Hordeum_vulgare Locus HORVU6Hr1G007030
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU6Hr1G007030
Hordeum_vulgare
HORVU6Hr1G007030
chr6H
snoZ118, snoZ118, snoZ118, snoZ118, snoZ118, snoZ118, snoZ118, snoZ118
3957..4065, 4196..4304, 4461..4568, 4703..4812, 4976..5084, 5269..5376, 5414..5518, 5854..5963
8559
CAGCGCCTTCCTTACCGGAGGTTTCAGCTCCACCTTCTTCTCGCCACTGTGCGTGAATA
TGTCCTCGGCGCCCAAGAAATCATCCCCCTGTAGCAAACAGCAATGGTTACCAGAGTTGT
TCCTTTAAGAAGAACTAACAACTGAGAAATTTGTGGCAGTAGAAGAGTTAACAGAGATGC
CATGATATAGCAGTATAAAAAATAGCAGGGGCACTGACCAGCTTGCTTGACTTCTTCGAT
TTAGGATGCAGAACCTTCTGTGGAAGCTGGTCTTCACGTAAAATGGGGTTCTTAATGACG
GCATCTCTTCCACCTTGAGGCATCGGAAGTGAAAACTGCAAAGCAAATAGGCAATTAGAA
ACAAACATAAAGATTAGGCACAAGTGGAAAACCATCACACTGCAAGATATTTGCAGTCTG
CTTCACCAAATACTGACATCGAAAAGCTAGAAGCAGAGTTCTGGGTATTCATCACCATTG
ATTCTAAAGAACAAAATTATTCACTGAACATCATGGAAAGAAATATGCATATGTTACACA
TTAAAATTATCCCTTATATGTTTTTTTAAAATTTCTTGGATAACAGCAGACCATACAGGA
AACAATCAACCATAGTTGACCCACTCAAACACAGAAGTAACATAACAACACAAGCTGTAG
TCAACATGAAGAAAATACAGCATAAGTGTGAATTTATCAATTTAGCCGCACTCACTTTTG
TGCCTCGGAGTGTAACACGCGGGCGTCGTGAAGCCATAGTAATCCCATTTTCACCAACTG
TTACTGAAACCTTACGCAAGGTGCCGCCATTGCCACATTTTGGACAGAATATTTTTCCAA
TCTCTTGGGTCACCTTGTAGCAAGCATGACACCTCAGAACCCACCTGGCCAATCAGCACC
AACACATGAGAGACAGATAAGAATGTGCAAGCTTCTATAAATAGGATACTATTCAAAATG
GATGTAGAGTAGTCAAAGAGGTGGAAAATGTTAGATTCACATACCTGTGCAACTGACGTA
TTTGCATACCGCCTGGTGCCAAGAGACGGAGACCAATCTGGAGGATAACGTTTTGCATGG
CATAGTCACTAGTAACACATGCTACAGTTGATTCGGACAAGGACCTCAGGGCCCAACTTT
GCTCACTGCTCTCATCATCTACAAAAGATGCACTGACACTGACACCTTCCTCGGTCTCGC
TTTTTATATCCAAATTATCCAATTGTTCAGTGCATGCATCAGTAACATCTCTACCCTCAA
TAGTATAAGCATTGCCAACCCCATTCTCCCCATTAGATTGTTGATCTCCAGCAATTTTTG
GTTCATCCTCTTCCTGAGATTCCAAGTTGTCAGTATTTGACCTTGTTTTCTCTGGAACAA
CAGAAGGGCCATCCACTGAATCCAAACCATTTTCAGACAAGTCATTATCCTCATCGACTG
TTGGAGCAACAGAACTTGTATCAAAGCTTTGTTCAGATGCCTTGAGGGCATCGCGCCTGG
CTTTCCTTCGCAAATATTTTCTGTGCGTGGTGCGGCCAACAGCAGGCAACCAGCCTTCAT
TGTTCTCATCGTCTTCCCAAGGAATACATGCATCTCTCTTTGAAGGCTGAAACTCTGCAT
CCCCTTGTGTCTCAGAAATACTGTTGGTCTCGCTTGTAGGGATCTCCTGATTCTCAAGAT
CCTTCAGTGGGAGGATCCGAGAATTAAGATCACCTCCTGATTCAGACATCTTATCCAGTG
CTTCCCACTCTGCTAGGTTAGTAACATTGGAGCCCCAGCCAGGCAGCGGAGCCTCTTGCA
AGGTCCGGACGCTGACCACATGGAGTGGAGGTGGGTGCTCCCGCAAATGGCTGGTCCCAT
GGACCTCAGCCTCCAACATGTAAGCTAGAGCGATAATCTTCATATCAACATCGGAAAGTG
TCTGGAGATCTCCTGTTTCCCTGGCAAACTTGACAACTGCAAGCAATGGTGATATACAAG
TTAGTCGCCTCTAAATATGTTGTTACTTAGACCAGAGAAAAGTTTACAATGAAAATGCTA
ATTCTACCGAGCAGAAGTAACTTGAAGGCCATGGACGATCCGAGTTAATTTCACAATTAA
ATGCTAATTCTATCGAACAGAAAGTAATTTCCAGGCTACGGACAACCAAATGTCAACATA
TTGCAGTGGTAAAAACAAACAATAATAAACTACCAAATTCTAGCCACGCAGCCAGTAATG
CCAAATTCTACAGACAGCGTGATATCAGCCATCCTTTTAAACGGCACCCTGTTGCATAAG
CATGCCTACACCCTGAACATAGCACTGAAGGTTACTCCAAGCAACAAGACTCTGAATAAA
CACCACTCCAGGCCTAGTTTCTGCTAAAAAAGACGAGTATGATGAAAAGATGAAAACCAA
TCCAGCTACGCAAATCATCGTCATGTACCTAGTGCAACATAAACCACCTATAATAAACAC
TTGGATGAACAAAAATGAATTGAAGTCCAAGAAAGTACAGAGTTTCAGCTGTATTATTTT
AGCAACAACCGAAAAAAAAATGGTGGCAGTGGTGGGCAAAGCATTGGACCTCGCTTGACG
AACTCGGGGGCGGGCTCGACGGTCTCGACGGGGGCGGGGAGGAGCGCGAGCCGGCGGCGC
GCGGCGGCGTCGCGCACCTCGTCGAGCACCTCGGGCACAGTCACCAGCCGCCCGGCGGTG
GAGGCCAGCGCGGCGCCGCCCGAGATGACGGCGTTGGCGTCGACCACGGCCACGGCCAGC
CCGCTCGAGCTGGCGCAGCTGGACACGATCCGGCTCACCGCCTGCGCGGACGACTCCTTG
GCCACCGTCTCCCGCCGCGCCGTCGCCGCCGCTCCCCACGCCATCGGTGCCCCTCCGCCC
GCCGGCGCCGCGCCGGCCGCGAAGGCCGCTTCGCCCNGGGGGGGGGGGTAGGGTGGCGGC
GCGCTAGGGTTTTGGGGCTCCGATTTCACTTATTTTTGGGCATAAATACGCTGGATGTAT
TTGCACGGAGCACACAGGAGAAGACTTAAATTTTCAGGTAACCCCTGGGGTTGGAATTTA
GCCGGGAGGATGCGAATAGTGGGAAAATGGGGGACCTGTGTGGGTAATATCCATCCAGAG
TTCTCCACCCACGATATAACGGCGTTGAGGCGGAGCCATCCCGTCCCCAATCACCATCCT
CCATGGCCGCCGCCAAACCCTAGCCGAGCCCAGCCCGCCGCCACCCCGCTCGCTCCTCTT
CGCCGCAGCGGATCCCCGCCAGATCTAGGTGCTCGCCCCCTCCTGCGCCCCTCGTCGCCG
GTAGTGCCCCGATCCCCTCCCTCTCCCTCTCCGCGCTCCCCCAGCCCGAGCCTCGTCCCC
TCAGATCCGTCCGACGGGCCACCGCAAGGTGCGACTGGTTCTCCCTCTCCGATGGTACTC
ACGTCCGCTGGTAGATCGGGCTTTGGTTAGGGTTCGTTCGTGGATTAGATCGGGTATCCC
TTAGCGCGGCAGGTTTCGTTCCTTGGTTCGTGGACGCCGTTGGCTCGATCTGGGCTTGGC
CCTTCTGCCTCCTGGGTAGGAGTTAGTGATTGTGCCGGGTATCCCAGGCTGACGGTTGTT
TTGCTGTGATGAATCGCAAGGACGGTATATGAGCTAGTCGGCTGTTGAAAAATGGCCTCC
TTGCTTGATTACGCACCCTTAACTGATCATAAATTCTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTGATCATAAAT
TCTGAGCAAACGACACACGCTCCCATGCTTCCAATCATGGTTGTTTTGGTTTTAGTTTTC
CTTGCATTGAAATGTGTAACGAATGCCTTGATGTTGTCTTGTGTTAGCCTGATTGTTTGT
TTGCGGTGATGAATCACAAGGACGGTATCTGAGCAAGGTGGCTCTTGAAGAAGGCCTCCT
TCCTTGATTATGAATCCTGAACTGATCATAAATTCTGAGCAAACACACTTGCCTGCTTCT
CATGGTGGTTTCCTTTTTTCCTTTAATTGAAACTTAAAAAAAAATACACAGTAGTTTTTA
TTTGTGTTGATGCGTTGAAATGAGATCAGAAACATATGCTATCCTGACATCTTGATTGCT
TGCTGTGATGAATCACAAGGACGGTATCTGAGCTAGGTGGTACTTGAAGAAGGCCTCTCT
CCTTGATTATACACCCTACACTGATCATAATATCTGAGCAAGCATGTGCAAATGTTAATT
GACAATGTCCTCAGTTGGTTTTATGTTGCAGTCTGTCCTGTTGTCATGCATCGTTTGTTT
GTTGAAATGTTAACCAATGACCTCACTGGTTTCACCAGTAGCATGTGTATTCCTAGTTTT
CATAGCTTTTCTGTGCTTTTATGTTTGCTGTGATGAATCACAAGGACGGTATCTGAGTAG
GTTGGCTGTTGAAAAGGCCACCTTCCTTGATTACTCATCCTAAACTGATCATATATTCTG
AGCAAGCATGTGGAAATGTGAAGCGAAGCATGATCCACAATGACTTTACATTATCTTTTG
TTCTTCTGAAGTGCATCCTTTCCTGCTTGAAATGTAAATCAACTACTTTTATAAGTTCAT
GGGTTGTTTAACCTTTGTCTGCTTGTTTGCTGTGATGAATAACAAGGACGGTATCTGAGT
AAGTGTGGCTCTTGAAAAAGGCCTCCTACATTGATTACACATCCTAAACTGGTCATATAT
TCTGAGCAAATGTGTGCACGTCTTAAATGAACACCCAGCGTGCTGGTGGTCTCTGGCCAT
TGGCCCTCTTGTCTTAGATGTGTTCCTGGTCCTTATATTATATAGCTTTGTTATGGATGG
CTGCTTCATTTAGAAGTTAAATAGACACTGTTTCTGTATTTTACTTCTGCAATGCTTGTT
TGCTATGATGAATCTCAAGGACGGTATCTGACAAAGGTGGCTCATCAATGAGTTCTCCTT
GGTTGATTACACATCCTAAACTGATCATATATTCTGAGCAAAAGTGTGCAAGTTTTAAAT
GGACACCCAGCATTATGCTGGTGGTCTCTGGTCATTGTCCTCTTATTTTTGATGTGAACT
ATCTCTGTTTATCCAACCAGTCCTTATATTATGTAATTTTGTTAAGCATGGCTGCTTCAT
TTCTAGAAGTTAAATAAACACTGTTTCTGTAATTTACTATTTCAAAGCTTTTTTTCTATG
ATGAATTTCAAAGACGGTATCTGACAAAGGTGGCTCCTTGATGAGTCTCCTTGCTTGATT
AGACATCTTAAACTGATCAAATATTCTTAGCAAATTGATTTTATTGAATTATAGAACAAA
CATATATTTCTTCTTGTTTGCTGTGATGAGATCACAAGGACGGTATCTGAGAAGGTCTCT
AAGGAGTGCTACTTCATTGATTTTACATCCTAAACTGATCAAATTTTCTGAGCAAACGGG
CTTTAAACGAAAGTCATTCTGTATGTACACATGCCAGCTTAAAGAACAGTATATTTATTC
CCAGTTTTTGTGTTACTTTGGCTATTATGCCATCAAAGGACGGTATCTGAATAATTGGTG
CTTTATAAAGTCCTCCTTCCTTGATTATGAATCCAAAACTAATCAAATTTTTGGAGCAAA
AATGTGTGAACAATTATTGGAACTACTATTGTGCTACCTGAAACAAGATATCTCATTCCA
TTAACCATTTTAGCATGGTCCTGACCACACATTCAAGAATCACAATTACAGAAGTTAACA
AACAATGCCCTTAAGTTTGTTTTTGGTTTCTGCTTGTTTGCTATGAGGAGATCACAAGGA
CGGTATCTGAGAAAGGTGACTTTTTAAAAAGAGCCACCGCCCTGATTATAAATCCTAAAC
TGATCAAACTTTCTGAGCAAATGTGCCTAAACAATCAATGAGTATACTCAGTATCACTGT
ATTAATATAAATAACTGGTGACATTTTCCCTTGATTTTAGTGTCATTAGAAAAATGTGAT
ACTCTGGACAAGCTCTTGTTCGAAACAGTAGCATCTACTCTTGATTTCAGTGTGTTCGCC
ATTTCTTCATGAAGTTTCACTTTTTTTGGCCATCCTTGATTCTCATGAATTTTTATATGT
GCTGCACTTGCACTTCTTTTTCCAACTCCATTTTCTTTTGGTATTTGAACCAGGAACTGT
AATTTTTTTACTTAAATGAGTTTGTTGAAAATATGGTTATGTCTTGTGTCTTCAGGCAGA
GCAGTGGTTCCTTTCTCATGTGCTTTATTATGTGGTATTAGGATGATCATTCACCTTTGA
AGTAGTGCATTACCAGAAGCTCTCCTATAGGAAGATGGAATCTGCTGACATACAGACTCA
ACTTATACATGGTCTTCCAGATGAGGTTGCTCTTCTCTGCCTAGCAAGGGTTCCTCGGCA
GTATCACAATGCTCTCAGACGTGTCTCAAGGGGATGGAAGGCATTGTTATGCAGTGAAGA
ATGGCACTCTTACCGCAAGAGGAACAACTTGGACGAGTCCTGGATATATGTGATCTGTAG
GGGTACAGGCTTCAAATGCTATGTTCTTGTTCCTGACCCTACGACCCGGTCCTTGAAAGT
CATCCAGGTGATGGAGCCTCCATGCTCTCGGCGAGAAGGTGTTTCCATAGAGACCTTGGA
CAGGCGGTTGTTTCTTATGGGTGGCTGTAGTTGCCTAAAGGATGCTAATGATGAAGTGTA
TTGTTATGATGCTGCTTCAAATCACTGGAGCATAGCAGCACCAATGCCTACTGCTAGGTA
CTCCTACAGCCTCAGCTCCCTGTTTGTTTTCTCTGTTGCATATGTCTCCTACCATCTTGG
TTAATTGGGCAGCCTACTAACCCATTTGCTCCTTTGATTTCAGGTGCTATTTTGTATCGG
CATCTCTGAACGACAAGATTTATGTTACTGGAGGATTTGGGCTGACAGACAAGTCACCTA
ATTCTTGGGACATCTACGACAAAGCCACAGACTCATGGCGCTCGCACAAGAACCCTATGC
TTACCCCTGACATCGTAAAATTTGTGGCGCTGGATGATGAGCTGGTGACCATCCACAAGG
CGTCCTGGAACAGAATGTACTTTGCGGGTATATACGACCCGGTTGACCAGACCTGGAGGG
GCAAGGAGAATGAGATTGCCCTATGCTGGTCTGGCCCTACGGTCGTCGTTGAGGGGACGC
TCTACATGCTTGACCAGTCCCTCGGCACAAAGCTGATGATGTGGATTAACGAGACCAAGG
AGTGGGTGATGGTCGGCAGGCTGTCGGACAAGCTCACACGCCCACCTTGCGAGCTTGTTG
CCATCGGCAGGAAGATCTATGTGATCGGTCGGGGGCTGAGCACAGTGACCATCGACATGG
ACACGGCGGCCAGGGTGGACGGGTTCCTGGTGTCCTCGTCGACGGCGCCGTTGATGGAGC
ATGACTTCCCGCCGGAGAAGTGCAGGGTGATCACCATCTGAAGACCTTTTCTAGCTGGGC
TTGTTTGTGCTGTGAAACAGTGGACGATTTTCTTTTATTCTGGCTGTATATCGACTTGTG
TGTTTTGACGAGATGGCTGTACAATGATTGACTTTTTAACTGTAACAAGAGGAAGAGGAA
AGGAAAGCTCAGGATGTTTACTCATTGAGTGTATGTCTCTGTACTTTGTTGGATGTTCAT
AAATTCTGATCGCAACACGTCTCTCTCCTGTTTTCGCCATGTCCGCTAGTTGAAAAATGA
AACGATCCAAAAATACAAACATGCCAAATGCAACTCCTACTTCCTCACCTCAAGCCACTT
CTTGCCTTTTGGATCCAAGAGATTTGCGTCGATTGTTGAGAGCTTGAGCCATCATTTCTC
TTGAACCTCTTGTTGTTCTTGAGGTCATCATGAAGGGTTGTATCTGCAGCTCCGGTCGGC
AATATTTATGTTACTGTAGGTCTCATACGAAGAGACAAGTCACCGCAGTCTTGGGATATC
TATTGCAAATCCACCGACACTTGGTGCTCGCACAAGAAGCCGATGCTCACCCCTGACATT
TTAAAATTCGTGGTATTGGATGATGAGCTAGCTGGTGACCATCAACAAGGTGTCCTCGAA
CATAATGTATTTTGCGGGTATATACGACCGGTCGACCGGTCCTGGAGGGGCAAGGAGAAT
GAGATCGCCCTATGTTGGTGCGACTTCACGGTCGTCGTTGGCACGACGCTCTACATGCTC
GACCAATCCCTTGACACCATATTGATCATGTGAATTAACGAGACCAGGGAGTGGGTGATG
GTCGGTAAGCTATTGGGCAAGCTCATGCGCCCGCCTGTGAGCTCGTGGGTATCGACAGGA
AGATCTACGTGGTTGGCCGGGGGCTGAGCATGTTGACCATCGACATGGACACGAAGGCCA
GGGTGGACGGGTTCTTGGTGTCCTCGTCGACGGGCCCACTGATTGAGCATGACTTCTCGC
GAGAGAAGTGCAAGGTCATCATCATTTGAAGACGACTACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..3387, 6341..6836, 6943..7559
6394..6836, 6943..7540
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved