Hordeum_vulgare Locus HORVU6Hr1G017680
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU6Hr1G017680
Hordeum_vulgare
HORVU6Hr1G017680
chr6H
snoR117, snoR117, snoR117
8527..8605, 9728..9806, 11426..11504
13671
TGGAATTCTTTGCCACCACTCCACTTGCTGCATCAGGCTAAGATCTTCATCCTAAATCT
GCTTCCTATGCTGAAGCCACAAGAACCATCTTCCAAATGCCTGAGCCCAACATGACTGCA
ATGTTAATACTTATGAAGCCTTTGGCGTCAGACGCGGAATTGCCCACAACATTCTTCGTT
GATGATCTTCAGTATCTTTCGAAGACAATTTATCACATTCTTTGCCATATTATATGACCA
ATCAAGGGGCATTCGCCTTCACGCAAGCTGGAAGGGGCACTGAAGACTTTGATCTACAAC
ATCGTCTATGTCATCATGTTTAATCTTCAAGATTTATTCTTGCGCAACCTGGCTGCTGAT
GGCATCGATCTATTTGAACCTAAGATCTATGCATCATGGATCATGCGCTTTATCAAGCGC
AGGACAAACACAAGGTATTTGCCCTTTGCTTGCAACCATGAAATATATCTTCCTGATGTG
GAAGTCACACATGAAGACATTTACCCATCCAAGAGCAAGAATCCAATTGGTGAAAGCACA
AGTGACACATCTCACATTGAAGGGCTTCACATTTCATCCGATCCAGCCAAGGCTAGACTG
ATCGACGCCTTTCGTCGTCCACAATTGAGTGCCACTGTCACACAAACCATAAGTAGCACT
CCGCCTCAACAACCCCAATTCAAGAAGGAATGTGCCATGAACGATCAAAAACTTCTCGTC
TCTCTTATTCAGAAGCAGGATCGACACCATGAGCGAACGCAAAGACAAATGCATTCTCTT
GTCACAGATATAATTAACGTGATTTTTCCGTCCAACCATGTAAAAATGATACACCAAACC
AAATCATTTTTTCTTGAACATAGTACTAACGCAAGTGTTCATATACACGCACATACACTC
ATCTGTACAAACGTACACACGCACATCCTGTCTCTACAAGCATATCCGAGAGACTGAGCC
GACATATCATCTTAAAATTTACGAAGTCACCGTAATCACGTCGTCACTGACGAAAACGTC
TCATCCCACTACATACACATCGTCAAAAAATACTGAAATAAATTTAAAAATAAATACAAA
CACTAGAATAAAAAAACTTTTATGTAACCATCCAACCAACCAAAGATCGGTTCGCCACCG
AACCAAATCAAAGTCACAGCTTACCGCCGTGCGTCAACGATTGAAGAGACCAACGCGGGC
GCACCGAATGAACCAAACCAACCACCTCTATTCCCACGCCGGCCCCACCCCTCCCCCCCT
CCAGTCAGTCTCCGCCCTTCCAGAAGGCCGCCGGAGTAGACGTGCTCCGGCCACTCCCCC
CTTCAGATCCCGCCGCCGCGCCCCAGCCCCCATTGCTGCGGGGTTGCACCGGTAAGCCGC
AGTCCGCCCTGCATATTTACACCCCCGGGATACGTGGATAGGAGGATCGCGGATTTGTTT
CCACGGGAGCCCGTCGAGGCGACGACCGAGGTCAGTCAGCGGCACCCAATGCGCGCTGCG
CCGTCCCTCAGCGCAAGGTCCGAGAATCGCTGTGGAGCTGCGGGGAATCCGCCGCGGCGA
TGCGCTGCTGGGATTGGATTCGATTCCTGACTTTTGGCTTCGTTCCTTGCTTTTACTGGG
CCAGCCAGAGGGGAGTTGCATCGGCCCTTGTAGTACAGTAGCTGATTGGCAGTTGCCGGC
TGCTGCTTGTTTCGAATTCTCAGTTGATGTTCCCAGGTTTGGTGCGCTGAATTTGTTGTG
ACTGGTACCTAAAACCAATAACGTAACAGCCCCACCACCCACCCACCCCAAACTTGGGGC
CATAACTGATTTTGCACTTTCTATGATTAAGGATGCTACTGGAACTGTCCCAACTAGAGA
AACCCACATAGGGCATCAATCATTCCATGTTTCAGTTTACAGTATTCCATTATGAACCAA
TTTGAGTTCGTGCAAAACTGTGAAAATGCCGAAACAAATTGCTAGAAAAATATTTAAAAA
TGGTCTGATAACATGCCTGATATAACTCATCATTCCCATGTTCTTCATTGTCAACCAAAG
AGGAGGTTACCAGTATCCATACTTCAAAATTTCATGGAAATTTATGGAATTTACCCTAAA
TGGTTTTTTGTTTTTATGTTGTGTTACTATGTTATTATATCCATCTATTAATTTGTTCCA
CCTTTTCTTTCAAAATCATGCTTAATATTCATAGTTGACTGGTACTTTTATTATCCTGCA
GGACTTGCTTTTATCATATGACCGGCAAAATGTCCCCTCAGTGATACCCAGGCATGATTT
GGGTACTGTTCATAATGCAGTTGGCTTCTCATGGCACCCGAAATGACGAAGGAATGCAGC
TGGTGCCCCGTTGTGATCAGGAAGAAGTGTCAGATTCGCAGGAGATATTTTCACAATCCG
ATACCGCAGAAAGCTCTACCAAGTATATGGGCTCATGTGAAATCAAGCCATTGATTGTTG
AGGATGAAAATCACAACATCGATGCGAATGAAGAAACCCATCTTGTCATTCAAGACTTTC
CACAATGCCGGATTTGCCTTGATAATGAAGGTCCACACTACACTATGACCTGAAATACCC
TTTTCTTACATAACACCTTAAGGGCTTTTATATATCTCGTTGTATTTTATATCAAGTCGG
TGTTTACCATGTTGCATTTCTGCTGCAAGCAGGTGATGACTTAATTGCACCATGCAATTG
CAAGGGCACACAAAAGTATGTCCATAGGTCCTGTCTTGATAACTGGAGATCAACAAAGGT
ATTGATTCACGAGCATTTTGTCATTGTCACCGCACTTGTACAGTGTAGACGCTCAAGTAC
TCAATCATCCTAAAGTCCACCCAAAACACCTGACATGCTAACACTCATTATCGTTACATT
ATTCTCATTCTGACCTCGTTTCTTTATTATACACATCACCCAGGAAGGTTTTGCATTTTC
ACATTGCACCGAGTGTCGGGCAGCATTCTTACTTCGTGCAAATGTTCCTCCAGATCGATG
GTGGCTAAGACTGAAGTTTCAACTTCTGGTTGCTAGAGATCACACATTGATCTTTTTCAT
TGTACAACTGGTAAGATGTTCACACCTTGTATAGTCTAGTGCAGTGAACTAATTTTCTTC
AGTGATCTTATAGTAACATTAGTCTGCACCAGTTCTTTCTTTCTCTTTTTCTAGATATGT
TCTTACATATGTCGATGAACTTTTATGATGTTATATTGCATATGCAAGTACACTAGATCT
TTTTGGGGTCTCGTACTATTATTACAGTTGTAACAACGATTGAAATATGCTCCTCCTTGT
ATAGGATGCCACTCAGAAGGAGCATGTGTTCTAATAAGAGGAAAATAGTACCAGCATAAT
AGGAAAAGTTGTTGCTGTTTATTTCCTTCTAAAGATTCCAACGAACTTGCATGAATATAT
TTCTGTTTGCTGAGATTGATAGAACATTTTCTTTCTCCTAGTCCTGTTGGCATTTTGTTT
ACTGCATTGGAGAAAAGAGAGCATGCATCCTCTAAATGAGAAGTCCATAATGTACTGCAC
ACTGAGAGATATAATTGTTTTGATCTTACCCAGTTGATTTATTTTCTTTTTGCCTGATAG
GTTGTTGTTTTCTTGGGTATGCTGGTGTACAGATTTTATGGAGATGAACTGCGAGAAATG
TTTGGCTATGAACAGCATCCTTACGCTTTTTATGCGTTGGCGAGTAAGTTCAATTTTCAT
AGTGATGTCTACTACCCATGCGCATGTTACAAAATATCTTTGTCTATGATTCAAGAAATT
TCTTGAATTACCATTTACCTAAAATGTCTAATGAGAACTAGATAACTTATGCCCTTTTAT
TAGTACTGGATCTCTTCCTATTCAGTGCTGTCAATATGGTTTGCCATGTACTTCTATAAA
ACAAGCCACTTCAACATTTGCATCTTCCATTTTTAATTTTGTAGGTATTAAGATATATGG
TGTCGAAATGACCTTATGCTTGCACAATCTCTATGTATTTCTGTAACTACTGTGAGGATA
TAGATCAGCATGGCGTAATTTATGGTACCAGCAACAGCTTTGTTCCTTTGAGTCCAAAGA
TAACCCAAGTATATTTCATATAGGACGAGTCATGGTTATCTAAGTGTGTTTTGCATCTTT
CATTTTCAATACTGTAGCCAGTATTAAGATATATGGTGTTGAAATAATCTTATGCTTGCA
CAATCTCTATGTATTTCTGTATCTACTGTGAGGATATAGATCATGATGGTGTAATTTGTG
GTACCAGCAATAGCTTTGGTCCTTTGAGTTCAAAGATAACTTAAGTATATTTCATATAGG
ATGAGTCATGGTTATTTAAGTGTGGTTTATGCTCTGGGCAAGCATGGAAAGACCTGTCAT
ATGGATTTGTTTTCATAATTCAGATGGTCATCTAGACTACTTCTTGAATTGTAGGCAAAC
ATGTCTGATAGAGAAGTTTACACGCTTAATGGGAGCTACATGATAACTCATGTTTGCACT
TTGGCTCCAAAGATATGTAAATTGTAACTCAATGGGAGCTAGATGAGAATGCAATGACAT
TTGTCTGTCTATTGTTGGCGTTTAGCGTAAGCATCTGCTGTTGCGCATTGCCCATTTTGC
CCATGTTGTATATGAAGCACTTGCTCAGTTTTTCTTTCTTAATACTTATAATAATTTCTC
AAACTGCAGTACTGGCTGTTATTTTGGTTGGTTTGCTATATGGATTCTTCATAGCTATAA
TATGTGGACAGAGGATCACCGAACGGCACTACCATGTTCTTGCAAAGCAAGAGTTAACCA
AGGTTGGTGACAGAAAGAAAAACAGAAACATCAAGTTTGTTTCATCCCAAGAAGTGCATT
TTCTGATTAATAAACTTTTTCTCCAACTGATTAATTTGTAGTGCAAAATACTCATGCCAT
CAGCAATCCAATATGTTTAGAAAATCTGAATGCCAATTCCAACATAGAGTATTACAATTG
GTTTTTATTAACATGGTTTAGATTTCTCCTGTTGTCCTTGCATGATCCCATTGGGTTAGG
CTAGACACTAGAGTATGAACCATGAAGTCCCCGCGTGGTGAAAAAGAGATGTTTCTTGCT
AGTTTACATGCGCCTTTGTTTTCTTATCATGGTAAAGAATAGCTTCTTAGCATTACAACT
TCTGAAATTGTAGCACCTTCTCTTTGTTATGATAAACTTGTGGTAAACGATTTGCTCATA
CTGTAATGTTTCTCTTATGGCAGGAGTATATCGTAGAGGATCTTGAAGGGTCTGATCCAG
TGCCAGACCTTGATCCTAGCCATGTCACGGAGTTGAGGACACTGGGGCTCTATTGAGCAT
AGCCGCATATAGCATCAGGTAGGCAGTTTAAGATCTTGTTGAGTTAGAGCATTGTCTTAG
TTTTTACGGCTGCATTTTCTACTTGTCTAGAAAATCACTCTCTCAGCTTATAGATGATGT
CTGTGTAACAGCTCCACCGCTGTCAAATCAACGATGCCCATCCTCCTGTGTTAGTTTTTC
TTTTGAGAAAATCCCGTGTTATTTTTTTGAGCGGTAATCCTGTTTTTTGTAAAACAAAAC
ACCCAAAAGTTCATTTATTGGAAATATCAGTTACATCATTTATGAGGGGTACAATTTCAA
TTGTAGGTTCCTCAAACCGATCCAATGTCAAAGAAAATCGAGCCAACCTTGCAAGGCCAT
TAATAACTTTATTTGCTTCCCTATTGCAGTGTTCGAACCTAGCTATGGTAAAAATCACAA
ACAAGACGGTAGCAATTGAAAATTGCCTCCGCCGACCCCAAATATTGACCACTCATCTTC
ATTGTTTGAATGACCTCCAGGTTATCTGAATTAACAACGAGTCGATTGCATCTCATCCTT
TGTGCAAGGGCAAGAGCGAAGCCGTCGGGACATCCGCATAGTCGTCGATCTTCCCATTCT
CTCCAGCAATGAAGTTTCCTTTATCATCCCTCAAAACTGCCCTTGTTGTACCCCTAAGCA
AGTCTTGATCAAAAGAAGCATAATCGTTAAGTTTGAAAAGACACACAGGGGATAGATCCA
CCCCTCTTTACACATGGTAGCCTTTGGATAGGATGCGACAACATAATTTGCCGTTATAGC
ACGAATCCCCATCTTAACCTGATAAGCATCTTGAACTACCCCTTTGTAAACCAGTTTGCA
TCTTACACACCATAAATACTAGGCTGCAATGCTGATCATCTCCCGAGCATTCAGAAGACC
CAGACTGGTCAAATCCTGGTCTGTCAACAGAAGTGAGAATTCCAGCGCTGCCTCACTAGC
GCAATCAAACTTCACAGTCTATTAATAATTTCATCTATCCCTAGACATTTTCAAATATCA
CCAGTTGTGTTACATAAAAACAAGTGCTTGTATCCTCTGGACCAATAGAACAAGAGGGGC
AATCGGGCGAAACTTTCAAATATCTTTTCTCATTGTTGAGGAAATCGTTAACTGGTAACT
GCTCGGTTGGCTGATGAGTAAGGGATTAATAGGCTAATCGGCAAGTTAATCGGCCATTTA
ATCCATTAATCGGGTGATTTATCTGTTAACCGGCTACTCGGTGACCCTACGAGTAAGGAT
TAATCGGCAAGTTAATTGGTTAATCGGACGAGTTCTTGAACATGATCTTTTGGCAAGAGT
AACACGACAAGGAAGGGTACCATGCGGCGTATGCAAAATATTTCTTTGAACCTTTGCTGA
CAAGAAAACTTCCAAATAGTACACCAAATGAGATTAAGAGTGGAACGTCTCATTTCCTTT
GCACGCTGTAGTTTCCTCCCATCCATGTTAGTGATTCCATTCCACAAAGTAAGCTGATCG
AACCAAAAATAACTCATTCTTTGTGTAACTCCAAGTTGGGGAAGAGGCATACCGAGGACC
CATTGAGCATCAACTGGCCACAAAGTTTGTTTGACCGATCTTCATCCTAATTATTAGAGC
ATCTTTCGGTCCAGTTTTGGTTCAAATTTGACCCATTTTTAGCCTATATTTGGCATTTTT
TAGTACAAATTAAACAACAATAGTTATTTTTTTATCACATAGTTCATCACAGAAATCAAT
ACAAAACAAAAAAATAGTTTAACAAGTCAATACAAATCAAATATCGAGCTAGTCGTTGCC
CTTGAGCCTTCATACGTCCTCCACCAAATCGTGCTGCAGTTGTTGATGCACCTGTGGGTC
TTGGATCTCCTGACACATGTTGAGGAAGACAGTCCAAGTTGTCGGTAGCTGGTGATCAAC
TTGGACAAGAGGACCTTGCCTGTAATATGGTTCAGTGTCAAACACTAGCTCCTCCTGCTC
GCTCTCAATGATAATGTTGTGCAAGACAACACAACAAGTCATGACTTCCCTCATTCGATC
TTTCCACCAAGTCTGAGCGGGGTACCGGACAACAACAAAACAAGATTGAAGCATCTGCGA
AGTAGTCGGCGTAGAGCAAGCAATAGCCTTCTAGTCGATGCCTCTGCTTTGCCATCAGCC
ACCTCGGCGCCGAGCCACCTCGCCGTGGCCCTGCATTGCTCGCGAACAGGCCGCCCAGAG
AGCCGAGGACCATGAGGTGCTCTTCTTCCTGGGCGTCGGCATCGGCTTCCTCCTCCAGTA
CCGCCGCGAACGCCTCCTCGTCGTCGGAGTCCAAGGCTCCTAGATCCACTGACGACCTCG
CCGACAAGAGAATATGACTCGCTTTATTGAACGTCGTCGCCGTCTCTACCGGAGCAGAGA
GGAGATAAGGCCACACCTTAGCTATGAAGACTACTACCGGTCTACAGGTATACACGTCCA
TGCGGCTGCTTCGACGACTGCTCCCTCGTCGACGAGCACAAGCCCCCTGGGGGAGAGGCG
TCGTCGGGGCCAACGCTGGAAAACTCGCCTTGTCGCCCTTTTCAGAGGAGAAGAAAAGGG
AGGGGACCGTCGTCGACGTTTTTCTGTTCCGCCGAGGGGTGAGCGAGCGGAAAACGTTCC
TAAAATCATGATTATTGGGTTGGGGGAATGTGGTATTTTTTTCATCCGTTTAAATACATG
AGCTCTTCCGCCAGTAGGTATAAAGAAAATAGTATGATGGACTTCACTGTTAGTTTTTTT
TTTAAGGAAAACTTCACTGTTAGTTAGCCCTGTGACTTTTCAGATGTCAAAAAAGAAGAT
TTTTGTTGTTGTTGAGGGGTGCAAAAGAAAAATGCTCTATCTTTTTTTTTTTTGAGACAA
TGATCTATCTAAATTATAACTAGTGGGTTCCTAATAACGGGCCTGGTAGCTCATGCGGGC
AGGCACGTATTGGGCTTTCATGACGCCATCTCGGCTTTCTGCCTCCGCAGCCCACGCGAG
GATGGGAAACTAGGGTTAATTGGAAACTGTTATATAAGCCGCCCGTTCCCCCTCTCCTTC
CACCACCACCACAAGCCGCCGCCGCCGCCGCCGCCGCCAGCACGAGGTGAGGTCGTAGGA
CGCGTCCCGTCCGCCTCTTCTTCCCCGATTCCCCTCTCGCGTTTCGATCCAATCTGTCCT
TGTTCGGGGCCTGTGATGTGAACAATTTGTCCGTACCATCTGACACCTCTGATGATCCAC
ATTTGCTAATGTATCTCTGAGGCCCCCCATTCCGTTTCTTCCTCGTCTGTTTTTGGTTTC
GATCTTGATTTCTTTCCGCCCGGAATTTCACCGATGTCTCTGATTTGACCATGGGAGGAA
GGCAACAAATTAGAGTCTCTGATGCGCTAAAACTCCATAGCGACTTCGGTGCTGTACGTT
GCCCAGAGCGACCCCCGGCGATGGTTATCATGCGCGCGCCGTCTTCTTCCTACGGCGCGC
GCATCCCTGTCCCCTACATGCACCTCTCCGGCTTCCGTAGTGAACGGATCTTGATCGAGC
TTGCGTTGAAAAGGCAAACAAATTAGAGTCTCTGATGCGCTGAAACCCCGTAGCGACTTC
GGTGCTATACGTTGCCGAGAGCGATTTTGGAACGTGGTATCATGCGTTCGTCGGCTCGCG
TTCGGCGCGCGCATCCCTTTGTTCCACACTTTTTTAGCTCTTTTTGTGCCTTTCTTCCAA
CCACAATACAAAAAACACTTGAAAATGTTGGGCCTCTTCCTTTTTCTGTTCGCATTCCTG
TTTACTTGCCCTTTTTTGTGCTTGTGTTTGGAAACAGTCCATTATTCGATCCACTATACG
AAGTCTCTTGCCTGGAGAACGTAAGGTCTAATTCCAGGACCACATGGCAACACTGAAAAA
AAGTGAACGAAACACCAATTCAAACGAATGCAGCGTCTTAAGTTCGTTACAGGCCCTTAA
CGCATCTCAAAAAACGCTACATCAAACAGCCAGGAAAATAGGCCAAGCCAAAGCAAGTTT
TATTTTCATCGAGGGCAGGTAATTGAGAGTCTTCTCCGGCACTATGCAAATTCATTGCTT
ATCAGCCACATTGTTGAATTTATACAATCGTGTTTTACTTGCACGCGTAGCTATGGTTGT
TTTCGCCTGCTTTTCTTAATTAATCAGGCAAATCTCTTCTCCTTAATCAATGAAAATGAT
ATAAATCTTTTGCTTCTCAAAAAAGGGGGTCAAACACCTGTAGGAAAAACTTTTTCCCCT
GAGTTAGAGTATTAAATGTAAAATATGACATTTACCGGATGGAACTTAGCCGCCCACAGG
AACAACCGCTGTAAATCAGATTCCTTTCTTCCATAGTTCCTTCTCGAGCATCAAACTACC
TTTTTTGAGGCCTGTGATGTAATCAATTTGTCCGTACCATCTGACATCGTTGATGATCCA
CATTTGCTAATGTATCTCTGAGGCCCTCTTTTGGTTTTGATTTTCGCCAGACTGTTTTTT
TCAATTGCCATAATTGATCTCTGTTTTTTGAGTTGCCCAGCCATGATTCAAATGCAGGCA
ACAACTCTCTGATGCGCTAAATTCCATTGTAACTTTGGTTTTGTATGTTGCTGGCCTGGA
GCGTGATAATTAGAGTCTCTGATGTGCTAAACTCCATAATTATATGAATGATGAATGTAG
ATAGAACTTTGAGGCAACAAATTAGAGTCTCTGATGCGCTAAACTCTGTAGCGACTTTGG
TGCTGTACGTTGCCAAGAGTGAGCCTGGAACGAGTTTTCATGTGTGCGCTGCCTCACTTA
GTTTGCACTCGAACTCTTTTTCCCACACTTTGTTCTAAATGGTTTCCGTTTATTACCTAA
GAATACACCAATTACAAAAATATTGCAACAAGCCAGTCTTTAACTTAACTAATGCTCTGA
TATCTTAACTGCTTTGCAAAAGAGATGCTTTAATTTGTCTGTCAATTTTTTACTCAAAAC
AATGCTTGCTTCTTTTCTTTACATAAAGAAATGAATCCAGTGTCACAACAGGCGAGTCAG
GGCTTTATAAATACCACAGCTCAAAAACCACAACATCGAACAGCCTGGAATTTTTTTACA
GCCAGGAGCACATCACCAAACTGAAATTGCATAAGAAAAGAATCTGGGCCTAAATGGACG
ATGTTCTGTTTTTCTTTAGTTTAAGCTGGTCTGGGGAATATTTAGAGCCTTTTCTTCCAT
GAGTAGCAAAGGCAGCAATATTCTTATTACTGAATCAAATTCAATCAGTAGAAACCATGC
AAGCTAAAGCTTGCCTAACTAGTTTGACAAGCAAGTTCCATTTTGTTCAAGCAGGCAACT
CCTGGGTAGCAGTTTACTATAGGATAATTACTATAAAAAAATAAAGAGATTGAACTATAC
AAGTAGAGAAACCACTTGTTTTCAGTCCCTCCCACTGTGCGTCAGCCACATGGTTGAATT
TATACCATCATGTACTCCTTGTTTTTCTTGCAAATACGGAGGGTCATACGCCTGTAGCAA
ACAGAAAACATCTTGATCTGCTGGTTCCCAGAATTAGAGGATCACATCTAAGTCACTAAA
TCAAGCATAAAAAGAAAAAGGAAAAGAAAAGACCCACACAAATCATCACGCAAGATCAAT
GATAAGGACTTACATGTGCAATACTTATCTCACATTTAGATGTGTTTTAGCAAAACCGCT
TGGAAAAAGAAAGGTGAAATATGTCATTTTCGCTTTGATATGTACATCCGAGACATTCTA
GGCTGAAGCTACTCATAAAAAGAAAAAGGAAAAGAAAAGACCCACACAAATTATCACGCA
AGATCAATGATAAGGACTTACATGTGCAATACTTATCTCACATTTAGATGTGTTTTAGCA
AAACCGCTTGGAAAAAGAAAGGTGAAATATGTCATTTTCTCTTTGATATGTACATCCGAG
ACATTCTAGGCTGAAGCTACTCCAGAAAAGGCTGGAGCTTAACCGCCCAGAGAAACATTA
CTCACAACTGTATCAATCATGAGTACCTGCTTGCTTATCCTTCTCTTCCATGAGTTACCT
CTTGCATCAATCTACTTTATTTTTGGGGCCTGTGATGTGAAAAATTTGTCCGTACCATCT
GATATCTTTGATGATCCACATTTGCTAATGTATCTCTGAGGCCCCTTGTGTTTGCTATCT
GGTTTATGACTTTTGGTTTTGATTTTTGCTACACTTCTTCTGATTGCCATAGTCAATCTC
TGTTTTTTGAGTAGCAGTCATGATTGGAAGGCTGGCAACAAATTAGAGTCTCTGATGCAC
TAAACTGATTTTCGAACGAGATATCATGTGTGTGCCGTTTGTCCGACACTTCTTAGCCTT
GCCCTATTTATGCAAAAAACATATGAAAATATTGCAGTTGGATGCATTGTATTTTTTCAT
TGCTCATTCCTGTGTACTTGGCCTTGCCTGGATCATGTTTTGTGTGTGTCCATGCAGAAA
TCTGTTTGGGTGTCTTCTCAGTATGCAATCAGTCCAGTATGCGATACTATACCCAAGATG
ATTCTCTACTAAGAAGGAACAAGGGATGCAAACTACTGCACTGTCCGTAAAGACTGAAGG
TCTAATTCCATGACAGCATTGCTGTCTGCATGCCAAAATGTTGAAAATTAGTGAATGAAA
AGATGAAGGATACTTAATCCCAACGGAAACCAGTGTGAAATTCATGACAGGCCTTTGCCA
TGGCTCAAAAACCACAACATCTAACGGCCAGGAAACTCTATTACAGCAAGCAGCCGTGGA
GCGCATCACCAAACTGAACACATCACAGTAGAAAGAGCAGAAATGTAACATTACTCACAA
CAGCATTTTGCTTATCACTGATCCAAATTCTAGCAACAGATTAGTAATTAGCAAAGTCAG
GTCAAACGTTTACTACTAGCTATCATGAGTTAATAGTTTATTATGGTATAACAACCATAA
AAACATAATGACAGCATAAAGAGATTGATAGTTATATACTTCTTCCCGTTGCTGCGTCAG
CAGAATGGTTGAATTTACCTTGGACTTCTATAATATCCTCTTGTTTATCTGCATGTTGCA
AATAGGGAACTTGAACTGTCAGTTCACAGAATTAGAGACATCGAAGAATATTAAAGGGGA
AACATTATCTCTTTTCGAACTTGATCCAATACAACAAGGGGAAGCATTATCTCTTTTCCA
ACTTGATCCAATACAACAATATTATGATGTCCTAGATTCTAGTCTCACTTTCTTTTGGTT
GGAGCTTCTCCAGAAACAGACTGGAACTTAGCTGTCCACAGAAACAATTTGTTCCTGCTC
ATGTATCCTTTTCTTCCATGAGTTCCCTCTCGAGCATCAGTCTATCTATCTTTGGGGCCT
GTGACAATTTGTCTGTACCATTTGATATCTTTGATGATCTATATTTGCTAATGTATCTCT
GAGGCCCATTGTGTTTCTTAGCCATCTGATAATTTGTTGTTCACTTTTGCCGAAGTTGAT
TGATCTGTTTCACGTTGCTTAGCCATGAGAAGCATTAAGGCGACAAATTAGAGTCTCTGA
TGTGCTCATTCACGTAGCGACTTTGTTGCTGTACCTGAGCGAGACCGGCGATAGTTATTT
TTCATGTGCCTTCTTTTCGTATGGCATGTGCATACCTATCCCGTACACCTCCTGTTGTAT
AAAAGAATCTATCATTTTTCATGGCAACAGACTAGTCTTTGATGTGCTAAATCCAGTAGT
GACTTCTGTACTGTATGTGTATGTTGCTGAGGTACTCATACCTTTGCTGCATTTGGTTTC
TCCAGTCTTTTTGGGTGCGCATTTGGTTCCTGTTTACTCGGCCCTTTGTTGTGATTGCAA
AAGTATAAATTTGTTATTCACGTGGGAATATGTTTGATATCTTGTAAAAAGCTGAAGGAA
ACTCACCGGAAGCTAATTTCTAGGCTACCAAAAGGTTGAATTTACCTTGGGCGTAATATA
CTCTAGAGCATCATGTACTTCTCTTGATAGCTTGAACTGTTGGTTCCCAGAATTAGAGAC
ATCAGAGAAGATTAAAGTATTTCTTTTGCAACTTGATCCAGAAACAAGAACGGTAACACT
CATCAAAACAACAATATAGTATGATATCCCAAACATCCTTTTTTTAAGAGATATATTCCA
GCAGCCTGGAGTTTCTCCAGCAACGGTTGGAGCTCCCACAGAAACAACGATATTAATCAT
CCTTTTTTTCCTTGAGTTCCCTCTCGTACAACGAATATATTTTTGAGCCCCCTTTCTGAT
TCTTTTCTCATCTGGTTTTTCTTTCGTTGATTTTTCCCATGCTGTTTCTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1370, 2221..2549, 2672..2757, 2923..3069, 3632..3702, 4689..4801, 5243..5357, 11817..12671
2273..2549, 2672..2757, 2923..3069, 3632..3646
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved