulgare
mono:1:Plant_U3
chr2H
Plant_U3
1001..1221
2220
TTTCGGGAGGCACATTTATATTTCGCGTGGAAGAAAATATGTGTCCCCATGAAAACCAA
TTCTAAGAAAAAAATTGCATTTTTTTCCTTTCTGACCTTTCCAAAGGAAAGTCTGTTCTT
CTCGTGGAAGAAAATATGTGCCTCCAAGAGAACCAAATTTGTGCTCCTCTTGAAAGAAAA
ACAATTTGCTATTTTTTCTTTTTTGACCTAAGGAAACTATGTGCTTCTCGTGGAAGAAAA
TTTGTGCCTCCAAGAGAACCAAATCTGAGCTCCTCTTGAAAGAAAAAAGTTACATTTTTT
TCATTTCCGACCTTTCCAAAGGAAAGTTTGTGCTTCTTGTGGAAGAAACAAACACATTTT
TTTTCAAGAGGCACAATTTATACGTCTCGTGGAACCACAAAAACAATCGCATAATTTTTT
TTGTCAATTTTTTATTCTCTCCCGAACCTAGAAAAAACAGAAAAAATCAGAAAACCAAAA
AATCAAGAAAAATCATATAAAATCCTTAAACGCCTACAGGAAAAAAAAAACCCCCCCCCC
CCCCCCGCATCCAGCACTAGACACATGGCGATGGTTGGGCGCATCACTTGACGCGTTTCA
ACCCACCAAAATAAACCTTACGGGACTACTGCAAGGAATACCCCATGATTAGTTGCTCTC
TATGGAAATTGGGGTACCTCTTAGAAACACGAATGCAGCATGAAACATCGGTACAATTTA
TTTTTGTAGGAAGGGAAGAAGCTTCTTGTGCGAAAAGAAACAAAATAGGCACCCCACACA
AAAGAAAGGTAGCCCGAGGCCCAAAGAGGAGAAAATAAACAACATCATTTCTTACCAACT
ACTAGAACGGTCCGGGGTTCCAGACCAGATAGCATACTGGGCCGCTCCATCACACGCTAA
ACACCCGGGTATTATGCAGGGAGCAGAGGTGTTTTAGTACCACACCGGATGTTTACAGAC
ACAAGAGCCAGCTTAAAAGGGAATTTCCACTGCACTAACGCACGACCTTACTTGAACAGG
ATCTGTTCTATAGAATCGTACTGCTGCATCCTTGACTAATAAGGAGGCAAGCACCTAAGC
TTGGTTGATGACATCTGACCTGTGGGCCAGAGCGTGATTAATGGCCTAGATCAGTAGCTG
CTGCTGATTCCCTTTGCTTTGGAGGATCGTTCCTGTCCAGCTCTGGCTGGCCGAGGTGGC
TCAAAGGTTGTCTGACAGGCTCTCACTCTTTTTGTTCTCCCCAAACCCATTTTTTTGCAG
TAATCTGCGGACACTGCTGCAGCTGATGCACACTGACAGTAGCAATGGGTATATGCAGTG
CCATCGGCTGAGCATACAAGTTGCTAACCTTTCTTTGGATGGAACCCAAGCTGCTGCTAT
GAAGTTCAACGTGGGCTTGGTTCCAACGCGCGGAACGAACTGAGATCGATCGCTCATGTT
GTCACATGGCCCGGCCAAAGAATCCCCTTTTGCAGCAAGACACGGCCAGTGCCCCTCGCC
AAGCCGGGGCCAGAAGGGGGTTTGAGCTGATTGAGCCATATGTCTCGCTGCAAAGCTTCT
CATGCATCGATCGGCGCTGGCCCAGGCACACATCTTTCCCAGATCAAATGAATCCTCTCC
GATCCGCTACTACAAAATTTCTTTCTGAAAAGCTTCCGTGCACATGCCACGGCTACCGGG
CCAACTCGCCGTGTCTCACTCGATCAATCCAAATGATTCCTCTTTGGCACCGGCCCTGGC
CATGGCCATGCCTTGAGATTCCAAACGGAAACAGTCAATTCTGAAACAAGACTTCTCATC
ATAGTTTAAAATACCAAACCGGTGATCGAACCCACGAGGCCACCGGTTCAGGTTTTTACC
ATCAGACCGCCGGTTCAGATCGTACATTTTGTGTACTAGTGTCATACTAAATAGGTGTAA
AATACAGTTATTTATTTAAATTTAATAAAAAAGTTGGCTAGCTAAGATGGTTATCGGGCC
GAAGGTGCAACTTACACACCTATATCTAGAATCATAGGTTTGAATTTTCTTTTATGCAGG
TTTTTTTTTCTATTTTTATGTGTGGTACTGGATGAACCGTCGATTTTATATCTCCGGTTA
AACCGGCCGGTTTATATTTTTAGCTTAAAACCCCAAAAAGTATGCCGGTTTTGGTTTTTT
CTAATCGGACCGCCGGTTCGGCCTGGTATTTTAAATATGCTTCTCATCTTGTGTGACCTT
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved