Hordeum_vulgare Locus HORVU5Hr1G111970
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU5Hr1G111970
Hordeum_vulgare
HORVU5Hr1G111970
chr5H
snoR1
5356..5452
7610
cgctgcggcgcgctgaagttccaagtaatgaggaaaagtgctcatggatcaccttctcc
ttgtcttcctctgcttttactatcccatccgtcccatgcaagctgtggatgagagccttg
cgtcttctatagtttttttggcttggaagaaagtggttggtgcgtccccagcccgcagcc
aggtgatccgggaggcctgacgcttccgagcatggtctagtgccgcaaggcctagaatgc
gtagctttcggagttttagaagatggaattctgcatccggaaggactcgactttcttggg
aaatgtcgaaacgaagaactacttccgtgaccaagtgcagttgaagttttgcaccgccaa
agaggggtttgctccaaatcctaaggtctctgacggccctacccatcttggtattcagcc
ttgcaaaagcacacatgggcggcgttggacgattccaggcgttgttaactgtttcctgaa
agtgcgggaaacggtccagaacaatttgaatttaaatttcgtccggacgcaagggtgcag
ccatcgcggcaaggagtagggggcagtggtgtgagcaagaaatagtcttgacgactagaa
gttgattgaaatatgaaaaaaatagaattaggatgaatatgcggcaagcgaatatgaata
tgtttttggtacatgtgcgaatatgaggcaagcgagaaatagtctcgacgactggaagta
gattgaaatatgaaaaaaattagaattaggatgaatattttggtacatgtgcgaaaatgt
ttatgaaaatgattaaaatgctactgaaaaaattggaattttcgtttctcaaatatgatg
agatgtttgaatggttgaaatgatgcaaatgttttctgaagttttgatatttgtattaga
tgatttttttctattaaaatgtcaccgagataattggacgaatgttttctgaagttttga
ttgttgatcaatcttgttcgtcgattcttgatccaatggcaGGATTATTGACCGATCTCG
TTCGTCAACTCTTGATCCGATGGATGTAATAAGTGGCTAATTCATGTCCAGGAGGAAATT
CACCCTCTGCAAGGATAGCCCTGCCGCCGCTGCCGCTGCGGGCTGGTCGGCAGCCGGACC
ATTCCTCCGGTGTGCTTCCAAATGGCCCGCCGCCTTCTTCTCCGTCGTAGCCTCAGCAGC
TATTCCACCTCCGCCGCCGACATGGTCGTCTCCTCCATCCGCCTCCTCTCCGCCACCAAT
CCCACCAAATCAGCCCCAACCCCGACTCCCCTTCACCCCGGTAACCCCAATCCTGATCCA
GGAGCAGCTCCTCCCCACCCTCCTCCTCCCACCACAACCCTCCTCCTGTCCCCGGCGGAC
CGCCTCCGCGGGGTCTTCCTCCAGAAGCCCCCCGGCCGCGCCGCCCTCCACCGAGCCCTC
TCCTCCACGGGCCTCGACGCCCTCTCCCCGGAGGTTCTGTCCGATGTGGTCAGCCGCGGC
AACCTCAGCGGCTCCGCCACCGTCGACCTCCTCGACTGGGCCATCTGCAGCGCCAAGCTC
CGTCCTTCCGTGCAGACCTGCAACATCGTCGTCAGGGCTCTGGGCAGGAGGAAGTTCTTC
ACCTCCGTCGAGCCTGCCCTGGAGGTAATGCGGAAAAATGGCGTCTTTCCGGACCTAACC
ACGCTGCAGATCATCATGGATACTCTTGTTGCCGCCAGGCAGGTCAACAAGGCCGTCCAA
ATGCTCGAGAGCGACCAATTTGGGATAGGAATCGAGAAAACTTGCCACAGAAAGGAGGCT
TTCTCTGCTCTCATCGAATGCCTCTGCCGGAGGTCACACGTCGGTGTAGCCAGCTCACTC
GTACAAGCCGCCCGTGGACAACCATTCCATCTTGATAAGCAAGTGTACAATGACGTGCTT
GGCGGTTGGGCGAGGTTTGGGAGGGTTGATAAGTTGCAGCATTTCTGGGCAATGATGCTG
GAGGATGGGCTAGTGCCAGATGATGTTTCGCATTGCCATCTTATCGAGGCATTGGGGAGG
GCAGGACAGGCCGAGGAGGCACTCAGGGTGTTTGAGAAAATGGTGCAAGAGGGATACGGT
CCAACTACAATGGCCTACAATGCACTTGTTTTCAATTTTATCTCAGTAGGGGATTTGGAC
AGGTCCATCAAGTATTACAAGGATATGGTGGACAATAATTGTCCTCCAAACAGTGACACA
TACTGCAAGATGATTAGAGCCCTTTTGAAAACACGCAGGGTGGCTGATGCACTTCAAATG
TTTGATGACATGCTGGCTCAAGGAGTTCTGCCAGATACAGGCATAATTACATCATTCATC
GAGCCACTTTGTACGTTTGGCCCCCCTCATGCTGCCTTGATGATCTACCAAAAGAGTAGG
AAGGCTGGTTGTACGATATCGCTGAAAACATACAAGCTTCTGCTTGAAAGGCTTGCCAGG
TTTGGGAAAAGTGGGACAGTGTTGAACATTTGGGAGGAGATGCAAGAGAGCGGGTATCCG
TCCGATAAAGAAATATACGAGTTTATTGTAAATGGGCTTTGCAATGTGGGCAAGGTTGAT
GCTGCTGTTTTTGTGGTGGAGGAATCACTTAGGAAAGGCTTCTGTCTAGGGAGAGTTGTT
TATAGCAAACTGAATGACAGGCTGCTGGAGATGGACAAAGTGGAGACTGCTTACAATTTG
TCAAAGAAAATCAAACATGGACGCACACTTGCTAATTCACGCAACTATTGTCGTGCTAAT
GGTTGGCACTTGTGATTTGtgaacagacttggttgctacgcaactatttgttatgctgat
caaaacagttccgtatgtgtttaaaagtagcctcacttgcattctgcgaaacagttggca
aaggtaaaacgcaagtttggctggtgaaaggtataagagtatgtacttattcttgagtct
tgagtgtccatgtttcttacgtgtttggctatttcatgcataccatgttatcgtttatat
tttgtacttttttagttttggtggggttattctgactaaatcttgtctgatgagtagtgg
attaagtagcagaaagctacatcacacaacgagacaaattaatcaaatcggtggaataga
atggatagaaatgtaccgttttcgtgtgtccttctgctgctctagagaactacaaacatc
agatgggatctgaagtttcagaacttgggttcctcaggggaatgcagagaaactataaaa
ataaatctgttggatctcaaatatcagaacttgggtccctctgggagttgtagagaaagt
agtctgatgtatccttgaatataactggacttacaagttatagaaaaacagcattacttg
aaagttgaaccggtactccagtaggcctgcctttaactgaacttgttatatatggcaaat
caaacttcacatctccagaattcagttgtgccagttatcctgttgctgactgcttttgtt
tgactgttgtgaattttatagtttttattcaatcataatttaGTTTGTCACTAGCAAATT
TCCCTTAGTGTTGTTCTCATTGTATATATGGCTTTGGTGTTACACTTTGTTCTGCACAGT
GTAAGATTTTCAGTTCATTTTTGCAGGTTCTGTAGCTACCTATGCCTTTTGTCTCCACAC
AACGTAAGCTGCTCATTTTCATGAAGATGCTACCATGGATTTAGGGGATAACTCCCTAAG
ACTGTTGCTATCAGGTCTGTGGATTGATATATCACATGAGATCAAAGAAGGGAACTGGTT
GACCAATTACATGAGAATAAAATGAAAAGGCAGGACATCTGGTTCCAGAAATGATAAAAT
CCGTGGGGCTTGCAACCATGTAATGAAATCCCATACCATAAATCCTCTGTGTTTCAATGT
GATTTCTAGCAAAGAGTGGagaggatgaactgcatatattctgtgtagcagcaatctcga
taatcaattgacacaagataactacagaggttcactcaatgctcaatagatgatgcaatc
aatgtatgttcagtcattagtttcttccatgttatctaaagcctcgggtatatgaaatga
aaactacttcctccattcctaaatatatgtcttttcagagattccactatgaactatata
cagatgtatatagacatactttagagtgtaggttcactcattttgctccctatatagtcc
gtagtagaatctctaaaaagacttatatttaggaacggagggagtagttattattactcg
taggtctgtgtattttctgttagttaaaatctaaagttttgcagctatgacaggtactaa
ataagctatggtcaaccagtatgattcagttgaccatgtctgttatcttttgataatatt
tgacaggttatgggttataaatgcatattcagttttgatatctattagcatttgcaagtt
agtgccctgctagctaaattctggttagtaattgtctgtgtccgccttccgctgaaattt
gattgtgtttggttggacttagacaggtttagttgtactgcaactgtattgcatatttga
tatatttatccttttccgaagttgagttggtaagttttcgttaagatgttcaatgatatg
ctggtaaaaattgatgccggaagatgtgtatggctgtcagaaagaagtccatagtggaat
ttttagatttggggttttcaaatttgaaccaaaatctaacccatacctttagactttttt
ggaattttcggaacattttgtctgtgtgttccctttcactctttgggaacttctgacttc
agaatgaacctttccccctttccccttttttatgatgtatttgtgctgcttaattcctgt
atgtatgcatgtttgtcctatCAGGATTCTCTGTTTCTATAAACTAGTAGTTTCAGTTTG
ATCTGAATCTGGGtaaattatatatattgacaatttgacatgttccactttctgatctgc
aaaaggtctgcaacttatcacatgggaccatctgatatttggatccatccatcagaggta
tgcttcagttagtttccgcagttcgaggttttcctccatggatagtatggaagtttagcc
tttgacttatgtgtctgggtgtgtgccatatagctgcatgcttgacaatggatacatgtg
ttagtgtggatattggccacattagaacggctcttgaggccccatttaatttttgttcat
gtatctatgctcagatttggttagtgtctcatctttggtatcaacttggaaggcaaatta
ttcatggatatgattcagcatttaacaatagtttcttgacatctttatcaaagactatac
tatgtttgtaaaatgaactattggataattggatttcttgaatgcttcttttaccaatat
tgggcttttattctttgcttggatatctttgagtatctagtgttgttagtaaggcggcga
cgtcttggtgagcattgcttacttctgacacctcttgtatgagacagaacttgccctgtt
atcccttccatgagcagattagcaaccctctgagctcttgtttatcattgatctagttat
cctgttattccttccattttgtcgtgatgtagttcctgtccatgttaagatggccgtaat
ttttgccaacagtggatatgcagttatgcacatgtctcctttttatagcagtacagattg
tgaggtagaaacaccatctttttgctgtttctttaccttctttaatgttttcatgtgcta
cttatttcttgatgcttgtgGGAGTGATTGAAGAACAAGCAAGTTGTTTATTTCCTGGAA
GTCCTTTCAACTATTGTGTATATTCATATCCGAAAAATGAGGTTCTTTTCCAATTCATAT
ACAGGAGGAAGGCACATTACAAAGATTTGGCTCCTTTCAGTTCTTTTACTTGTCCCAGTT
TTGTTGGGATGCTACTGATTTGATACAAGAGCTAAGACCAGTCTACGATACACAAACTTG
AAGTGTTCAGCAAATAATTTCTGCTGACTTGTTCAGGTCTAGCTTCACTGATCAATCAAC
GATATTACAGGAAGAAGAGAGGTAGCTAATTGGGCTGGGATTACAAGGCAGTCAGAAGGG
GGACCGAGGGAAGGAGCCGGAGGTAGGAGAAGACATAAGCCACCGTGCCGATAGCCGTAA
TCCTAAGCGGATGCCTCGTCCGTCGCCTCGGCCCTCTCATACTTGTAATTGCCGCAGCAA
CGAGCTGGATGGGCCTAGCCCATCACTACCAGCCCATGATAGAAAGGGGGCTGACATGTT
TTGAGAGACATTGTTGTCCTCGAGATATTTATGCCGAGCCAGTTTATTTAGATTAAGCTA
TCATGTTACCTGGTGCATTTTGATCATTTTTTGTTTCAGAGACCTGTGAGGAAATTTTGC
CGAAAATAATCTCCATGTACTGTCAAAGCAATGCCCTGTGAAGTATTTTTGGTTGAGAAG
TTCTATTTCTACCAAATTATGTAAACTatgcttggcaatgtcagacaatttattttgatc
aagctattctgagatgcctttttgatttttggttatgtcagatgtgagggaatgttacca
taaagtttctggccttgatggatatgtccagcaagttctttgtcttgtatgtagataccg
tggagcatgtaccttctctgtgttcttgttgcccatgtagagcaggttcccaaacaacaa
ttaatatacaggcaagttatgttgaaaaatcgtgacatcatttgagtaaaacagaaaact
aagttacgtcctgaatcctctgctgattattccaagctgccagcaaaaaaatgtcctctg
cagaaaaatcctctgcagcttattccaaccctgaaatttacatacacagcaaaactaacc
ttttgtagagctcaccatgcacagggggttgatgcttacagttacaggcatgtgagcaca
aatttcttgtttgcgcaaaaggtagcacatcatatataactgtaactgtaaaaagagcaa
ataatctgaagactggctaaaaggttgacataacaatagaatctcctcctttttttcaag
ggaaagctatattgattctcaaatatacagtttcattacatcatctacttagatgagaaa
caataaagtccggatgatctcctgtcctacaactacaagcctgggatgggatccctcaga
cattggcagctaacaaatgggctacaatatcactcactccctttagcttatgagacagcg
ccctttgcttctgcagtcgctgccgatcgagttaactttcgacgacggcgggcatgctcc
tgacgtcgtccatggcgacgcgcaccgttcggagggggtcgtcgcgggggaagttgccgt
cgtagatcacttcgacgtagccatcgtcgtctgctgcgtcggagacgacgcgggcgccga
gccagagcacgaggcagtgccccgtcggcaggatcccggcgcgcgtgcgcaccttcaccg
ccatccccttcttcacccagatcgacgaagggcgcggccgggtcgctatggttggcatgg
tcttgatgcactctgctccggtggtggtgtcagctccgcttgaagccggcg
  Untranslated Region
  Coding Sequence
  snoRNA
1105..2882, 3626..4022, 4985..5036, 5884..6610
1107..2774
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved