Hordeum_vulgare Locus HORVU6Hr1G084900
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU6Hr1G084900
Hordeum_vulgare
HORVU6Hr1G084900
chr6H
snoZ101
2040..2138
4119
TTAAAATGATTATTTTTGTCCTTTGTTGCGAGATTTTAAACATGTTTAGTTGTCATATT
ATAATTACTTAGTTGTCAAAATTAAACATGTATAATTGGCAAAATTATAAGTGCTTAATT
GTCTAGTTTAAAATAGCTTAATTAGTTGCATACTTTGTTGCCACATTATAAATATGTTTA
GTTGTCATATATAAATTACCTAGTTGTCAGAATTAAACATGTTCAGTTGCCAAAACTACA
AGTACTTGATTGTCTATTCTAAAATAACTTAGTTGCATATTACTTTGTTGCCACATTTTA
AACATGTCTAGTTGTCATATTATAATTAACTAGTTGTTAGAATTAAACTTGTTTAGTTGC
CAAAATTACAAGTACTGGGTTGTCTATTTAAAAAACATAGTTTCCAGATTTATAACTTGT
TTAGTTGTTATATTACAAAATATCAGGATTGATTTATTGTGCTTGGCGTTCAAGCAAGTT
TTAAAATAACTAGTCATGTTAATTAAGTCGCATGTAGACTGAATTTCTATTAAGTCGACC
TTATATTTTGAAGATATGTACAACACCATGTACTTATGGAGAGAAAGGCATGATAGGAGG
GTACATTCGGTGCAAGACACAGCTCACTGTAGTGAATAGTTAACTATAGTGATGAGTGAC
GTTACCTTGTCGCAAACAGTACCATGTACTCCCTCCGTTCCTAAATATAAGTCTTTTAAG
CGATTTCACTAGGTGTTTACATACGGAGCAAAATGATTGAATGTACACTCTAAAGTATGT
CTATATACATCCGTAATTAGTCTACTAGTGAAATCTCTACAAAGACTTATATTTAGGAAT
GGAGGGAGTAGTGAATAGTGTGACACCTTACTGTAAGAAGCTGCGGGCACTGGCCGCTGC
ACGGGAACCCTACGGTGCATCGTGTGTAATATAGATTTTCCAAAAAAAAATACTAATGGC
GCACTGTACCGGGATGCGCCATTGTTAAAAAAAATCTAATGGCGCACTGAGCCGCTCGGG
GGTGCGCCATTGCTAACCCTCTCGCCCTCTGCCCTCGCCTCTCCTCTCCCAAATCCAACC
GGCCGGGATCTCGCCTCTCCACTCTCTCTCCACCCCCACCCCCTCCCCCCGTGCACCAAG
GTCGTCCGCCACCCATCCCTTCCGCCACCCATCCCTTCCACCACCCATCCCATGCCGCCG
TTGGAGGCCCTCGTTGGCACCGCCGAGCTCTGGCGCCCCGCGGCCCGCGGGGCCGGCGGC
TGGGCCACCGCCGCCGCGCTCCTCCTGCTCCTCATGGCCCACCTTTCCGTCCTCCTCGTC
CGCCGCCGCCGTCTCTCCACGGGGCGCAACCGCCGCCGCGCTCCTCCTGCTCCTCGTGGC
CCACTTCTCCACGGGGCGCAACCGTCGTGGCCTAGACGAAGAACTCGGTACCTGCAGCTG
TAAGCGGCCTTCTGGTTCTCTCGAGTCCCTTAGGTTGTCCGAGTTCTATGCTAGTGGATG
AACTGTAGGTTTCTTGTTCTAGTCCCTTAGGTCAATTTATTACTGTTGCTCTTGGTTCGA
ATGGACTGTAGATTTGTCCCTCGCGCATCGCAAAAACTGATTACCGGCAGATCTCATGGC
CGCCGCGTATGAGACGATGCCACAGCGACCCGCCCCGCCGTCGCCGTCCTACATGGCCTC
ACTCACGACTCATGTCCAGTAGGCGACGGCGGTGTACATTGCACAGTCCTCTTACAATTA
TTATTCATGTTAAGGGTGCCCTCTGTTCTCACTTCTGGGGTCTAGAGATGGTGGCGTACA
CTGCCGAGTTATCTTACGATTCTGTAGATTTATCAGTGATTTGAAAGAACTAGTACATTA
GCGGCATGCTTAGCCTGTTAGCCCTCTGTTCTGATTAGGTGTCGGTGTTTGGTTAGTGCC
TCCAGAAACACTTCTGAGATGTGGTAGTATATCATAACTATTATCTCTGCTATGGTGCAG
AGGCCGTACGAAACTGGTGATAATATTTCCTTCTTGTTTTTCTATCTTGGAGGATTATCG
TTTATGCAGATGATGAGACACAAGTTTTATGGGTAATTTGCGTCTGAGGCATTTCAGTGA
TGTCACACCCTTTTCACCTTGGAGATCTGATGCATGCTTGACAATATCCTTCGTTATTTC
GTTTTGTTGCTGTTTTTGATTCGCTTGGGGTGAGATGGGGGAAAAAGGCCCGCTCTTTCT
GCCGTTTCCATAGATTCATACTACTATTACAACAACATCGCATTCCTTGGACTGGGAGCT
ATCTCTGCTCACCACATTCACTGGACCTAACCTAGTGGTTCAGCCTGATTTTGAGATATT
GTCCCCTTGAGCACTTCAGCTCACCATAATCCTCAGTACTAATGTTTTTGCACCTGTAAC
CGAGGGACTTGATTTGCTCTTGATCTACGGCGCCGTGTTCTCGCCTCGCCGTGAAAAGGG
AATGAACGAACCATACGGCACGACAACTATGGCCTCCTTTCCAGTTCCAGAGAGCAATGT
GTTTGTTTGCTGATACTATAACCTTTCTTTTCCTGCAGAAGTTGGATTTCAAGTTCCCCC
TGACGGTGTCCTGCGTCCACTTCATATGCTCCTCCATCGGGGCATACGTCGTGATCCACG
TGCTCAAGGCGAAGCCATTGATTCAGGTCTAGCCTGAGGACCGTTGGAAGAGGATCTTCC
CCATGTCATTCGTGTTCTGCATGAACATTGTGCTCGGGAACGTCAGCATGCGGTACATCC
CGGTCTCCTTCATGCAGACTATCAAATCCTTCAGGCCAATATTGGACCTGATTATTTCCA
ACCTAAGCAATATTTGCAGTTCATGCCTGAAACATGCTTGTTAAGGCATACAAGACAACA
CAATTTAGTATTGCCTACATGTTACTATCGCAGTGGATATTACCATAGAAAATAATTGCA
GGGTTGGAAGAAAAATAACTGAGGACTAAAAAGGATACTCTCTGATTTTGTGATTTGCGC
TGTATTTTGTGGTTTGTTTTGATCCTGCAGATGCTGAATTGTTGTCTTTGTACTTCAACA
GAAGATCTTTGGGTTTCCTCAATAGAATAATGGAAGCTTCGGAGATAACTTTTGCATCAG
AAGCATCATCTACTTCCCTGTATTCAAAATATCTCACTGTAATCTTTCCATTCTTAATCA
TCAGCGCATCGACAGACAAGCCAACCAAGCGTTCAGCTAGATTTCCCAAATCAACATCTT
CAGAACAAAAACCTTTCTCAATCTTCTGAGAGACACTCCCAAGAAATGCTTCTAAATCTT
CCATTGAAGAGAATGCTGAAGTGTCCTCGTCCACTTGTTGCTCCACTTGTAGATGTTAAT
CATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGTAGGCACGCCTGTACAGGTGCATACGCACGTTCAAAAGC
CAACAATTGGTATCTAGAGCCTCGACGATCTACGATGACGGACAGCGACGCTGAGTCGGT
CAAGTCCGGCAGCGGCGGTGCCAAGGCGAACAAGAACGGCGACAAGGTGAAGAAGGGCGT
CAAGTCAGCAACCAGTGGTGGAGGAACGAGCGGCGCTAACGTCCAGGCGCATCGCAACAT
CCCCATCCAGTACCCCATGCTCACCGACGCCAACTACGGCGTGTGGGCGGTGAAGATGAA
GATTATTCTCCGAACCCTTCGAGTGTGGCAGGCAATCACGGACGACGACGTCGATGACGA
GTCCGACGAAGGTGCCATGGCCGCCATAGCCCAGTCTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1438, 2558..3119
2702..2863
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved