Hordeum_vulgare Locus HORVU6Hr1G017030
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU6Hr1G017030
Hordeum_vulgare
HORVU6Hr1G017030
chr6H
snoR80, SNORD24, snoZ159, snoZ159
1263..1397, 1914..1999, 3994..4098, 4167..4263
5752
TTGTAAGCACGAACAATTTCTTTAAAAACGATAACATGTCAAAATATGACAACTCAACA
TATTTAAAACCGACGATCATAAATTATATTTTTTTTGGTAATTGTTAGTAATATGATATG
TCGGCATAGTTAAACCAGCAAGCACATAAAATATTTTTCTGACAAAGTTGTATGTAAATA
TGATAAGTTGACATATTTAAATTGATAAACCTATGACATACGTTTATATCATGTATAATG
AAAAATGCTACAAGACAACAATCATTTGTCAAACACGGTCATCGGGTTTAAGTAAGCGTA
GTTGCCAAAAATCTATACACACGGCTGTCAAGTTGACAACTAATGAAAATTGCTACAAGA
CAACAATCATTTTTCAAACACGGTCGTCGGGTTTAAGTAAGCGTAGTTGCCAAAAATCTA
TACACACAGTTGTCTAGTTGACAACTAAGTTAATTAAAGGTGGCTACTAAGTGTTTCATA
ATCTAACAACTAAATAATAGTAATCTCGCAACTGTCGATGAAAAAAAGTTGTCGAAACAT
ATGGACATGGGATCTAGTTTTGAAGATCTTGTTGCGAGAAAGCTAACGGTAAAAATGAAT
TGTCAATTGGATTTACACTTTAAGAGATAAACACTTTTTAAAAATTCAATATTTTTTTTT
TTGCTGATGTCACACTGATGTATTAGCTGTATGCATGAAGAAAAACCGTCGCACAGAAAG
ACGCTCGTGCAACGCCGTTATGTAGTGGCTTCCAACATTTCTTAGCACAAGGGGTTAACA
TTATTATGGGAATAGTTTTTTAAAAAATAGTCCCCGTGAGGAGAGAGGAGAGAGAGAGAC
GTGTACCGTTCGACCGGCCCACTAAAGCTCGCGCTGCCCCTTGTGCTGCAGCCCAGAAGG
CCGACGCGTCGGGCCGCCTCATTTGCAGCCGAGGAAGAGAACCCTAGACAGACCTCAATA
TAAATTCCCACCAACGCCTCGTCCAGAATCCAGACCCAATAGCTCCTCTCCCCCCTTGCG
GCTCCAAAGCTCCCCTGCGCATAGCTCTGGTTTCCGATTCGGTTCGTTTCTTGTACTTCG
TCTCGATTTTCGATCTCAGATGAGTGGTCGTAGCGTTGATGACAGATTTGTGGACTAGAG
TTTCTGATGCCGCCTCTTCAGCAGCATCTGCAGACAACCCCTTGGCTGTCTGAGCTCCCA
GATCTCATCCCATCAGATCGATTTGTTCTTCTACTTCTTTGTTTTGATTGATGCGCGTTC
ATTACCAATTCCTGAGGATGATTTGTGTTCCTCGCGGTAATTAGTCTCGGACGCTACACG
CGATTATCTCATGTGTGGTATATCCTGATTGGTGGCGTTCTCTTTGCCATTTTATCCTGG
AAACGCCACATACATTCACTTGACGTCCTCTCTTATTTCTCTCTTCTTTTCTTTGTCTTC
TGATTTTTTCCAGTCGATTGGTATGAATGTGGATGATGAGATGACAAGTAAAAATACAGT
TATCCCTGTCTTACTTCTTTGGAAGGATGCTGAGAATACTTTTAATCTGACACCATATAT
GTAGTGCTGTAAGAAGAATATTTGATTTTCGTAGACATATTGTTTTTCTTTTGGTTTGGC
TTGGATGGCGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACCAGCTACTTCTGACTCGTCATGCAATCTCTCAACTGGTGG
ATTCAGTAGTTTATTTCTTATTGGTATAGTGGTGCTTGTTCGTGTTTTTCATGGAGCCAG
TGATGTTATCAAAATATTTGCTACTCTTGATGGGCAACGACCCCATTTGATGAACACGAC
CACCAAGATCTCTGAGGCTCTGTAAATCATCTTTTATATTTTTGATGATTCTCTGTACCT
CCACAGGTAGTACGTATAAGTCTGGCGAAACAGGAAGTAATATTGTTGTCTGGAGCTGAA
TATTCAAATGTCAGATTTCTATCCATAGCTGATAAACGACATGATGCGTGTAAGGCATCC
ATACTGATAATCTAACTTAGTTTTTATTATCTGCTGAAACTTGGAAGTCACCAAATAACA
CCTGGCGTCCTGCTTCTTTTTCCAAAATAACTTGGCGTCCTGGCGTCCGTTCCTGGTGAT
TATCTGTACTTGCACATGGAAAAGTCTTTGAGATGCACCAATTCTAAAGGGCTACTCTGT
GCAACGGTTGGTGCTTGCCTTTTACTGACCTGCTTCAGATTCGGTTCAGGAAACACGAGA
ATGCATACAAAAGAAAAGACAAATCTGAAACATAAGACTTTGCAGATAGTATGGTTTCAG
GCCAAATAAGCTTTGACAGCTCGGAGTGTTTCTGTACATATTAGTATGGAGGATGATTTG
TGTTCCTAGTGGTATATCTTGCTGACATATATTTTTTTATTTTTATTTTTGGGATCTGAT
TTTGGCGATCCTGTTTGTTCCTTCTTGTTTGATATGTGAAGATGTGGTAGGTTCAACAAA
TGTTAAGTTTCTTAATTGGTTTTCAAATCAAACTAATTAGTATGTATATGCATGATGAGA
TGACATGTAAAGTACAGTTATCCCTGTCTTATTCCCTTGGATGGGTGCTGTGAATACTTC
GTCTCGACCCTTGCTTTTTATGTGCACTGATCTTTTACTAGCATGTACAATTATCTTTTT
ATATTGTTTAGAAGATCTTGTGATGAAATGTATTAATTGCTGAGCCAACCATTGTCACTC
TTTATGTCACATTGAATTGACTCATGAACAGTTTTGTAAGAGGAGACGGAGCAGCTTCGA
CCTAGTCTCAGATATTTTAAGTTTTACTTAGTTTTTGAGTGGGGAACGAAAATAAGCACA
CAATTGAAAAATCATCTAACTGTCAGTCTAAACTACTAAGAGGCTTCAGTGTAGTACGTT
TGATTGTGTTGATTTGAATCCTCATGTTAGTAGTGCCTTCCTACAACATGTGGGTCCTTG
AGTAACCGTCCTTATCTGGTACCTACAAGTATTAGTAGGTTATACATGGTATCTATAATT
TGTCCAAGAATTAGCTTTCATGCATTGGTTATATTTGTCCAGTGATGAAAAACCTGTTAA
ATCATACCATCTTTCCGGACTGATTGGTCGCTATGCGTCCATGCTGTCATTCTGTAATTC
TGAGGACAAATTATGTTGAAGATCACTTAACTTTTGTTCTGAATAAGGTGTCTCTGCCCT
TGATTAGTTGATCTTTCTATTTTATTTCTCTGGGCTCGAATTTCCTGAAGTGGCTAGGCT
TTATGGGGATCATGAGTCGCTTCACCTACTTCTAGTTGTGATGTGTAAACTGTCATGCTT
ATCATTACATCTGTTATGATTTTAATTTGCCCTTTTGTATTTGGTTCAGTTCTGTGAGTC
CAGTCATGTCACATCTTTGAGACCTGAGTTTTCTTCCTTGATGAAAATCATAATCATAAT
CCCTGAGGGCTACCAAGTTGATCTTCTGCTATTCCTTGATCCTCTTTCTTCTCTTTTGAT
CGACTATTCTTCTGCTTGATGTAGACGCATTTGCCTAGAACACATTTTCTTACAGCCCAA
CAATCAATCACCATGGTACTTTCCTTCTTAAAATCTTTAATGTGGAAGAACTGATCCTGG
TGATTCATGGGTTGATTAGATATATATTATCACCTTGATTTGGTTCGGTTCGTTTTGTTG
TTGTTCATTTCGAGATTCACCTTAATCTGATTCTTGTGTTGGTTAGATATATATTATCAC
GTTGTTTTGGCCTCTTGATGACAGGACAAATATTTTTGGTTTCAGCATTGTCCTTGTTTT
ATTATTAATCTGGTACTGGGTATGATGTTGAAAACTGTCTGATGATGATCAAACTAAATA
CTTTTGTTCTTCTGATGTGGTATCTCATATTCTCATGGCGCTGTGCGGAAGGAATCTGGA
GACCTGAATTGAGGAGACAAGTCATTTTATATTATTTCTGCCCTGAAACAATGGATGTGG
TTGGTATCATGTTTTTTATGTTGAAAACTTTCTGATGATGATTAATCTAAATACTTTTGT
TCTTCTGATATGCTATTTCATAGTGCTGTGCGGAGGCAATTTGGAGACCTGAACTGAGGA
AATACTTCATTTCTCGCCCAAAACAAGCATTATTTTATTTATTAAAAATTCTACGACTGG
TGAATGGAAATGAATTGAGTGACCATCTTTTTATTTGGCCGGCTTGGGCCGCAGCACCTG
AGCGGAAAACCTTAGATAAATCCCCACCTCCTATTTTCTTTGTGTATAAATCCCCACCAA
CGATGCCTACAATTTCCAAGCTGCAACCGCTCTTCCACTCAACCTGCATATGCATCGCTC
GTCTTATTCTTGATGAATCTCGATTTTGTTCGTTTCTTGGTTGTTCATTTCAATGGTTGA
TGAGAGGTTGTAGTGGTGATGACAAATTTGTGGACTAGAGTTTCTGATGCCGCCTCTTCA
GCAGCATCTGCAGACAACCCCTTGGCTGTCTGAGCTCCTAGATCTCATCCCATCGAATTT
ATCTGTTCTTCCATTTCTTTGTTTTGATTGATGGGCGTTCATTACCAATTCCTGAGGATG
ATTTGTGTTCCTCGTGGCACGCGATTCTTTGATGTGTAGTATGTCCTGATTGGTGGTGTC
CTCTGTGCCAGCTTATCCTGGAAACGCCACATACTTTACGTCCTCATTTCTTTTCCTTCT
GCTTTTCTTTGTCTTTTGGCTCTAAATGTTTTGAATTTGATTTTTTATATTTATTTTTTG
TACTTATCTATTGTTATGTATGTGGATGATGAGATCACAAGTAAAAATACAGTTATCCCT
GTCTTACTCCTTGGAAGGGTGCTGAGAATACTTTCAATCTGATATGATACCGGTGTTGCT
GCAAGAAGGATATGATTTTCGTGAACATATTGTTTTTCTTTTGATTTGGCTGGGATAGCG
AGGATGAAGAAGAAAATCATTTGGATTCCCATTGACTTGTAAAACATGAGATCTCTAACC
AGCTACTTCTGACTCATCATACAATCTGCCAACTGGTTGATTCAGTCGTTTATTTCTTAT
TGTTTTAGCGGTGCTTGTTTGTGTTTTTCATGGAGCCAGTGATCTTATCAAAATATTTGC
TACTTGGTAGAGGCTAGGGTTCTATCAGGTCTCGGACGTAGGTTGTAGGGGTGGAAGTAC
GGGCTGCGAGGTTGGGGACGACGGCGTCGGCGGTTGGGCGCCGTCGCGGCGTGAGAGAGA
GAGAGGTGGCTAGGGTTTGGGGCTCTCGTCTTCTGAGGGAGACGACAACAAAATATACTG
TTTATTGTCTGCTTAATATCGAAGGGGTACATTTGTTTATATAGGAGGACAGCCTCTCCT
AAACCCTAGATAACTTGGACTCTAATATAACTTGGACTCTAAGATAGGTAAGATAACTTT
GGCTAAGCCCGTAATTAACCCTGCCCAATGGGCCTCCTCCGTTGGTACGTTGTACCGGTC
ATAACATCTCTCCCCGCCTTCTCAAACAGCTCGTCCTTGAGCTAAACATCTGGAAACTGC
TGGCGGAAATCGTCGAGCTTCTCCCAAGTTGCTTCCTCCTTTGGCAGGCCGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 2046..4138, 4223..4752
4001..4138, 4223..4597
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved