Hordeum_vulgare Locus HORVU6Hr1G005390
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU6Hr1G005390
Hordeum_vulgare
HORVU6Hr1G005390
chr6H
snoR64, snoZ199, snoZ199, snoR64, snoZ199
1616..1717, 1848..1930, 2119..2198, 2538..2639, 2779..2863
5462
ATCTCCTAAGCGAGTGGTAATGCCTTGTTTGTTATGGCTTCGTAGCAACGCATGGGCAT
TGTGTTAGTAGTAATAATAGTTCATGTTTCGCTGGACATGTACAAAGGCGGCATGCTTTT
TTGTTAATGTCGACTTGATCAAGACGCGTACAAGCATAGCTTATTATCTCCTTGAAGAGC
TCGAACATGTGTAAAAACCTCGTGTCCCTGATACCATCGTATGCTTAGCTTGGGATTCTG
TACCTCGTGATCTGTCGGATTTACCTCCGCCAGGGGAAGCGACATGATTGGGGACGAGGG
TTTGCGACGGGATGCACTTTGACTTAAGACGACGTTGGGCACGGAGAGCATAGTTGATTA
CAGAAGAATGAAGGGGCCTTTTTGTAAAAAATGTGAGGCCATGTAGTTGATGGGATCTTG
AGATGTACTCCATCCATCCCATAATATAATAGCGTTTTCTAAACTACGCTAGAGTGTCAA
AGACGCTCTTACATTATGAAACGAAGGGAGCAATAGCTAGGGTTGAGAGTACAGACGTGT
CACTTGCGGCGGGGGCGGATCCAGAAACAAAGGGAGTAACGGAAAGTATTCTGCACACCC
CCGCGGTCTGGGTCCTGGATCCGTCACTGACTTGCGGCTTAGCATCAAAGACCAATGTGA
TTTCAATAGTGAAAATTGCTGAGATCTCAAGAAAAAAAACCCATACCACTTCAAAAAAAA
AGAAGACATTTATTTCCTTGTTGACATGTTTTTTTTACAAAGTACGTGCGGACGTTTCTT
CTTCTTCACGAGAGCACCTTTTTTATAACAACGAGTTCTCTTTTTTTTTTTTGAGGGAGA
GATTTGTTTTAGCAGCGAGTTCCTTTTTCTTTTGAGTGGACTTGACGAGGGCACCTGGTT
GGGGGCAATTGGGCTTGCATTGAAGCGAGATGGACCAAATGCAGCGTCCTCGTTCTCACG
GCCCAACAATCCAGGAGACAAACAAAGCCCACCACGGCGCCCGGCGGCTGCGCCCCCTTA
TAAAGCGCGGTAGGGTTTCCCCCACTCCGCCTCCACCGCCGCCGCTCCCATTCGCTCGTC
TCCTCCAACCCTAAGCGATGGTACGTCCTCCCCTCCCTCCTCGCCGCCGGCTCCGTCGTC
GCCTGTCGCTGACCGTCTGTCCTCGCCGTGGTTTTGTTTTTTGCAGACGAAGGGTACCGG
CAGCTTCGGCAAGCGCCGGAACAAGACCCACACGCTCTGCATCCGCTGCGGCCGCCGCAG
CTTCCACCTCCAGAAGAGCACCTGCTCCTCTTGCGGCTACCCCGCCGCCCGCATCCGCAA
GTGTAAGCTACCCCCTCCCACGTCCTCCGTTCTGGATCCCCATGCCTGTTACTGCTACTG
CGCCACGTTCTTGATGGTGCCCCTCGTCTCTTGGATGTTACCTAGTGCACATTAGGATGT
GGTTGTGAGAATTGAGACGTTAGCGGTTGATTCAGTCACCTCGGTTCGTACTATTTCTGC
ACGCTCTGATGATGGTTGTCGGATGCTAGTTTGATCTCCGAGCGGGAGTTTTTAGGTACT
GTTGATGCATGTATTAGCGGGATTATCGGATTCTCTATGATGTTTCTGCGGTTTGCAAAA
TGCTGTGATGAATAATGAAATCTACAACGCATGTCAGACTTCGGAGATGCCATTTATTTG
GCATTGATGAGAAGATATTTCATACTCTGAGCAAAATAAATTCGTTTTTTTTCTGGATAA
TTGCCAGACTTTAATGTGTTGCCCTAGCTCTTATTCGTCTTCTGTGTTTCCCTATCTCCA
TAGTTAGTGGCGCGTACTTGTGTTGTCTATGCATGCTTATGCTTGTGAGGGTCAAGTGAT
GAGGAATAAACTGCAACAATATGATGGAGCTAAGCTCCTCTGATTCTTAGTATTTAAGTC
TCTGATGACACCTCACCCTCATATTGTGTCTTTCTATGATGTCAACATAGTGAGAAAAGT
CCTGCATTTTTAACAGTTAATATAATTATATTCCAATTTTGAGTTTTTAAATTGACAATG
TGGAAGAGTCTAACTCCCAACCAATTTCTAACTTCAACCTTGGTAGTTCCAATTTTATCT
GTTGCCTGATATCATTTGTGGTTCAAGTGATGAAGTGAAACTGCAACAATATGACAGGAG
TTACACTCCCGTGATTCGTAGTTTGAAGTCTGATGATTTCTCCATGCTTCCATCTTGTAT
TTACCATTTTCTTGCGAAATGCAATTCTGTTGACGTTCTTGTCTTCTTAAAGTTGCAGCA
ATATGATAGGACCACAATTTCTAGTTTTTTTGCCTGATAATTTCTCCATCAGTTATCTTC
CTCTGCCTTCTTTTATGCCATCTTATTTACTTATTTTGTCCGACTTGTAACATGCTTAGC
TGTGAGTCTTTACTACCACCTCTGTTTGGATGATGGTTGTTGGATGCATAGTTTGATCTC
CCAGCGGGAGTTTTTAGGTACTGGTGATGCACGTGCTAGCGAGATTATCGGATCCTCAAT
GCTATTTCTGCGGTTTGCAAAATGCTGTGATGAATAATGAAATCTACAACGCATGTCAGA
CTTCGGAGATGCCATTTATTTGGCATTGATGAGAAGATATTTCATACTCTGAGCAAAAAA
AATCGTATTTTGTTCTTGATAATTGCTGGACTTTAAGTTGTTGCACTAGCTTTTATTCGT
CTTCTCTGTCTTCTGTGTTACCCTATCTCCGTAGTTAGTGGCGTGTACTTGTGTTGTCCA
TGCATGCTTAAGCTTGTGAGGGTCAAGTGATGAGGAATAAACTGCAACAATATGATGGAG
CTAACCTCCGCTGATTCTTAGTATTTAAGTCTCTGATGAGACCTCACCCTCACCATGTGT
CTTTCTATTCTGTCAACATACTGACGGAAGTCCTGCTTTTTGCACAATAAATATAATTTT
ACTCCAATTTTAAGTTCATAAATTGACAATGTGGAAGAGTCTAACTCCCAACGATTTCTA
ACTTCAACCTTGGTAGTTCCAATTTTATCCGTTGCCTGATATCATCTGTGGTTCAAGTGA
TGATGAGAAACTGCAACAATATGAAGGAGTTACACTCCCTTGATTCGTAGTTTTAAGTCT
GATGATTTCTCCATGCTTCCATCTTGTATTTACCATTGTCTTCTGTAATGCAATTCTGTT
GATGTTCTTGTCTTCTTAAAGTTGCAGCAATTTGATAGGACCACAATTTGTAATTTTTCT
GTTGGATGATTTCTCCGTCAGTTATCTTCCCGTGCCTGCTTATATGCCATTTTATTTACT
TGTTTTGTCCGACAGCTAACATGCTTAGCTGTAAATCTTTACTACCACCTCTGTTCCTAT
ATGTAAGACATTTTAGCAGTTTGTTGAACGGCCCCAATTTCTTATATTTAGAAACGGAGG
GTGTATACTTTCTTATGCGTGATCTTAACTACTAATGATCAGACTTTTGGTCATGATTAT
TGCTTTGTGGTGTTCACTGTTACAATCCATGAAACTTGAGCAATTTAACAAACAGGAAGC
TTACTGTATGGTGTTTGCTGCTCATGTTGTTCAGATTGTTTATTACATTTTGTTTTCTTT
GATCTGATTGGATAGCCCTTTCTCTGCATTGTCTGGGATTACTGGTCCTGTATTGTCTTA
TGTTTTATTAGTGATTTTGCCACTTTTGGTGCTTTTGAGTTGCTCAGTGCTAACTTGGTG
ATTCATATATTCAGACAATTGGAGTGTGAAGGCCATCAGGCGCAAGACCACCGGCACTGG
AAGGATGAGGTACATGCGCCACGTGCCTCGCAGGTTCAAGAGCAACTTCAGAGAAGGTAA
CCTTGTCATCTTTATCAGAAGTTATTAACACTGGGAACATCCTTTTATAACTGAACTTGT
TCTGATGCATTTCTGTCTGTTGCTTGTTAATTCAGGTACCGAGGCTGCCCCCAGAAACAG
AGCAGCGGCCAACTAGGTCTGGATTTTGCCCCATCTGGAATCCCGTGAAGCTAGAATTTA
AAAACTTTTGCTTGGACTGTACCCCCTGCCTAAACTATTGTTGCTATAGAATTGAGTATG
GATCTGATATGTTCTGTTGCATTGGTTTGGAAATTGACCTCTGAATCTAAGACCAAGTTT
GTCTGAATGTTACAAGTTCTTGATCCGTTCTTCCTCCTTTTTTCTCTTGTATGTTGGATG
TAAGGGCATCTGCCCTCCAATCTAGTGAATTTTTTAGTGCTACGTAGCTGTGTGGCATAT
CTGGTTTCTAATGAGGCTGGCTGCCTGTGTTTTGATAAACCGAACACAGTTCTGAACAAC
AATATTTTCGTATGGCTGAAAAACGTACAAAATTGGCAGCGAGAGTCGTCTTTAGAGCAT
CTCCATTTCATGATTCTATTACCAGTACTACCTCTGTACCATAATGTATGCTGTTTTAGC
TGCTTAAATGAACTGCTGTTTTAGCACCGGAAATGAACTGCTGTTTTACCATAGTACTAC
TTCTGTACCATAATATATGATGTTTTAGCAGCTAAAATGTTGTTTGAGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGCT
CAAACAACATTTGAACTTCACATGCCGAGAAGCTTGTAGAAGTAGGTGTACTTGTCGCTG
ACAAGCTTGTAGAAGTAGGTGTACTTGCCGCTGACGTTGTCGTCCTGTGCTACGCCATCG
CCCACATGCGTTCCTCATCGTCAAGAAGGAATGCCGGCTCCGTCTTTTGCCTGATGAGGC
GTCAAGCTCGTTCTCCTCTAGGAAGGAATCTTCCCACACCCATTTGAGGGTGGTCTCGTC
GTCGGCCATGTCGAGGTGTTCCTTCTTGACGGTGAGGAACGCCGGTTCCGTCTTCTGCCT
GGCGAGGCGGGGGGTTGCGACAGGCTCGTTGCGGGAGCCGGACGAGGAGGACGGCCCCGT
CTCCATCCGCCTCGGTGTCCAGGAGCTGCCGCGACGGCGGGAGAAGACGGGTGGTGGTGG
GTACTCGAACTGTGACGAGTTGCCGTCGTCGATGTGCTCGAGGACGGCCTCCAAAGTGCG
GCTGGGGACGCCCCACCGTTCGCGTCGCTCCTCGAAGTTGTGGCGACCGCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 1186..1321, 3734..3835, 3935..4462
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved