Hordeum_vulgare Locus HORVU6Hr1G091860
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU6Hr1G091860
Hordeum_vulgare
HORVU6Hr1G091860
chr6H
snoR60, snoR60, SNORD25
2584..2659, 2849..2924, 3295..3391
5444
TTCGAACTTTCGAATGAGCACATTAGAATCATATGGTGTTTGCGAAAATTTGCAGTCTA
AATATCCAATACGACTCAAAATCATCTCAACATAGTGAGATTGCAGAAGTGTAATCCCAC
CCTCATCATCTCTCAATAGCTAGATGTTCAAGATAACATCAACCCCCAAGGTCTTTCATC
TCAAAGTTTTGAGATAAAAACGACTTAACCTCCTATATCACTTTAAGATTGGTTTCAAAT
ATCACTATGCCATCAACATACAAGCATAATATAACTCCTTCGTCCTCATCATGATGATAG
TTTACACATTTGTCAGCTTCATTAACAACAAAGCCAACATATATGAGAGCTGTATTAAAC
TTCTCATGCCATTGCTTACCAAGAGTTCTTTTTTCCTATCCGCCACCGCTACACCACTCC
TACCGATAAGCGCGAGTAACCCTTTCCTTCTTCGTCTACCAATTCAATCAATAATTTGGG
GGTCTAGTTGTGTTGAAAAGGTGTGCCTACATTGAATTTAAAATCTTAAAATACAAATAA
CAAATAGATAAAAATATAAGAAGAGAGGGAAAAAAATGTTATTGTGAGGAGTGGTCTAGT
TGTGTCGAAAAGGTGTGCGTACGTCAGATAATAAATATAAAAATATAAATAACAAGTAGA
TAAAAAATAAAAAGAGAGGGAAAAATGTTATTGCCAGGAGTGGTCTAGTTGTGTCGAAAA
GGTGTGCGTACATCAGATAATAAATATAAAAATACTAGTAATAAATAGATAAAAAATAAA
GAACACATGAAATAAAAATACTAATAATAAATAGATAAAAAATAAAGAACAGACGCCCTC
ATGCGTGGACCTGAACTTGAATCAGGCGCCTTAGACCAGTCGGCCATCCTGACTAATTTT
TTATTAATTCCCGGGTTAACCTCAAAATCAATTTTCCAAGTCCATAATAACGCCGCGCGA
TCCAGCCGTCCGTCCACCATTCCACAAACCAACGGCGCAGATGGAGCCCCAACCCTAATT
CTCCCTCTATAAGTCCTCCCCGAAACCCCGTCTCAAACCCTCACCCCTCACCCCTCTCCA
AAACCCTAAACCCTCCCCCGGCGGCGGCGGCGGCGGCTACCAGCACCACACGACCCACAC
ACCATGAGGGCTCCCATGAGAGGAGGAGGAGGGCGCGGCGGTGGCAGGGGCTTCGGCGAC
AGCGGTGGCCGCGGGCGCGGGCGCGGCTTCGGTGGAAGGAGCGACGGTGGCGGCCGCAGC
GGTGGTAGGGGTTTCGGAGGCCGCAGCGGCGGCAGGGGCCGTGGCGGCGGCAGGGGTGGG
GGAAGGGGTGGCCCCGGCATGAAGGGCGGTGCCAAGGTGGTCGTCGTGCCCCACAAGCAC
GACGGCGTCTTCATCGCCAAGGCCAAGGAGGACGCGCTCTGCACCAAGAACATGGTCGCC
GGCGAGTCCGTCTACGGCGAGAAGAGGGTCTCCGTCCAGGTCCGTGCTCGCTTGCCTCTC
ATTCTTATTTACAGTTCCAGGCTTCTTATAAGTTTTACTGCTACTGTGGGTATTGGCATC
GAGATGCTCTTTCACTGTGGGTAAACCAGCTTTGATTTAGCGGGGTCATCAGCTTAGATT
CGGCTGTTCTTAGTTCTTAGACGAGCAAATGGCGCACTTGGTGCCCTTAGTTTTTAGATG
TTCACTTGCTTCATATTCTGTTCGTAAATTTTTATACTCTGTTATGCTTATGGAGCACGT
GAATGGCGTTCATTGCTGTTTGAAAGATGCACTTTTTTTATTCCTATATGTAAATGATGA
CATTACTGGCTGAGAGATGCAATTTTTTGGTGCTGATGTGAAATGACTTTCATTAGTGTT
CTACCGATATGCACATGTAGGCTGATGTTCATTGTTGCTTTGGTATTATGCAGAATGAGG
ATTCATCCAAGGTCGAGTACAGGGTGTGGAACCCCTTCAGGTCCAAGCTGGCTGCTGCCG
TGCTAGGTGGTGTGGACAACATCTGGATTGTAAGTCCTGTTTTGTTCCTTGGCTCTAATT
CTGAATTGTTCGAATCCTTGCAAGTCCAGATTAGAATCATTGTTGTAGTAACTGACTCCG
TGGATGTGTTCCAGGCTCCTGGAACTCGTGTGCTGTATCTTGGAGCCGCTTCTGGAACTA
CCGTGTCTCATGTGTCTGACATTGTTGGACCGGTGAGTTCTCATCGCTCCTTTGTTTACA
TTCGGAAAATTTCGCTTCATTTGAATTGTGTCTTAATGAAGTTCATCATACTGCAGACTG
GGTTGGTGTATGCTGTTGAGTTCTCTCACCGGAGTGGCAGGGATCTTGTCAACATGGCCA
AGAAGAGGACCAATGTCATCCCCATCATCGAGGATGCTAGGCACCCGGCCAAATACCGGA
TGCTGGTTGGCATGGTTGATGTTATCTTTTCTGATGTTGCACAGCCTGACCAGGTATGCC
TTTTATGAAGAATTTCTAGACCTCTGTTTCTACAAGTTTGCTTGCTGTCAACATAAGTTG
TTATAGTTTACACTTACGGTTATTGTTTGTCTGTGTGTGACTCCTTTGTGAGTTACTGAC
GGCTTAGCAAAAGATGAGCTTTACTCGGATTCCCCTTCAGGACATCAAATGGATGATGCA
AAATCGAGTCTCTGATGCGTTCATGCCTCTCTACTTATTTGGTTTGCAGCAGTTTCTGAA
TTTTGATTACAGCCATACTAAAATCCATGACCATCACATTTGATTATATATGAACTGATC
CCATATCAGTGTTTTTAGTAGCTTTTTGTAATAAATTGCTGTTATTGGTGTACTATGTTT
ACCTGACCTTCTGAGGATTTATTGGGGCTTAGCAAATGATGAGCTAACTCGGATTCCCCT
TCAGGACATCACAATGGATGATGCAAAATCGAGTTTCTGATGCACTTATGCCCATTGCCA
GATCTTTGCTTTTGCGTGTTGCTGCGTTTCTATGATTTTCTCCACAATATTGCATTTCAC
TGGTTGTGTTTATTTGCTTTTTTATCTATCTTGTTTTGCATAGCATTAAGTTTGGATGGT
TGTGTTACAAGTAGCATTGCACCCTATCCACTGTGATAAAATAGTGTATATGATTAGTTA
GTCCTGTTTTTATTTTTGTTGGAAGTTCCTTACATCGGGGCCTGTTTTTTACCTGAAGAC
TCTTCTTTGGCAAGTTCTCACATCATTCATCAATCCTGAGTTCGCCACTCTTGTGCCATT
ACATAAATTGATGTCTTATTCTACCTTTTCCCTCTTTTTATATTTTTATTAGTTTGACAA
CTGTGATGAGCCAATTTTACAGTTACAGACCTGTAATGACTCCTGCGGAAATGATCGCAT
GGTCAAAGAACATCTAAGGGACTGAGTTGTCTTAGAAGATTAGATTTGTATCTTTAGCAG
ATTTGATTGTTTTGTGTTTTTATCTGCTTCTCTTAACAGTATTCGTGCCTGTGAATTAAC
CTGTATGGTTCCCGGGCAATGATGAGGTGGGAAGCAAAGAGGAACGTTCCTCTCGCTATC
CAGTGCGGAATTTCTAGTGTTGCTATTGGACGTCGAGGAACTACACTTTCTTTCTGAATA
TGAATTCGCTGGTTCTATAGCTATTCCAGTTGAAGTTTGGTAACTCATTGATATTGTTGC
TTTGCATTCTTTCTTTGCACACAATATTAAACCCACATTGATACTTGATTTTGATTTTGT
TCTCACATGAGGTGATTTTGTTTCTGTGAGCACCGTTTCAGTACAAAAGAACCTCAGTGT
GAATATTGCAGCATGATGTGGGTGACTTGTTAATATTGTGGTTGCGCATTTCTAAACCTT
GCCATTGCATCTTCTTTCCCACAGGCTAGAATCTTAGCCCTTAACGCATCATACTTCTTG
AAGAATGGCGGCCACTTTGTCATTTCCATCAAGGTAACACTCAGTTTCATACTTAGGGCA
TTACTTGGAAAATCTTAAGTTTCCATTTGAGCTGACATTGCTCTTTCCTGTGGCCAGGCA
AACTGTATCGACTCCACCCAGGCTGCTGAGGCCGTGTTTGCGAGCGAAGTGGAGAAGCTC
AAGGCCGACCAGTTCAAGCCATCGGAGCAGGTGACCCTGGAGCCCTTCGAGCGCGACCAC
GCCTGCGTCGTCGGTGGTTACAGGATGCCCAAGAAGCAAAAGTGAAGTTGAGGAGAAGAA
GAATAGAAGTGGCCTTGTTGTTTCTGCAATCTGCTTTTGCTCAGATGTACTATTAGCAGT
AGTGGTAATGTGACCCAAGTGTATGGGGTTTTGTGGAAACTCTCTGAGACGATTCCTGCT
GTTTTACAGCAATTATGTTAAACTTGATTTGAGCAGAAAATGTTACTTCCTCTGTTCAAT
ATTATTAGATGTTTTTGATAGATTTTAATGTGGAATAATTAGTGAAATGAGTGAACACAC
TAAAAAATCTGAAAGCATCTTCTATTTGTTAACATCTTATTATTTTCAAAAAGAAACCTT
TGTTCACACTGAGATCTTTACAGAAACTATATAACTGATGTTAAAAAAATTTATTTTGCT
AATTTGTCGTAATAGGAGTCATCTAACATAAGCTATATATCATTTTTTTCTTGTGGCCAA
TAAAACCGGCTGGGACACCCCCAAACCCCCCCTTTTTTTTTCTAAGCTTAGGGATTGAAA
TCGAATGAAATTTATTGAATTTAGGTCTTTGATTTCCAATCCTCGATCAACAATTTGAGG
AAGACGAGACGGAAGCCTTTGGATGAAACCAATGAATCTTCTGATCCGAAAGACTAAGGG
GCTAGGCGCTCACTCCACACATTTCCTCTTTGGCGTTGGCTCCACCAGTTTTGACTGCTT
TAGTTATCTCAAATCTTTGGCAGGAAGGGGCCAAGCCAAATAGTGCTCTTTAGAAGCGCA
ATCCGTGCTTGAAACTCCTTCGCTAGGATCCAAAAACCTGGAGATCATCCTCAACAAGGC
CTTGAGGTTGTGGGCTTCTGTTATGTTTGTTGACGAACTCACAGTCTCCAAATCATCATC
AAATGAAAAAAAGAGTCATATATAGATGCATATTAGAAGAGTTATTTGAACATTTGATTA
GATAATAGCACACGGGTATCACTACAGATTAGGAGTAAGATTAGTGATCTGTACTACCTA
CAATTATGTTAATTTGTGATCCGCTCTGCTTGTGCTTATGTCTTCATGGCTGAGAGATCA
TATCTGCAACTCGGTACTAATTAACTTGGATGATGAGATGGTGGAATGCTGGGGTTTTGT
GTGCTGCCTGTAAGACAATTATTTGGTTTATCATGTCAAACTTAATTTGAGCAGAAAATT
GTCATCTTTGACAAGTTTTAACCATGCATAGTAAATCTGTTTGAGCTGTATCTATGCTCT
GGGCAAAATTAACTTACACGACGTCCTATCTTTCCTAGTTTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1478, 1913..2008, 2114..2191, 2276..2452, 3864..3932, 4017..4444
1143..1478, 1913..2008, 2114..2191, 2276..2452, 3864..3932, 4017..4184
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved