Hordeum_vulgare Locus HORVU7Hr1G108780
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU7Hr1G108780
Hordeum_vulgare
HORVU7Hr1G108780
chr7H
snoR60, snoR60
2399..2474, 2729..2804
5210
AATATATTATTATCAAATCCATAACTATACCATAATAGTAAATTCCACCAAGAGCTCGG
GCGAGCAGACTGTCACTGGGTCACATATCCTCATTTTTCTCCATCAAGTTTCACTGGATG
AAAATGTAGACGTTGCAATATTTAGATTTATTGTGTGTGTCGACTCTAGATAAGTTCGAT
GATTCAAGAAAACTATTTTAAAAATGTTCACATTTTAAGAATATATATTTGCAAATAGTC
TAAAATGTTCATGAATGCAAAAAAATATTCCTGATTTTAGAAAATGTTCACGAACTTGAA
TTTTTATCACAATTTCAAATATTTTTCAAAAATATGATTTCACAAAAATGAAATTTATAA
TGTATTTCGGTGATGTAGCAAAATATGGTTATCGCCGTTGAAAATTATGATGTTTTTTAT
TCCGTTGCAACGCACGGGCCATTTTGCTAGTTTATACAAAGATGTATAATACGTAAAAAA
AGTGGACGTGAAAACCTATTTTGAAAATAAACGCTAATCATGTATTTGGAATACGTTAAA
CACACATAAATAAATACTTCTTATTTGGACGAAAAAGAAAATAATATAATAAATAAATAA
AAACTGAGAAAGAAACAATAAAAACCGAAGAAAAAATCGAGAAAACGAAAAAGGAAACCG
ATGCAAAACCTCTCCTCGACGCGTCCCTTACCGGGCATCGAACAAGTAACGAGCGGGCCC
GTGCCTTGACGTTCTGACTCTCAGTTAAGATGGGCTAATTCCAACTCTCTCTTTTTTTTT
GTGATCTGGCTATTTCCAAATGGGCGGACCATATATTAGGCCGCAAGTCCATCGTATACT
TTCGTCCCACTAAGGTAGTTCTTCTTAAATGGGCCGAAGGACCATCTTATATTGTTCGGC
CTGTTTCAACCAGTCTTTCTTAAATGGGCCATAGTCCAATTCTCCCCCAAGAAAATGGGC
CCTACTCTTCGTCTATAAAATTACCGCTCCCCCGGCGGAGGCCAACCCTCTCAAAAACCC
TACCCTCCTCCTCCCTCCATCTCCGGCGGCGGCAGCAACAAATTTCCGACGCCATGAGGC
CACCGGCACGAGGAGGTAACAGTCCGTCGCCCTACCCTCGGCCCTATTCTTCTTCCTCAC
ATCCCCGATCTCATCCGAAGACGCTGTTACGCTGCACGCAGGACGCGGCGGGAGGGGTTT
CGGCGGGAGGAGCGACGGCGGCGGCCGCGGGGGGAGGGGCTTCAGCGGGAGGAGCGATGG
CGGCGGCCGCGGGGGCCGGGGTGGCAGGGGCGGCAGGACGCCCAGGGGCCGCGGTCGTGG
CGGGGGAAGGGGGGCGCCCGGCATGAAGGGCGGGAGCAAGGTGGTCGTGATCCCGCACAA
GCACGACGGCGTCTTCATCGCCAAGGCCAAGGAGGACGCGCTCTGCACCAAGAACATGGC
CGCCGGGGAGTCCGTCTACGGCGAGAAGCGCGTCTCGGTCCAGGTCAGTGCCCGCTGCTC
CCGCTCTTACTCTTAGAGGCACCATATCAACATCGGTTATGTGCCACTAGCGGACGTCGA
TAGATCAATCAACTTCACTAAAACCAGCTTAGATTTGAGTGCAATCGTCTGTTCACAGGT
TCTTGTTAGATGATTGTTTCCCTGTGGTATCAGATTTCCTGCTCTGTTGTGTTCATTGTG
CATATATCAAACAAAGTATGCTTATTTCTGCCCTGGTATTGCAGAACGAGGACGGGACCA
AGGCTGAGTACAGGGTCTGGAACCCCTTCAGATCAAAGCTGGCTGCCGCCGTTCTTGGAG
GTGTCGACAACATCTGGATTGTAAGTTCGTTGTGCTTTAGCATGTATTACGTGTATTCAA
ACCTTGCTGTTTCAGGTTGCGATGTAGATTAGCGTACGACATTGTCTATATGCTGACATT
GCACTTCTTAATTCAGGCTCCTGGTGCTCGTGTGCTGTATCTTGGTGCCGCCTCAGGAAC
GACGGTGTCCCATGTGTCTGATATTGTTGGACCGGTGAGACATCATAGCTACTCACTATT
GATCAAATGCTTCTGTTTATGTGAGCTGTGGTCTTACAGAAATCTCGTCACTTGCAGACT
GGGCTGGTGTATGCTGTGGAGTTCTCGCACCGCAGTGGCAGGGATCTTGTCAACATGGCC
AAGAAGAGGACCAATGTGATCCCCATCATTGAGGATGCTAGGCACCCTGCGAAGTACCGC
ATGTTGGTCGGCATGGTTGATGTTATCTTCTCAGATGTTGCACAGCCTGATCAGGTATAC
CTGTCATCATATAAATGCCCACAATAACTATTTGCTCATTTGCCTATGGGCAGGCCTATC
CATTGTGGTATGTCATTGACTGCTATGTTTGGATCACCTTCTGTGGCTACATTGGGGCTT
AGCAAATGATGAGCTTACTCGGATTCCCCTTCAGGACATCACAATGGATGATGCAAAATC
GAGTATCTGATGCATTTTATGCCCAACGCCAGTCCATTTCTTATTTATCTTGGATTTGCT
AGGCTTCTCTTTTGATGTCATCACATTGGATGTTACATGAAACTATTCCCATTACAATGG
TTATCAATAGCACTAACCATTTATGTATACAAGTACTTGAACTGCTCCGCTTAGATTTTG
TAATTATGGTTTACATCAGATTATTTCTTTCCATTATGGTTTATCAGTTTGCATTGCTTT
CCTGGTTTTCTTTGGCTGTGTTGGTGCTATTGCTGATGATGAGCTTACTCGGATTCCCCT
TCAGGACATCACAATGGATGATGCAAAATCGAGTCTCTGATGCTCTTAATGCCCAGAATT
CCTACTTGTATCACCATATTTGTTGTGTTGATTTTGATTACACTTGGATTTCTTACTTCA
CTTTGAATGCTGCATGAGTTGATTCCATTTCAATGGTTTCAATAATTCGCCTCTTGTAAC
ATGGTTCTTTCCTTATTTGTAACTGTCAGTTTGGAAGGTTGATTTATGCTTGCTTGATGT
TGAACCTTGCCACTGCACAATTCAGATTTGATAAAAGTATAATTGCTTATCCCTTTTGCC
GATTTGGTTTGCAACTTTCCCCTTGCTGATAGAAACTTTGATCTTTGGTGTGGCATGTGT
CGTACTATAATACTAAGAATTATGTTAGCATATGGTAGGTCATTTCCTCTTAAGGTGAAA
CTGTCTTGAAACTACTTACGGTGTTGCCTTACTGATATGTACACGTTTTCAAGGTTGCAG
GGTTAGACAGCCGGTTATTGTTGTGAAGTGTCAAAACTCGAAATCTTTATGTTTGGTTAT
TAAATTGTACCTTGCTTTGTTTACAACATTTAGTCTCTGCACTTTCATCTCTTCCAACAT
ACTGATGATTATATTAACCAAGATTAAGAATTGTAATTATCTTATGTGTTGGTAAAAACA
TTATATGCAGGTCGTTCATCTTTGAAATTTAGTGTTCAATATCAGCTTGAACAACCAATA
TGCCATTGTTAAGTAGCGAAAACATTCATAGGTGATACTAAACTGTACTATCATTCTTAA
ACCTGTCAAACTATCTTCTCTCCTGCAGGCTAGGATCTTGGCCCTTAATGCTTCATACTT
CCTGAAGAATGGTGGTCACTTTGTCATTTCAATCAAGGTATGTACTGATTACAGATTCAA
GAAACATTGCATATGCCCTGGAACATGATTTCCTGGAAATGTTGCATTTATGTAATGGTT
CTTCCTCTTGCCAGGCCAACTGTATCGACTCCATCCAGGCTCCCGAGGCCGTGTTTGCTG
CTGAAGTTGAGAAGCTGAAGCTTGAGCAGTTCAAGCCTTCGGAGCAGGTGACCCTGGAGC
CCTTTGAGCGTGACCATGCCTGTGTCGTCGGTGGATACAGGATGCCCAAGAAGCAGAAGG
CGACTTGAAGGAAATAGTTATATATGTTATGCGCTATGATGTTCTATCGTTTGTTAGTAT
TAGGTCCTAGGTGTTAGGTGTTGGTGATATGATCCGACAATGTTGGTTCTATAGCCTAGT
TCGTTTATATGGTGTTGGTAAGTGGCTGAATGATTTTGCATGCCTGTTAGCAATTGTTGA
CTTGTTGGCAGTGTTATCCATGAAACCATGACTTCCCATTTGCACAGCTTTTTGTAAGCT
TATCAAATCCTGAATATGCTTCATGACCTTAGCATCCTGTAAAGATGTGTCAATTTTTCT
GACATGTACTCCCCCGTTTCAAAAAAATTGTCTTAGATTTGTTTAGATATGAATGTATCT
AGTCAAGTTTTAGTATTTAGATACATCCATTTCTAGGCAAATCTAAGACAAATTTTTTGA
GACGGAGGTAGTATGTGTTTGACAGGTATTATATAGACTAAAAATCTCAGCATACACAAT
TCAGACTAAGCAAAATACAAAAAGCTTTTCAAGATGGATTTTTTGGTACGATGCACACGT
TTGATTTTTGAGAAAGCTAACACATGAATGATGACTTTGCTTGCGAAGCACAAGCTAAAC
AAGCAGGATGTCCATTCTTATCTCCCCCTCCAAATTTGTCTTGATTTTTATATTTCTACA
TTGTTTGATTTTTATATTGCGACAAGTTGAGAGAAGTAATAAAAAAATGTGCGTTTTTTT
AGGTTCCACCAGTTCTTTGGTTGAGGGGCCACAACCCGCGTGAATCTCTCATATATAACC
GTCACTACAAGCCTTATTTTAGAAGAACAGATCTTCTTCAGTTTGTGCTTAAGTTTAAAG
GCACACCACCCTCACTGAACTCTACAGCCATTACCACCCTTACGGACCGTTGAAGGCCGA
AGACGCACTCTTTCCACTTTGCTCTTGGTGAGATGACCATCACTTTGAAGGATATTGCGA
TGATCTCCAGGCTACTGATCGAGGGCAAGGCTCTTAACTGGAAGGTGAAGTCTCAGGGGT
GGCGACAATGGGTTCCAGGATTGGTTGGTGTTGAACCACCAACAAGGATTCAGGAAATCA
AGAAGGATCCTAGACCATCTGGTGTTGTTCCCGTGGCTACAAGAACATTTTTATGAGTGT
CAGAGGATGCGAGTCCAGCTATTATGTAGAGGTATACCAGGGCTTACTTATGGAATCTTT
TGACCCAAGTGGTGTTTCCGGATAGCACGGGAGACACGGCCTTATGTATGTTCTTGGACC
CTCTTCGTAATTGGGATGATAAGTGAAGTTGGGGGTCGGCGACACTATCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1094, 1181..1211, 1334..1482, 1724..1819, 1936..2013, 2097..2273, 3568..3636, 3734..4110
1342..1482, 1724..1819, 1936..2013, 2097..2273, 3568..3636, 3734..3907
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved