Hordeum_vulgare Locus HORVU5Hr1G101650
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU5Hr1G101650
Hordeum_vulgare
HORVU5Hr1G101650
chr5H
SNOR75, SNOR75, snoZ105
1278..1366, 1471..1558, 1619..1686
3295
GTTTATGCTTAAAGCAAGCATGTACCTCCTGTCTAAAAGTCAGTAATGAAAAGATTCTC
TCAAGAGTTCGTCGCAAGGTCTCAGATGTTATGAATGAGATGTTCATGGCTCCATACCTT
ATCGACCCTGCGAATAGGCAATGAGATGAAGAGCTTCTTCAATACATCATGTCTCCTCCG
GGTGTTTATTGAATCCTTCAAATACCCTCGAATGTAATCGGGTTTTAACAATTTCACCAC
ATAACATGGTTTGAAGACCGGGTGTTTCTCAATCTAATCATAAGATGGATGGACTTGGGA
AGTTAAATAAAACTATGCTCCTTTCATCAATCATATCCGCATAATGACTACCATAAGCGC
TCTTGGAACCAATATTGACCGCATAGACGAACGCGTTGCTGCGGCCTGATGCAGTTGCTA
CTTGTTTCTTTGCAGTGTGCTAAAAAAGAAAAAATGTTCACCATCGAGTAATCTTAAAAG
CTGTGAGCTACAAGATGTTCAACTATATAGCTCATCTAGTTTTTTTTTCCATAAATACAG
TATATGGGTTGAAAATTCCTTCCTGGTTTTAAAGCAAGGCTTGGCTATGACCGTACGATT
AGTTTCGCACTCATGATCTAACAAGTTCACGACGTATCGATCCCAAAAAAAAAGCTCACA
ATGTACCACGCTCAGCTATGACTGACTTGTGCTGCACGAACGGTCGAACTTTTGAGCAGA
ACCGATCGAGTTTCTTTTCTCTCTCTCTACTTTATTTGAGAAGAAATTTCTCTCTCTACT
TGTTTTTGAGGGGTTCTCTCTCTATTTTTTTTTGAGGAAAGTTCTCTCTCTATATATACT
AGGAAATCAAATCAAGTACAGTCAAATGGGACTGTGGGCCTAATCGTTATTAGGAGGCCC
AACAAGCCCAGACAACAAGAGAGTACTAATCGGATCTGAACACCGTTCACTGGCTGATCC
GAGCCGTCCACCCGTCCAACCCATCTAGGGTTCCCCCCCCCCCCCATTCTAGCCAGTATA
AGTACGAGGTGAGAGCCCCCGCCGCCAACAATCCACGGAGATCGGGTTCGTCCACACATT
TCCGCCGCCGCCGCCGCCGCCGCGAACCGGAGAGCGAGGCCGACACCGCCGCCGCGATGA
GGGCCAAGGTTCGTACTGCCCTTCGTCTACCTCGCCTGTTGTTTGCTGCTTCGCGACCGC
GGTAGATCTGGACATGTGCTAGTGTTTACCGGGCGTTCGTTCCTGCTGTTGCTGTTGCTC
GCTTGCGTAATTATTGGTTCTCTGTGATGATCAACACTGATTAGATGTCCGATCCAATCC
ATTCCATTCAACCGTGGGGACAATATGAGGCATTTGTCTGAGAGAACCGCTGCTACTTCG
ACCAGATCTGCTTCTCTATGAGATTTAATTACGGCCTGTAGTTGTTTTAGCCGGATTTAT
GTTTTTTTTGCGGTTCTCGTTTGTTTATAGTTCTCTGTGATGATGAAAACAGATGACGAG
TCCGATGTAATCCATTCAGTTACACCATGTGGACAATCGAGGCATTTGTCTGAGAGAACA
TTGATTGCTTAGCCATTTCCGTTGCCCATTTCTTTCCATTTTTTTGTATGATTGCGTCGG
TGGCATGATGAGGAAGACAATTCTTGTCCGATCTATTTGATGATAAAATCCTCCTACTCA
TTCTGAATGTCAAACCGACTGCAGATCTGCTTTGCTTTGTTCAACGAGTTTGTAGACAGT
ACACCCTTCTTAGATAGTTCTTCTTTTTGCCATGCTAAATTGTCAGTTTGGAAGATGATG
AAGAAGAATTGGTCCGTGTTTCTGAAAATCACGTGATGATATCCAATGAAACACTCAATA
TTCTGATTCCAAAACTAATTTTACGATTTTTTATTTTAAACGTGAAATTCTTGTGATGTC
CATGAGCAGTTCCTAGATCCTCTGTTCAATTTATGCTGATGAGCCGCATGGTTGCCTATA
ATTCGCAGTGGAAGAAGAAGAGGATGAGGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGC
AGCGATCCAAGTAGGCGCCTTGGAGGATGGAGGCGTAGCATCATCTTACATCCAGGCATC
GAAACACCGAGGGATGATGGCATAGGCTTGTGATTCCTGATGTGTTCTGCCGCTGTGGTT
GTGGAAGTCGTTTTACCTTTGTCTTGTCAAATTTAGCTGTTTAATACTTGTCTGGTTATG
TTCCAGGACTGAGTTTTATGTAATGTGAGGATTATATGTGTTTATGACTGAATTTTATGC
ACCTATTATCTTTAAGCTACTCTGAATAGTTACTTTTGACCTTGCATTTGTTCTGTCTGC
ATCTTTTTGCGTTGCGAAATGCCGTACCTCATTGTTAGCTGCCAGTGAATGGTTCATCAA
ATGAACTTCCGAATGTGTTTGTTTTTTGGGCAAGCACCATGTGGTAATTTGAACTGAGAC
ATAAACATCATGGCTGCAATTGGAAGTTTAGACTCGTTTGGTTTATGCATGCTGTAATTA
TGTACTAATTCCGGACGGAGAATATGGTACTTCGTAGGCACAGAGAAGTCTGATTATATT
TCTGTAGTTACTGTCATTTTCAACCTCTGTGTTCAGCCTGTTCTATTTCACTGATGATAG
TCCGATTTCATCCATTCTATTACACCCATGTGAACGATCGAAGAATTTAGAACATGCTTA
GTCTTTCAACTTTGCTATTCCATTTTAGGTTTAATGACTCTAATTCTTGATTGTCTAATG
CGTATGTAAGTACCCCCTTTTGTTGCAAGATTTATCACATTGTTACAATCTTGTCACTTT
ATTCCCACTTTTTTGTGCATGGAATTTGGAGTAATCCGTTTGCCTCCTGTTAAATAAAGG
AGGAGAAGTGGGCGAAAAGCACACGGCTGTTCGTGTCAAATAATTATACCACTAGATTAT
TAACGCCTTTGCCGAACTTTGGCACTCTATTCCTCTTCAGATACTTGTAACGTGAATGAA
TTTATGTCCCCGCGCCGCAGGTATTAATTTGCATGTAGATGAATGGTTTAGTAGTAAGAA
GAAGTTACTGATTAACTTTATCTCTGCTTCCTCTGCTGCTGCCCTGTTGCTGTGGGAGAT
GCGTAGTGCAGCTAGTGACGTTGGCTTTGGCATTGGCAAAATGTCTGGCCACGTAAGGAA
AGCCTTTAGGCATGGCGAGGCCAGTTTTGCTGAATTTTTGTCTAAAAGGACCCCTTGCCG
AGTGCATTTGTCGGAAACGACCACCTGTAGACGAAAGTGGCAGAAAAGACCCCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1147, 1988..2248
1001..1147, 1988..2053
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved