Hordeum_vulgare Locus HORVU5Hr1G101500
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU5Hr1G101500
Hordeum_vulgare
HORVU5Hr1G101500
chr5H
SNOR75, SNOR75, SNOR75, SNOR75, snoZ105, snoZ105
1377..1464, 1567..1655, 1773..1860, 2150..2237, 2291..2358, 2635..2702
4211
AAGTAATGAGTAGCCATAGTAACAATAGGTGCAACAAGGTAGCCGAATCCTTTTGTGGC
AAACAACATACCGGAACAGTTTCTTATAATAGGCAAAGCGTTCTTTCGGGCACACGAGAA
TTTCATATAGTACTTTGATATTTTGATATGTGGGTGGACCGGTACTTTGGTGCTGTTCTT
ACTTGAACAAGTCTTCTACTTATGATTAACCCTCCCGCAAGAATCCATAACTACGAGAAA
AGTATTAAGAGTAAATTCTAACCATAGCATTAAACGTAAGGATCTAAATCAGGCCCTTAC
GGAATAGCGCATAAATCAGGGTTTAAGTTTGTGTCACTCTAGCAACCCACTATCTAATTA
CTACGCCACAATGCATTCAGGGCAACACTGTATAAGAACACTTGCAATTAGCATAAGGGT
CTTACTTGTAATTAGTATAATAATTTTTTTCCTTTGGAGAAGTTCAGGATCGCACGAGCT
AATCATGGCAACAGGGTTGGCGTCTCTTTGGAGGTAATAAAGAAAAATAAATAAAAAATC
AAAGCCCGGAAGAACAATTATGTATTTAACTCTTTTAAGAAGCACATAATGCATTTTTTT
GTCTTTTTTTGAGTAAACACAACATGTGCATCTCGCATGGAGCACAAGCTATGTTTTCCC
CCCTTTTTAAGGAAGCACATCTCTATTTTAAGAAATACGTCTATGCATCTCGCGAAAGCA
AGGCGGTACCTTTTGCGGTTGTGTTTATTTTTCAAGAAGCACAACTATACTTCTTGTAGA
AGCACACGAAAATGACTTGCTTCCAAAAGATATTCTACCATATAAAATCCAAAAACACGT
ATAGAAATAATAATGAAATGTTCTAAAAATGCGGACAACCTTGACACATGGTGGCGGCTG
GACGCAACACTAGATACACTCAGCAGACAAAAGAAAGAAGATATATATTGCGGGAGACCT
CAAGGAAAGGTGCTCTCAAAAACCTTTTTTTTTTAAGGATACACCATTGATGTACCAAGT
TTTATAGAAGACAAAAAATATGTACAAGAGCTATCGAAAATTCTCATCGCCATCATCTGT
GTCAAATACATATGGGCCAAAGAGTTAAGGCCCAACTCATCACATCTCGATCTGAGCCGT
CCATCCCTCCTGGGTTAGGGTTCCTTTCCGAGCTCTATAAGTACCACGCGAGAGCAGTCC
CCTTTTACCTCCGCCGCCGCAGCAAGCAGATACCGAGACCCAGTCCGCCTGCCGCGCCGC
CGCCTCCGCGATGAGGGCCAAGGTTCGTTCCCGATTCCCCTCTACCTTCTCATCCGACTG
CTCGATGCGATCTAGTGGTTCTCGCTCGGTAGTGGTAGTTGCTTGCTTGTTTGCGGTTCT
CTGTGATGATGAAAACAGATGACGAGTCCGATGCAATCCATTCTACAAAACCGTGTGGAC
AATCGAGGCATTTGTCTGAGAGAACGTTCGATTTTGTAGATGCAGCCTTGTAGATGTATA
GGCATGTGTTCGATTGAGTCTAGATGTGATTTGTATTGGTTAGATTTGTTTTGTTTTTGT
TTTTGGTTCTCTGTGATGATCAACACTGATTAGATGTCCGATCCAATCCATTCCATTCAA
CCGTGGGGACAACACGAGGCATTTGTCTGAGAGAACTCTGATTTTGTTCAAACATTTGAT
TTGCGATTGCGGTGCGACTCTCTTGATAAGGTTAGATTTGCTTGTCCGCCTGTCTCACTC
AAGTCAAATCGTTGATGTTTCTGGGGTTATTTTTCTCTATGATGATGAAAACAGATGACG
AGTCTGATGCAATCCATTCTATTAAACCGTGTGGACAATCGAGGCATTTGTCTGAGAGAA
AGCTATTCAATGCCCATCCGCCTTTGTCTTATTTGTTCTAGTCATAATGTGTGTAGGTTT
CTCGTTCTAAGATTGGATTAGCTTGGCTGCTTGTGTTAGTTATATGTACTCCCTCCGTTC
CTAAATACAAGTCTTTGAAGAGATTTCACTACAAGTCTACATACGGATGTATATAGACAT
ATTTTAGAATGTACATTCATTCATTTTACTTCGTATGTAGTCACTCAGTGAAATCTTTAA
AAAGACTTATATTTAGGAACGGAGGGAGTAGTTGATATTGGTGTGTTCGTTCTCTGTGAT
GATGAAAACAGATGACGAGTCTGATGTAATCCATTCTATTACACCATGTGGACAATCGAG
GCATTTGTCTGAGAGAACATTGATTGCTTAGCCATTTCCTTTTTTCAACTGTTTTTTGTA
TAATTGCGTCGTTGGCATGATGAGGAAGACAATTGTTGTCTGATCTATTTGATGATAAAA
TCCTCCTACTCATTCTGAATGTCAAACAGACTGCAAATCTGCTGTGTTTAACTAGTTGTA
GATATCATAGTTGTTTTATATATGCCTTTGAAATTGACTTCAGTTTGGGAAATGACGAAG
AACAATTGGTCCGTGTTTCTGAAAATCACATGATGATATCCAATGAAACACTCAAATCTT
CTGATTCTAAATCACATAGTACTATCATTCCAAATTTTATAATGGACTTGTTATTATTAT
CCTATGCATATTCTTGAGTGTTCATTTTTCCACCGTTTTTTGTGTAATTGCGTTGCTGGC
ATGATGAGGAAGACAATTTTAGTCTTATCTATTTGATGATAAAATCCTCCTACTCATTCT
GAATGTCAAGCTGACTGCAGATCTCTAGTTTGCTCAACTAGTTCTTCAGATATCTTAGCA
TAGTTGTTTCCTATTTGCCTTTGAATTGACTTTAGGTTGGGAAAATGATGAAGAACAATT
GGTCCGTGTTTCTGAAAATCATGTGATGATATCCAATGAAACACTCAATCTTCTGATTCC
AAATCAAATACTACCATATCTGAGTTATTATATTGGATTTGTTATTGTGTTCCTATGCAT
CTCCTAGAGTACTAGCACTATGCAATTTGTATTAATGAACTGTGGTTTTTGTAATTTGCA
GTGGAAGAAGAAGAGGATGAGGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGCAGCGTTC
CAAGTAGGCGAACAAAGAGGAGATAACCTTGTATCAATGCACCAGTCTGTTGGGTCGTTT
GGTTCCTGATATGTCTTGTTGTTTTGATATTGGGGATGCCAACCCTTGTAACAAGATGAT
TATATGCTTATCTTCAAAGCTGGATATTCGGCTTAAGAAATATTATCGGCTATTTTTGAT
TTGTTGCCCTGTCTGTTTCTTATTTTCTTGCATGCATCTGAATGTTTTTGTCTTAGTCGA
ATGGTATTTCAGTTTTTTTTTTCATTTGTTTCTCATAAGCATATGTACAACTGGAATTGC
TCGGTTCCTGGCGCAAATGTCTCTTGGAAAGAGAGGAACAACCGATGCGGTAATTGGTAT
GGGGATCTGAGCTGCGACGCTTTTTGAGAGAATACAGGATTATCTGCAACTGCCACCATC
AGTTCATAGTGATTTTTGGGGCAACACTCTCTCATTGTTTGGCTGCCTTTCTCCATGTGT
AAACTTCCATGATTTCCTGAGCGAATCAATATTTGTGGGGTGAGTATAGACGCAATGTAG
CCTTGCACGGTGTCGCCCTACTGCCCTTTGCGAGCCATTGCCATCAAACAAGTATAGCTG
GCGTGGCAGTACGACGAGGAGACAGACCGCCTTTACTGGCGTGTAAGTAGTGAAGGGCTT
ACACAGACCTCGTTCTACCCTTCCAAAAATTAAACCACAAACCTTCCAATACTCGCGTGT
GCCCTACTGCCCTTCGCGAGCCATTGCCATCAAACAAGTATAGCTTACTGGCGTGTAAGT
AGTGAAGGGCTTACACAGACCTCGTTCTACCCTTCCAAAAATTAAACCACAAACCTTCCA
ATACTCGCGTGTGAGGAGACGCTCCCCTCTCCTTGCGAAATTTCTCCGCCAACAATGACG
GCGCCGCCTCCTCCGCGTAAAGGGTTTAGGGTTTAGGTCTGTCTCCTCGTCGTACTGCCA
CGCCAGCTGGGTGCCGTCGGGATCATCTGTCTCTGGATACCTGTACCTGCTGGGAGTTTC
GGAGGAATCCGTGAGCCACGGGGACTCGGCAATCTAAGACCTTGGTGCCAGAACTACTCA
TGTTATTGGGTAAGGTAAGGGTGAAGTGTATCAGGCTGCTGCAACCTATGATTGAATAAG
TGGCTAACTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1281, 3001..3211
1091..1273
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved