Hordeum_vulgare Locus HORVU5Hr1G004370
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU5Hr1G004370
Hordeum_vulgare
HORVU5Hr1G004370
chr5H
snoZ101, snoZ101, snoZ102_R77, snoZ101, snoZ102_R77, snoZ102_R77, snoZ101, snoR8a, snoR8a, snosnR60_Z15, snoZ43, snoU31b, snoR77Y, SNORD14
14031..14129, 14350..14447, 14489..14575, 14677..14775, 14847..14934, 15036..15120, 15234..15331, 15467..15553, 15756..15842, 16266..16360, 16463..16559, 16868..16953, 17544..17627, 17781..17902
187903
TTCACCACGGCCTCTAGGAGGGGCGCTGTCGGCCGTGTGGCGGCTGACTTGAGCATCTC
CTCAATGATGTCCATCCATGACTCCTTTATGAGCTCCCTGAGCTTTCTGTATGCATCTTC
CTTTGCAGTGTAGTTGTTCTCCTCCATGCACGCTTCCACCGTTGATATCACGGGCCTCTC
ACCAGAGCTCTGTTCTTGTTCTCGCTGATTCACGAGAGAGGAAAAATTGTCATATTAACA
AAGTGATATTACCTTCTATTAATATGGCTACATACATCAATGCATCAATTGATGCAGAGA
CCAGTTATCCTTCTCTAGTTAAATAACTTTTCTATTAGTTAACCAATATTTTATGGTATG
TAGTTTGTATGACCAGTTAACTATTATCCCGCCTCCAAAATAGATGGTGTTCTAGAAAAT
ATTTTTTCAAATATCTATAAGGGAATTGGCTGTATATACGAAATTATTCGAGCTTTTTCA
ACTACAATAATATCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCT
CATCAAGTCTAGAGTACCTGCACAAACACAAAAGAGCTTGCACCCAACTCTATAAAGGGG
TTTTCAATCCCTTCAAGATTGATTGCAAAGTGAGATCTGAAGGCGGAAAGTGCAACGAAG
TAAAAAGAGTAAGGCTGAAAATATGGTGTGGATTAGACCCCGGGGCCATAGTGTTCACTA
GAGGCTTCTCTCAGAATAGCAAATATCACGAGTACAAGGAATGAGGCCATTTTGGAGCTT
GCAAAGCTGGATTTCAGTATTCTGCAAGCTCTGTACTGTCAGGAGCTGAGGGCTCTTACT
TTGTAAGTGACTCTCTATGATGAAATCTGCTATTATGTCGGTATAATTTCACCTACTTTC
CCTTGGTGGAATTTATATTTCATCACTAAACTCTAAGTCCAGACACAACGCGGTGCCTCT
TAACTCTTGACATGCGTTTCATATATACCATCTATCGTACCATTACAATCTGAGCTCATG
GTTTATTTGCAGGTGGTGGAAAGAACTTCAACTCCAAGACCATTTGAGCTTCGCACGAGA
CCGGATGGTGGAGATGCACTTTTGGATGCTAGGAGTTCTATTTGAGCCACAATATTCATA
CGGACGAATCGTGCTCACTAAGTTCTTTACATTTATATCGATCTTTGATGACATTTACGA
CAGTTACAGCACCTTAGAAGAAAGCAAACTCCTCACCATGGCAATGGAAAGGTCTCTATA
TAGAAGTGTGGGATAGGGTGGTTTTAATAACCAATTAATGTGTTGCTTGATACTAATTCT
GGAACAACTAACCATTCTTGTTAGGTGGGATGAACAAGCTGCTGAACAGCTCCCAGGTTA
CATGAAGTTCTTCTACAACAAAGTACTTGCTACCATGAAGGTTATTGAAAAAGACTTGGA
TAGTCAAGGAAACAAGCATGCAAACTATGTAAAAAAGCTAGTAAGTCGATGTCTCATGAA
CATGTTCAATTAAACAAAAATATATCGTTAAATACTTGCATAAGATCATTATGTATGGAA
CGCAACTAGCACTATGGTACGGATCCCCTGAATCGCATTTAGCAATTGATGCAGGGCCAT
TTGCATGGGTGTACAAGTAGATAAAAGTGATGAAATCATCATGGCTCTGCATAAATTTGA
AGTATAAAATATTTTAACCCATCAACAGTGTAGTCGATGTATGGTGCATGGGTGTACAAG
TAGATAAAAGTGATGAAATAATCGAGGCTCTGCAGAAATTTGAAGTTTAAAATATTTTAA
CTCATAAACAGTGTAGTCGTTGCATGGTTCATCTTAATTGTTGAATTCGTTTCAAAAAAC
CTACAAAACTAATATTACAATATTGGTTGATAGAAGTTATCACCTAGCTTATGTTTTCTT
TATGTTCGCTCGTAAGACAAATCTGCTACATGAAAGAAATATGTGTATGGATATCGACAA
TTAATTTTCCCAGGAAAAATAAATATACCATTGTACTTGTGCAGCTAATCGATGCTACGA
AATGCTACTACAACGAGGCAAAATGGCGTGAGGACAGCGAAACATCAGTTACTGTTGAGG
ATCACCTGCGATTCTCGGTGCCTAGCTCTTGTTGCATGCATATTGTATGCCTTGCCCTCG
TTGTCATAGGGGCAAGCGTTGATGCCATCGAATGGACCATGACCTATCCCAAAATCATGC
GAGCTTCTTGCATCATTGGCCGTGTCATCAACGATGTGGCTTCACACGAGGTTATATACT
TAAAACTGAAAATATATGCCATGTTTGATTTTATTTGCAGTTTTCTTGGGTCATCGGTCG
TGTCATCAACGATGTGGCTTCACACGAGGTTACATACTTACAACTGAAAATATATGTCAT
GTTCGATTTTCTTTGCAGTTTTTGGTTCATGGATAAGTTTGGGATCCATTTAGTTTGTAG
CTTGTCTCTTATATTTGGTGATGAATATTATGCAAAAACATAATAAATCCTCGTTATGTG
CAACAGGATATCTATGCCAATTAAAAGACAGTTAAGTACATTGATGTAATCCCACCATTC
TGAAATAGTATCTAAGACTCTAAACACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTGCGGAAGAGATGGCTGACAGGGCTTCGATTGGAATTTTGTTCTGCAGGG
GCTGCGGCTGTACGATGTAGCAAATCCATTCTCCGTCTGGAGGCGAATTCGGAGGCAGCA
CTTCTGGACTGCTGCTTCAAGGACGAGTCTGTGGCATTTGCCGGCGGTTCGGATGGATGT
GTAATAAGGTATCAACAAATTAGTTGCAACACTCCACCAAGTCCATGTGCTTCGTCATCA
CAGAAACATAATGCTTGTAGCGTTTTCTTTTCCAAATGCAGGGGCACCATCCTCTATTCT
GACTAGAGCTCCCTTCGAGGCTCCATGTTAACTCTAAGAGACAGAAGTAGAAATAAAATC
TGATCCATCCAACTAGAAGATCTAATTGTATTGACGTGTTACACTTCATAAAGCCTGGTA
GAATTCGTTCAGAGTATGGCAGTAGGAATTGTCTTATTTACCTTTGTAATTATTTAAGGT
AAACTATGAAGTTAGAATAATTTCAGTTACATATCTATGTACTTTATTTCGACAGAAAAA
TTTAAGTATACAATGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
TCGAAGATTCTACGCGATCCTACCNGTACAATACTTTTAGACATTTCCGTGTAAAATTTC
ATGAACAAATATGTTTTGTGAGCTACACAAAATCAAAATGGACGAGTTTTTGTAGTGAGC
GTCCATGTGCTTAAAATATATGTTTTTTGGTACAACTCACACCAAAAAAAATTCATCGTG
AAATTATGTCGAGAGGTAGTGTACATATGTAAAAAATTAACATGGTAAAATTATATAGGA
TAAGCTCATAAACAGAAGTAGAATTCAGCATAAACCATAGGTCTCCGACATATATGTTCA
TTAAAGGGCATAGTCACAAATATGCTGGTTCAGCCTGAGCGGACAATAGTAAATAGTTCA
CTAAGTTTTTTGTAGAATTGATTCACAGTTGTCTGGGTTTTACTCTAGTTTGCCAGCTGA
TCTCCAACATGATCTTGGTCATTCTCTTCTATGGCATTTACTTCATGAGTATCAGTTGCT
ATCTGTTCTAACTTCCTCTTCTTTGCATCACTCTGTTCTTCCTGACATTGTAACAGCTTC
AGGAACATTGCTCGGACATCATCGGGTACTTTCGACAGATTGCCCTAAAATAAATAAAAA
CGAAAAAATAAGAGTAGTGTTAATTAGGAAGTAAAGCACATAAGTAAGATAGCAGTCTAA
TTACTAGACTTTCTAGCCGATCATTAACAACAAGTCTAGCAATTAGTGACCAGCTAGATA
TTCTATTAATCGGCTTGTAGTGATCGGCTAGAAATTATAGTACAGACAATGGATGGATCG
GATAGAATACAGTACAGAGACAATGGATGGATCGGATAGAATACTAGAANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAACTGGTTTGTTTTTTACAGATTCTGTTT
TCGTTGAGTTGGTTGCTTGTTTGATGAAACTATGGTTAGTACCGGGGGTACTAGCCATGG
AAAAGTGAGAATACAGTAGCCCAACACCACAYATAGATAGAATTCAAGTTTGCTACAGTA
CCAAAAGAGGTGGTAGTTTGTTTTCTTGTGCTAATGTTATCACGAGTTTCTGTTTAAGTT
TTGTGTTGTGAAGTTTTCAAGTTTTGGGTGATGTTCTCATGGACAAAGAGATAAGGAGTG
GAAAGAGCTCAAGCTTGGGGATGCCCAAGGCATCCCAAGCCAAATTCAAGGACAACAAAA
ATCCCAAGCTTGGGGATGCCCCGGGAAGGCATCCCCTCTTTCCACTACAAGGAATATGCT
AATACACGACGCTATATTTTCGTCGCTACATCGTCACGGTTTTTAGTTTACGACGATCTC
ACGACGAAAAACCAAGCGTCGAAAACGGAGCGTTAGAAATGAACAGCAACGATGTTTTGA
TCAAAATCGTCGTAACTTTTACGACGATTCATGGATCGTCGTAACCTCTACGACGATCCT
AAATCGTCGTTGACAATCTAACCCAGTCCTACATGGCAGTCCTACGTGGCAAAATTACGA
CGAAATCAAAACATCATAGTTGAAATCAGCCCAACCCATTTCAATTGATCATATGGGCTG
GTTTTATTTTTGGGTCTTTTTCTTATTTGGGCTTCGTTTCGGCCTTAGGAAGGCATATGG
TAGGTTTGTGCACCGGTGAGAATTGCGCAGCACTAAGAGGCTAGCAAAGGTGGAAGGGGA
AAGTGGCATCTATACCATGGACTCACATTAGTCATGAAGAACTCACATAGTTGTTGCTTA
AAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTCGCAAGTCCCA
GTGGTCTGCGAATATGAAGATGTGTTTCCAGAAGAGCTGACAGGAATGCCTCCGCACCGA
GAAATTGAATTGTTATTGAGCTTGAACCAGGTACTAAGGCTGTGTGCAAACGTCTAGGAG
CTGAAGGAACTTAAGAAGGCAACTCGATGAGCAAGAGCGTTTGGGTCTGATCAGACCGAG
CTCGTCTCCTTGGGGCTGTGGAGTTATGTTTGTCAAGAAGAAGGATGGCACGGACCGATT
GTGTGTCGATTACCGTCCATTGAACAAGAAGACAATCAGAAACAAGTATCCACTTCCGAA
CATAAATGAGTTGTTCGAACAGTTGAAAGGAGCTAAGATCTTCTCCAAGCTCGATCTTAG
AATGGGCTATCATCAAATTTGCATTTGCGAAGAGGATATTCCGAAGACTGCTTTCAGGAC
TAGTTTTGGCTCGTATGAGTATACGGTCATGTCTTTTGGTCTGGCAAATGCTCCACCGAC
ATTTTGTCAAATGATGAACTACATATTCTCTTCGTTCAAGAATGAGTTCGTCTTCCTGTA
TCTCGACGATATTCTGGTCTTTTCGAAAACTGAGGAAGAACATGAAGAACATCTCAGGCT
GGTGCTTGATAAGTCAAGAGAGCACAAATTCTATGCCAAGTTTTCCAAATGTGAGTTCTG
GTTGAAAGAAGTCGTCAATCTTGGGCACATCATCCCTGCCGAGGGCATCAAAGTTGATAT
GTCAAAAGGTGCAGACCATTGTTCAGTGGGAGCCTCCGCAGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTAACGTAACGAAACTTTTTAAGGGTTAACCGTTACCT
AAAGGAAACGGGTAAAAACCCGTTACCTAATAATTACCAAATTAGGACAACTTAATACAA
CTAAGAGATACAATAATAAATTAAAGTTTACCTAAAACCGGTACCTAAACCAACTTACCT
AACTACAAAACAATACATGAAGCAATAATGAACAGATGGTATCTCGCTAGCTCTTCTAGA
GAACCGCAAAACAATAATGTAGAGCACCTTCAAAGACCAAGGGTTGACTGAACATTGTAA
TTCATGGCAAAGAAAGATCCAGTCACAGTCATACTCATTAACAATTAAAAAGCAAAGCAT
AGAAATGACAGAGGTTCTCTCTAATTGGTGCTTTTATAAGAAGTGGATGACTCAACAGAA
ACATAAATAGATAGGCCGTTCGCAGAGGGAAGCATTGATTTGCAGAGGTGCCGGAGCTCA
AGCTTTGTAGACAGAGATAAATAATTTCGGGTGGCATAGCTTTCATTGTCAACGGCAATG
ACCAATAGTTTTCACCATCTTCCATTCTACACCATACTATAGGCGGTTCCCAAATAGAAA
GAAAGTTTGACTCCCACACCACCGAATCAATCACACTCCAACGGCTAGCCGTAATACTCG
GGTTGCCATCCATACCAACAACAATACCAGGGGGGAGTTATGTTTGCAATTATACTTTTC
GATTTGAGCATGGAACTGGGCATTCCAATTACCGTCCCCTTTACCCGTGAATAGATAGTG
AATAAACACGATATCGAAGGATAACACGCCTAGCATAGGAAGATACTAGATCGCCCTTTG
TCACCACATGAGTGGTTTAGGGACAATACAAACCAGATTANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCTGTGAGTGGATGGCACTACTTCTAACTAGCCAATGAAAN
ATTTCTCACATATTCAATTTCCAAGGCAATAAATGTAGCATCCGCGATAGGATGATGTTA
TATAGATGTGTGATTTATAGTGGTAAGTTGGATTGCTGCTTACCAACTGAGGCTAAATAA
AATGCATTTTACTTGCTGCTTATGGAATGAGGCTAAATAAAATGCACATTTATTTTGTTG
CAAGCTGAATTGGAATATCTGCTGAGTAGTCTCTTCAAGCCAAAATAAACTTCTATAATA
AAACTACCACATATATTATATCAAGCGGTGTTATCTATAGATTAACAATTGGAATATCTG
TTGTGTAGTCTCTTCAAGCCAAAATAAACTTCTGTATTAAAACTGTCACATTATCTTATA
TCAAGCGATGTAATATATAGATTAACAATTGGAATATCGGCTGAGTAGTGTCTTTAACAG
CATGCAAGGGGGAAAATATGTGTTTTACAGAGTATACTATTCAACAACATGCGAGGGCGA
AAGTCAGTTTTCTTAGAGAATAAGTGATTTGTCTAATTCTGGTGTTTCTACAACTTAGTA
GGAAAGTAACATATCAATTACCTAACGATACTCTACAATAGCATAGACAAAAACTAAAAC
TTAAACCCTTACCTACCTTCGTTCCTACCTTTCCCTTTCCTACGTTCTANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATATGCATCACTCCACTCTGCTCWTGACT
TCGTGCCGTTCACGTCTCATATTGTCATTGCATGATCGTAAGATAGCCAGCGAGATGTTT
TCAACGTCATACGCCATGCTAGATCGTTGTACATCCCGGTACACTGCCGGAGGCATTTTC
TATAGAGTCATCATTATTTTGAGCTTTGAGCTGTGAGTAAATAAAAGTGTGATGATCATC
ATTATTAGAGCATTGTCCCATGTGAGGAGAAAAAAGAGGCCAAAGAGCCCAAATAAAAAA
AATAGAAAAAAGATCCTTCCTTTTTGATCGTCGAACTACTGGGTGTGTTGATCGCCGAAC
TATGGCATGCTGATCGCCGACTTGTGGCACGATCGTCAAACTTTGTGGTGCCGGAAAAAG
ACAAGTTTGAAACCGTTGGCGTCCCGGGACCCAAACCTGGGGGCACGGCTGGAAACTCGC
TCGCCCCGAGGGCAAGAAAAGCGTCGGCTCAACGCCAAAAAGGCTTTCGTCAAGGTGCGA
TGGGGGACAAACGACTGGAGATGCTCTAAGGGATNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTACCTCCTACTGTTCCCCATTCCCTCCATTTCTACCTCNCCTTTCC
ACGGATCCCACGACTCCCACGGACGACGCTCCCTCCCTCTCCCTCGCCACGGACTCCCAG
ATCCCACGGAACGCACCCTGAACCGTGCAACCGCCATCCGGCGGAGCTTACCCCGATCCG
ATCCACGACTCCCCTNTACCCCCGCCTCCTCAGATCTCCCCACGCGCTCGGATTTTTGAC
ACCAGAGGTTGGTGGCACCGCGGTGCTGCTGCTGTTGCCGCTCGGTTGCTTTGACCAGCG
GGAAGCCCATCTCTTGTCGCGGTTGCCTTCGACTCGAAATGTGATCTTCTTCCTGTTGCG
CAGGTCCTGCCGGTGGGGGTCCGCGTCTGGAAGCTCCTCGGCTGCTGCTGCTTCTTGCTT
CGGGTGCTCAATAGCAAACCCAGCCGGCAGAGAKTGGGGGTGGTGGGGGAGAAGTTCCAG
TTGGGGACAGTGGGGCGCTCAGCCTCTCCGTGGTCTCCTCGGTCTTCATTGTCATCTGCA
ACAAGGCGCTCGTGAGCGCCCTTGGCTTCATCTTAGGTATGGGATCCAATATCGCGCTCT
CCAGATGTGCTCCACTCCTTCTCTTTGCTACCAGCGCTTCGCCTCCCTGGTCGTATTCTC
TGCATTCATTTCAGTCTTAAGTCTTCTCCATGATTAGTGAAATATACTACTACTACCATT
CAGGGTCGTTCATTGTAAAGCCGTCACACTGCAAGGAATAGCGTCAATGATAACGTAACA
AGTACTGCATTTTCTAGGAGTATCAACTCTGGTAGCATCCCTAAAGTAATAAGTATAATA
TACTGTATTAGTAGCAACTTAGGCTGACTTGATAGCTGTGACTAGTGACTAATCTGTGCA
TGTTCCCACGAGAGATGCTGCAGTCCATTCACTTTACAGCTGCATTTATTTGAGACGAAA
CCAGCACTTTATCTTTGCGGAAGAGATGGCTGACAGGGCTTCGATTGGAATTTTGTTCTG
CAGGGGCTGCGGCTGTACGATGCAGACAAATCCATTCTCCGTCTGGAGGCGAATTCGGAG
GCAGCACTTCTGGACTGCTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCCTCCTCTGCTCCGTGCCTTCTATCCCCAGTTGCTCTGATGATCCTCGTGGCCTTC
GAGCCACGGTCATGGTGTGGGTCTATGGCCTTCGTTCCATGGCTGTCTGGCAAAGTTGTC
AGAATCGTGATTCTGAAACGGATCGGAAAGTCTTTCGGTAGAAATCGAGTCGTAGAATCG
AAGATTCTACGCGATCCTACCAGTACAATACTTTTTAGACATTTCCGTGTAAAAATTTCA
TTGTTAACAAAGTATGTTTTGTAGAGCTACAACAAAATCAAAATGGACGAGTTTTTTGTA
GTAGTAGCGTCCATGTGCTTAAAAATAATTATGTTTTTTGGTACAACTCACACCAAAAAA
AAATTCATCGTGAAATTATGTCGAGAGGTAGTGTACATTAGTGTAAAAAATTAACATGGT
AAAATTAATATAGGATAAGCTAACATAAACAGAAGTAGTAATTCAGCATAAACCAATAGG
TCTCCGTTACAATATAAATGTTCATTAAAGGGCTATAGTCACAAAATATAGCTGGTTCAG
CCTGAAAGCGGACAATAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GAGATCACTCCTTTAAAGGTAGTGTTGCTGGGCTTGATCCTTGACGGATCTATACCCATC
TTTTTCACCGTGTGTAGGTTTCGAGTCTTACTCAATACTCACACCTTATAACACAGCCAA
AACATTGGAATGCTAGCGACACTATCGCATACGTGAGTCAAAAGACGCAAACGGTCCCGG
CTAAGGTAAGGCTGCAGCCGTGGAGTTAACCGTGCGTGAGACCACAAAGGGATGCGATGT
GTTACAGGCTGGATTCCTATGGCTTAGGATCGGGGTCCCGGCAACTACTTACATGAGCCG
CTCTAAAGGTCAGCTTCTCATGCTCAATACCGGGAGTCACGCACTTGAACCGCTTCTAAA
CCCTGCCCGACAAGGAAAATGATTTGCTAAGTTTTTCATTAATTGATATATCAGAAAATC
ATCGAAAGAGACCGATAGAGCGCAAGAATGATTGAATTACCCTTGAAGCATGTCCTGCAG
GCTTTGGAACTGTTCCAAGGGTCTCGATATGGGTCGAAGGCATCAACTCTTCCCTTATCA
ATTTGAATGTCCAACAAAATCCAATGGAAGTTGCACATGTATATATATATGTGTGTCAGT
AACTTATCAATTACACTTATAAGTGAATGGACACAACAGAGTAAAGACCCTCACTTGAAG
TTGTATAGAAACAGTATGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGATGAGTTATTGTATTATGTAACTGGAGATGTATTATGTGATGTTATATATGAATGAT
TTAATTCGACTTGAGTTTCTTGGATTTGTAATATGAAATAGTGCTGCATTTAATATTGGA
CAATAATGTTGAAAAGGCCCAATAATTAGAAATGAAACCAAGTTACTAGAAAAAGTTGCT
GAATTCAAAATGAAAAAAGGGCAAAACTGAAACTGGACCAAATGTACTAAATAAAATTGC
TTGGTGCTTGGATTAGACATTGTTTTGTCATGACGAAATCCTTTAGTTTGCGTATGATGG
ATGGGTGGTTCCTACCCGTGGAGGTCCTTTATCAGCCTAGTTTTTTTTAGTACAAATTAA
CTTTGTAGTGGCTATCAATGCAATAGTGGCTATCAATTCAATAGCAAAAAATGCTTACAA
ATTAATTGGTGTAGTGCTGCTGTGTACGCATACCCTATAGTTCATCTAGCCAATAATAGA
AATTATACAGAAAGAGATTCCACCTCTGGAGGAATACGTTGGGTATCTTGCGTAGAACCC
TTGTGCTACAATACTTGCTCTATGTTTCACCACCTTGTTGTTACTCAATTCTATTTCGAG
AAGTAAAACTGGTGTAGGTATTACTTTATGAATACCTTTCCATTATTAGAGCAAAGATTA
TTTCTACCTAGATTATATCCTTTGTTTGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCTTGGTTTCAGGCCATTCACTCCGACGCAGGTGAACTAAATATAATTA
GCACACACCAGTATTGTACTTTCCTGTTGGAGGCTGGCATCAAATGAACTAGCATACTTC
CATTGCACAACTCTAAATAGATGTACGATATGCATTAATTAAACAACTTAAATTTTAACA
CACATCATGTAGTATATATCCTTTTGTTTAAACATATTTTCATGCAAAATGGACCGTGGA
AGCATAACCTCGAACACTGTGCAGTAATGCCCCAAGAGTGTAACTTGCCTTATTTGGAAC
CTTCTGTATGTGAGACCATCTTGTCTTTGCAATGAGAGTTATATTCCATGTGGTATTTCA
TGTGCACGCCTTGTTTTCTTTTGCATTCATGCATCCATTCATCCATGTCTCTTGTGTTGT
TGCTAATGTGATCATGTGTATGTGTTGTGATGACATGTGATGATATGTGGTTCTATGTGA
AGTGTTCTGGAGTGGTGCAATTGTAAGTAGGAAGCATCTATGTTAGTTGCAATAGGTTTT
TATAAAAACTCCCCCTTCTCTATTTTCTCAAGCTCAAAATTCTCTTGCTCCATTCCGGTT
TCAAAAATGCCCATGTTTTAGTATGATTGTGGTGGATGTGATGTTATGTATTTGTTGTTT
TGAAACTATGTTTTAGTGGTGCAAATATTCACAAAACACATCAACTAAATTATGTTTTGT
AAATATTTTTATGCTCCAAAAATTCCTTTTATATTTTATTTAAATAGGTCATAATTCCTT
ATGACCAGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTTAC
TTTCCGGAAAGTCCCCGTAGTTGGGGGAGCGAAAAGATTGGATTTCTTTCGGCCCGTTTT
TTCTGGCAAAGCGAATGAGCGTCTAAGACAAAAGTACTAGACTTACTAGATGGGATATTT
TGTGTAGACCCAAAGATCAAGGGGATTAGGAATTGWMMRYTYWRGMTGAACCARMAYAWW
TGTGACTATGCCCTTTTAATGAACATATATGTCGGAGACCTATGGGTTTATGCTGAATTC
TACTTCTGTTTATGAGCTTATCCTATATAATTTTACCATGTTAATTTTTTACATATGTAC
ACTACCTCTCGACATAATTTCACGATGAATTTTTTTTGGTGTGAGTTGTACCAAAAAAAC
ATATATTTTAAGCACATGGACGCTCACTACAAAAACTCGTCCATTTTGATTTTGTGTAGC
TCACAAAACATATTTGTTCATGAAATTTTACACGGAAATGTACTAAAAGTATTGTACTGG
TAGGATYGCGYAGATGTATACAACAAGTCTGCTACTACTACTTGTGAAGTCGTGATAGTA
GAATTCTAGTAATTATACGGCTAATGGCTGATCACTGTTTCTAGTATTCTATCCGATCCA
TCCATTGTCTCTGTACTGTATTCTATCCGATCCATCCATTGTCTCTGTACTATAATTTCK
AGCCGATCACTACAAGCCGATTAATAGAATATCTAGCTGGTCACTAATTGCTAGACTTGT
TGTTAATGATCGGCTAGAAAGTCTAGTAATTAGACTGCTATCTTACATATTCAGATTTCG
AGCAAGATCATGAGCAAACCACATAAGCAATGACNTTTAGGTCTCAAGAGGAACTCATAT
CAATGGCATAATCAACTAGCGATCAATAATAATAAGTTTCAAACGTCAACACTTCAATCA
AAACAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTATTAACTC
AGTGCCAAGAGCTTTTTCCTATGTTTTTGTACCYTTCAGAGGAGGATTTTGAACGGAGTC
CAAACGGAAAGTGAAACTAGCCAAAAAGATTTTTTCCGGAACAGAAAAAGATCGGGGAGG
CGGAGAATCGGGGCACGGGGCCACCAGGGACCCCACAAGCCCTCATGGCGCGGCCAGGGG
GGCCCACAGCCCCCTGGCTTGTGGGCTCCCTGAGGCTCCTTTTCTCTAAGTTTTGCGCCT
ATATATTCCCTAAAATTCCATAAAAAATAAGGAGATCATCGAAAGTACTTTTTCGCCGCC
GCAAGCTTCTGTCTCCGCAAGATCCCATCTGGGGCATGTTCTGGTGCCCTGTCGGAGGGG
GGATTCGGACACGGAGGGCTTCTTCATCAACACCATGACCTATCCAATGATGCGTGAGTA
GTTCACCATAGACCTACGGGTGCATAGCTAGTAGCTAGATGGCTTCTTCTCTCTCTTGGA
TCTTCAATACAAAGTTCTCCATGATCTTCATGGAGATCTATCCGATGTAATCTTCTTTTG
CGGTGTGTTTGTCGAGATCCGATGAATTGTGGATTTATGATCAGATTATCTATGAATCTT
ATTTGAGTTTCTTCTGATCTCTCTTATGCATGATTTCATATCCTTGTAATTCTCTTCGAG
TTGTGGGTTTTGTTTGGCCCACTAGATCTATGATTCTTGCAATGGGAGAAGTGCTTGGTT
TTGGGTTCATACCGTGCGGTGACCTCACCCAGTGACAGAAGGGGTAGCGAGGCACGCATC
GTGTTGTTGCCATCAAGGGTAAAAAGATGGGGTTTTCATCATTGGTTTGAGATTATCCCT
CTACATCATGTCATCTTGCTTAAGGCGTTACTCTGTTCGCCATGAACTCAATACACTAGA
TGCATGCTGGATAGCGGTCGATGTGTGGAGTAATAGTAGTAGATGCAGAAAGTNTCGGTC
TACTTGTCTCGGATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACT
AGATAAGTATCTTCGTAGAATATGTAGGATCCAATATCAAAGAACTCCCCAAACGCACAC
TGTTCANCTTCAGACATCGACCTTCAACCCCGACCTAAGTCCTATCGTGAGCATCCAATT
GTGGTTCTCGAGGCGACTGAGCGCAAGACCCGCAACAAGACTTTCAAATTTCTCAAGGTG
CAATGGTCACACCATTCCGATAAAAGGCCACTTGGGAACGCGAGGATCACCTCCATTCTG
AATTCCCAGAGTTCTTTCAGTCTTAGATCTCGGGGCGAGATCTTTTTGTAGTGTGGCAGA
GTTTGTAATGCCCCAAGAGTGTAACTTGCCTTATTTGGAACCTTCTGTATGTGAGACCAT
CTTGTCTTTGCAATGAGAGTTATATTCCATGTGGTATTTCATGTGCACGCCTTGTTTCTT
TTGCATTCATGCATCCATTCATCCATGTCTCTTGTGTTGTTGCTAATGTGATCATGTGTA
TGTGTTGTGATGACATGTGATGATATGTGGTTCTATGTGAAGTGTTCTGGAGTGGTGCAA
TTGTAAGTAGGAAGCATCTATGTTAGTTGCAATAGGTTTTATAAAACTCCCCTTCTCTAT
TTTCTCAAGCTCAAAATTCTCTTGCTCCATTCCGGTTTCAAAAATGCCCATGTTTTAGTA
TGATTGTGGTGGATGTGATGTTATGTATTTGTTGTTTTGAAACTATGTTTTAGTGGTGCA
AATATTCACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGATCC
TCGTGGCCTTCGAGCCACGGTCATGGTNTGGGTCTATGGCCTTCGTTCCATGGCTGTACT
GGCAAAGTTGTCAGAATCGTGATTCTGAAACGGATCGGAAAGTCTTCGGTAGAATCGAGT
CGTAGAATTCGAAGATTCTACGCGAYMSYACCACAATATGCAACAAACACATGATGCATG
AGATGAGAATGAACATGCATCTCTATTCTAGTCACTTGCACATGCATGAGAAGAAAGTAC
AAACTTCTGGACAGAACTGCACTCTAAGCTATCTTGACATGCATGTGGATGACATGAACG
GATGTATCACACGAAAACGATGCAAAAACATATAAAGAACGTTACGAACGGAGCTATGGA
TCAACCGGAAACAACAAAACAAGAAATGGAGTTCTACGGAACAAATCCATCACAACACAC
TCCAATGGCATACTTCTGGTATTCCCAGGTWGCATGTGATCGTGTCATTTTATTGCTATT
GTTTTCTACGTGTCAAGTATTCATTCCTATGACCATGAGATCATGTAACTCACTGACATC
GGAGGAATACCTTGTGTGTATCAAACGTCACAACGTAAATGGGTGACTATGAAGGTGCTC
TAGAGGTATCTCCGAAGGTGTCCGTTCAGTTAGCATGGATCAAGACTGGGATTTATCACT
CCGCGTGACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTCTA
TGGCCTCGTTCCATGGCTGTCTGGCAAAGTTGTCAGAATCGTGATTCTGAAACGGATCGG
AAAGTCTTCGGTAGAATCGAGTCGTAGAATCGAAGATTCTACGCGATCCTACCAGTACAA
TACTTTTAGACATTTCCGTGTAAAATTTCATGAACAAATATGTTTTGTGAGCTACACAAA
ATCAAAATGGACGAGTTTTTGTAGTGAGCGTCCATGTGCTTAAAATATATGTTTTTTGGT
ACAACTCACACCAAAAAAAATTCATCGTGAAATTATGTCGAGAGGTAGTGTACATATGTA
AAAAATTAACATGGTAAAATTATATAGGATAAGCTCATAAACAGAAGTAGAATTCAGCAT
AAACCATAGGTCTCCGACATATATGTTCATTAAAGGGCATAGTCACAAATATGCTGGTTC
AGCCTGAGCGGWTCATTTCTGACGCTCCGTTTTCGACGCTGGTTTTTCGTCGTGAGATCG
TCGTAAACTAAAAACCGTGACGATGTAGCGACGAAAATATAGCGTCGTGTATTAGCATAT
TCCTTGTAGTGGAAAGAGGGGATGCCTTCCCGGGGCATCCCCAAGCTTGGGATTTTTGTT
GTCCTTGAATTTGGCTTGGGATGCCTTGGGCATCCCCAAGCTTGAGCTCTTTCCACTCCT
TATCTCTTTGTCCATGAGAACATCACCCAAAACTTGAAAACTTCACAACACAAAACTTAA
ACAGAAACTCGTGATAACATTAGCACAAGAAAACAAACTACCACCTCTTTTGGTACTGTA
GCAAACTTGAATTCTATCTATATTGGTGTTGGGCTACTGTATTCTCACTTTTCCATGGCT
AGTACCCCCCGGTACTAACCATAGTTTCATCAAAACAAGCAACCAACTCAACGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGTGACACTTACTTGGATGAGTTC
TTGAATTGATCCTCCCCGGCAACGGTGCCAGAAATTCTTCTGCTACGGCAACAAAAGTCC
TTCCCCAGCAACGGCGCCAGAAATTCTTCTGCTACAACAACAAAAGTCCTTCCCCGGCAA
CACCAGGAATTCTTATTGATACTTCTCTTGTTTGCGTCGGTTTTTCCCTTGAAGAGGAAA
GGGTGATGCAGCACAGGAGCAGTAAGTATTTCCCTCAGTTTGAGAACCAAGGTATCAATC
CAGTAGGAGAATCTCGTCAAGTCCAGAGTACCTGCGCAAACACAAAAGAGCTTGCACCCA
ACTCTATAAAGGGGTTTTCAATCCCTTCAAGATTGATTGCAAAGTGAGATCTGAAGGCGG
AAAGTGCAACGAAGTAAAAAGAGTAAGGCTGAAAATATGGTGTGGATTAGACCCGGGGCC
ATAGTGTTCACTAGAGGCTTCTCTCAGAATAGCAAATATCACGATGGGTGAACAAATTAC
TGTCGAGCAATTGATAGAACCGCGCAAAGTCATGATGATATCTAAGGCAATGATCATACA
TATAGGCATCATCACGTCNGAGACAAGTAGACCGATACTTCTGCATCTACTACTATTACT
CCACACATCGACCGCTATCCAGCATGCATCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAGTACTCTAGTGCGTACTTCCTTGGTAATGGGCCAAATTCCCCCGTT
AACTTCCATTTCACCAATTTGATATCTATTAATGGGCATCNCCATAGCCCTTTGATACAC
CGAGTCAATGTGACCCGATTCTCCTCCCTTTTTTGTCTCCACAACCACCACCACACTCTA
TTCCACTTATAGTGCTATATCCATGGACTCGCGCTCATGTATTTGCGTGATAGTTATAAA
AAGTTTGAGAAAGTAAGAGTGTGAAAGCAATTACTTGGCCAATATCGGGGTTGTGCATGA
TTTACATTAGTTGTGTGAGGATGACGGGGCATAGCCACACTATATGATTTTGTAGGGATA
ACTTTCCTTGGCCTTGTTATTTTGAAAGTTCATGATTACTTTGCTAGTTTGCTTGAAGTA
TTATTGTTTCATGTCAATGCAAACTATTGTTTCGAATCTTACGGATCTGAACNTTTCACG
TCACGTGAAATAAGTTGCAAAGGCAACTACCTGGGTGTGGTGTGTTGTGTGCGGTGATGG
TGCGTTGTTTGTTCGGTCTCTCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAACTCTGGGAATTCAGAATGGAGGTGATCCTCGCGTTCCCAAGTGGCCTTTTTA
TCGGAATGGTGTGACCATTGCACCTTGAGAAATTTGAAAGTCTTGTTGCGGGTCTTGCGC
GTCAGTCGCCTCGAGAACCACAATTGGATGCTCACGATAGGATAGTCGGGTTGAAGGTCG
ATGTCTTGAAGATGAACAGTGTGCTTGGGAGTCTTGAAGCATCTCCGGAGCTGAGAGACA
TGGAACACGTCATGCACATTTGCAAAGTTTGACGGGAGCTCGAGCTGATATGCAAGGTCG
CCTCTCTTGCCAACAACTCTGAAAGGACCCACGAAACGAGGCACAAGCTTGGCTTTGATG
CCAAAGCGTTGTGACCCTTCATAGGGGAGCCTTGAGATAGACGAAGTCATCGAGCTCATA
AGACAAGTAGGTCTATGGTGAACTCCTCACGCATCATCGGGGAGGTCATGGTGTTGATGA
AGAAGCCCTCCCTGTCCGAATCCCCCCTCCGGCAGGGCACCAGACGTGCCCCAGATGGGA
TCTTGCGAAGACAGAAGCTTGCGGCGGCGAAAAAGTACTTTCGATGATCTCCTTATTTTT
TATGGAATTTTAGGGAATATATAGGCGCAAAACCTAGAGAAAAGGAGCCTCAGGGAGCCC
ACAAGCCAGGGGGCTGTGGGCCCCCCTGGCCGCGCCATGAGGGCTTGTGGGGTCCCTGGT
GGCCCCGTGCCCCGATTCTCCGCCTCCCCGATCTTTTTCTGTTCCGGAAAAAATCTTTTT
GGCAGTTTCATTCCATTTGGACTCCGTTCAAAATCCTCCTCTGAAAGGGGTCAAAAACAT
GGAAAAAGCTCTTGGCACTGAGTTAATAAGTTAGTCCCAAAAAATATATAAAAGGCATGC
AAAACATCCAAAGTTTGACAAGATAATAGCATGAAACCATCAAAAATTATAGATACGTTG
GAAACGTATCAAGCATCCCCAAGCTTAACTCCTGCTCGTTCTCGAGTGGGGAAGTGATAA
AGAATGAATTTTTGATGTGGAATGCTACTTAGCATAGTTGTCCTTTGCAACTTATTTCAC
GTGACGTGAATGTTCAGATCCGTAAGATTCGAAACAATAGTTTGCTATTGACATGAAAAC
AATAATACTTCAAGCAAACTAGCAAAGTAATCATGAACTTTCAAAATAACAAGGCCAAGG
AAAGTTATCCCTACAAAATCATATAGTGTGGCTATGCCCCGTCATCCTCACACAACTAAT
GTAAATCATGCACAACCCCGATATTGGCCAAGTAATTGCTTTCACACTCTTACTTTCTCA
AACTTTTTATAACTATCACGCAAATACATGAGCGCGAGCCATGGATATAGCACTATAAGT
GGAATAGAGTGTGGTGGTGGTTGTGAGACAAAAAGGAGGAGATGGTCACATTGACTCGGT
GTATCAAAGGGCTATGGAGATGCCCATTAATAGATATCAATGTGAATGAGTAGGGATTGC
CATACAAGAGATGCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAT
ATCCAATACGCTAAGCCCTATATAAGTTATCTCTTTCCTTCCTGGATCGTTATCCTTTCG
TGCCGCCGCGCTGTGCCTCCGTTTCTCCGTCTCTGAAAGGACCCACGAAACGAGGCACAA
GCTTGGCTTTGATGCCAAAGCGTTGTGTACCCTTCATAGGGGAGACCTTGAGATAGACGA
AGTCATCGAGCTCATAAGACATGTCAAGATGCTTGCTATCATAATAGCTCTTCTGACGGG
ACTGCGCTGCTCTGAGATTATCCCGAATGACCCGACACATCTCTTCAGCTTCTTCTATCA
AGTCATTTCCAAGAATCTGACGCTCGCCGGTCTCGGACCAGTTGAGCGGGGTACGACACT
TCCTTCCATAGAGAATTCAAACGAAGCTTTGCCTGAACTAGCTTAATAACTGTTGTTATA
CGAGAACTCAGCGAAAGGCAGGCAGTCTTCCCACTTCATGCCCAAAGAGATAACACATGC
TCTCAGCATATCCTCAAGGACCTGATTGACTCTCTGCACTTGACCACTAGTCTGAGGATG
AAAAGCTATGCTGAAGCGTATCTTCGTGCCCATCGCAGACTGAAAAAAGTCCCAGAACTT
GGAAGTGAAGATACTTGTGTGATCCGAAGAAATCATCATAGGCACGCCGTGCAAAGACAC
TATCCTGGAAGTGTACACCTCTGCAAGCTGAGCTGCGGAGATGGATTCCTTGACTGGAAG
AAAATGAGCCACTTTACTCAACTTGTCGATGACGACGAAGATGGCATGATTACCCTTCTT
GGACTTCGGAAACCCGGTGACGAAATCCATCTCAATATGGTCGAACTTCCACTCGGGAAT
GGGCAATGGATGCAAAGACCCGCTGGACGTTGATGCTCTGTCTTTCCTACCCTTCGACAT
ACATACACTATTCTATTTAACGAACTGAGACAACTCTCACGTCTTCATGCGACGTCCATG
CTACGGACAAACAAACGTTCCCTTACCCAGACAACCGCCGAAGGTAANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNACATCATAGAATGCCTCAGAGCAAATTACCCAT
AAAACTTAGTGTTCCTCATCTGCATCAACATTGACCGTTGTTTCGAAACCAATCCGTAGA
ATCTTCGATTCTACGACTCGATTCTACCGAAGACTTTCCGATCCGTTTCAGAATCACGAT
TCTGACAACTTTGCCAGACAGCCATGGAACGAAGGCCATAGACCCACACCATGACCGTGG
CTCGAAGGCCACGAGGATCATCAGAGCAACTGGGGATAGAAGGCACGGAGCAGAGGAGGG
AGAGGAGCTCACCGTGCCGATGCCAAACAGCGTCGCCGGCAGCAGTGGGGCAGTCCAATG
GAAGACGACGAAGCTTAGCCTACCTCCATGCACCTTGCCTGTAAGAGATGGTAAAGTAGT
TTGAGATATCACATTATTGAATTGCTTGCAGTGTGACATGAGCTAGCCAAAAGTATGTAA
GGGACTAAAAAGTTTTAGGAGTCTAGAATCATATATGCCCTAGCATGCATCTCTCAAATA
GTTGGCATTCAGCATTAAATTTCAACTTTCATCTGCCCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAAACCCCAACCACAGCCCAAACCCTAGCTCAGACCCTCCCTC
CTCCCCATCTCCTCGCCGCCGCCACCCTCCTCCCCGTCCCCGCCCCCCTTCCGATCCTGT
CCTTTCCCCGCCACTCCCACCAATCGCCCACCTCGCCATCCTCCTCACCCACCATTCCCC
ATTCAACATACCTCCATGTTCCCCATTCCCCTCCATTTTCTACCTCTCCTTCAGGATCCA
GATCCAGGAGAGCTCCCTCCCTCTCCTGCAGGATCCAGATCCAAGAACGCACCCTGAACC
GTGCAACCGCCAGTCCGGGCGGAGCTTACCCCGATCCGATCAGATCCCTCACCCCCCGCC
CTCCTCAGATCTCCCCACGCGCTCGGATTTTTGACACAGAGGTTGGTGGCACCGCGGTGC
TGCTGCTGTTGCCGCTCGGTTGCTTTGACCAGCGGGAAGCCCATCTCTTGTCGCGGTTGC
TTGATCGAAATGTGATCTTCTTCCTGTTGCGCAGGTCCTGCCGGTGGGGTCCGCCTCTGG
AAGCTCCTCGGCTGCTGCTGCTTCTTGCTTCGGGTGCTCAATAGCAAACCCAGCCGGCAG
AGATGGGGGTGGTGGGGGAGAAGTTCCAGTTGGGGACAGTGGGGGCGCTCAGCCTCTCCG
TGGTCTCCTCGGTCTTCATTGTCATCTGCAACAAGGCGCTCGTGAGCGCCCTTGGCTTCA
TCTTAGGTATGGGATCCAATATCGCGCTCTCCAGATGTGCTCCACTCCTTCTCTTTGCTA
CCAGCGCTTCGCCTCCCTGGTCGTATTCTCTGCATTCATTTCAGTCTTAAGTCTTCTCCA
TGATCAGTGAAATATACTACTACTACCATTCAGGGTCGTTCATTGTAAAGCCGTCACACT
GCAAGGAATAGCGTCAATGATAACGTAACAAGTACTGCATTTTCTAGGAGTATCAACTCT
GGTAGCATCCCTAAAGTAATAAGTATAATATACTGTATTAGTAGCAACTTAGGCTGACTT
GATAGCTGTGACTAGTGACTAATCTGTGCATGTTCCCACGAGAGATGCTGCAGTCCATTC
ACTTTACAGCTGCATTTATTTGAGACGAAACCAGCACTTTATCTTTGCGGAAGAGATGGC
TGACAGGGCTTCGATTGGAATTTTGTTCTGCAGGGGCTGCGGCTGTACGATGTAGACAAA
TCCATTCTCCGTCTGGAGGCGAATTCGGAGGCAGCACTTCTGGACTGCTGCTTCAAGGAC
GAGTCTGTGGCATTTGCCGGCGGTTCGGATGGATGTGTAATAAGGTATCAACAAAATTAG
TTGCAACACTCCACCAAGTCCATGTGCTTCGTCATCACAGAAACATAATGCTTGTAGCGT
TTTTCTTTCCAAATGCAGGGGCACCATCCTCTATTCTGACTAGAGCTCCCTTCGAGGCTC
CATGTTAACTCTAAGAAGACAAGAAGTAAGAAATTAAATCGTAAGTACCTACCTAACAAC
CCTAAACTAAAGGAANACTTATAAGTTATTAGTTACGTACGTTACGTTTAACCGTAGGTA
AGTAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTACGTTTAG
GTTTCCCAACTTTCAACTTATTAAACGTAGTTAAAGTTAGTACTAAGTTAACTCACACAC
ACATATATATATACATATGGTGAATGCGGCTGAGGCAGAAAACTACGTCAGATGTGATTA
TGGGTAACCTCCTCGTCAATGATATTCATGCTAAAGTGTTGTTTGATTCTGGTGCATCGC
ATTCTTTCTTGTCATANCCTTTTGCAGCAAAGCATGATTTCCATCTTCAAGAGTTGGCTA
AGTCTCTGGACATTGTTTCTCCGGGGATGCTTATGAGTTCTCGTTGGATTGTTCCGGATG
TTTCTGTCAAGATGGGTAGTTATTCTTTTCTGGCATCTCCTATTGTCTTGGGCAATTCCG
ACATTGATTTGATCCTTGGTATGGACTGGTTGGCCATGAACAAGGCATCCATTGATTGTG
AAGCTTACTCACTCTTCGGAGGACGTGATTATCTTCGTGGCGCGTGATGACACAATCCGT
CTGTTATCTTTGAATGAAAAGGGTGAGATTAATCCTATTTCGCAAGTCCCAGTGGTCTGC
GAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTCACCTCTACTCC
AGTCTTGGTTCCTCCTGATGACTCCAACCTTACACGTGTTAACACCAGGAATTCTTATTG
ATACTTTCTCTTGTTTGCGCGGTTTTCCCTTGAAGAGGAAAGGGTGATGCAGCACAGGAG
CAGTAAGTATTTCCCTCAGTTTGAGAACCAAGGTATCAATCCAGTAGGAGAATCTCGTCA
AGTCCAGAGTACCTGCGCAAACACAAAAGAGCTTGCACCCAACTCTATAAAGGGGTTTTC
AATCCCTTCAAGATTGATTGCAAAGTGAGATCTGAAGGCGGAAAGTGCAACGAAGTAAAA
AGAGTAAGGCTGAAAATATGGTGTGGAGTAGCCCGGGGGCCATAGTGTTCACTAGAGGCT
TCTCTCAAAATAGCAAATTTCACGGTGGGTGAACAAATTACCGTCGATCAATTGATAGAA
CCGCGCAAAGTCATGACGATATCTAAGGCAATGATTATACATATAGGCATCACATCCGAG
ACAAGTAGACCGATACTTTCTGCATCTACTACTATTACTCCACACATCGACCGCTATCCA
GCATGCATCTAGTGTATTGAGTTCATGGCGAACAGAGTAACGCCTTAAGCAAGATGACAT
GATGTAGAGGGATAATCTCAAACCAATGATGAAAACCCCATCTTTTTACCCTTGATGGCA
ACAACACGATGCGTGCCTCGCTACCCCTTCTGTCACTGTGTGAGGTCACCGCACGGTATG
AACCCAAAACCAAGCACTTCTCCCATTGCAAGAATCATAGATCTAGTGGGCCAAACAAAA
CCCACAACTCGAAGAGAATTACAAGGATATGAAATCATGCATAAGAGAGATCAGAAGAAA
CTCAAATAAGATTCATAGATAATCTGATCATAAATCCACAATTCATCGGATCTCGACAAA
CACACCGCAAAAGAAGATTACATCGGATAGATCTCCATGAAGATCATGGAGAACTTTGTA
TTGAAGATCCAAGAGAGAGAAGAAGCCATCTAGCTACTAGCTATGCACCCGTAGGTCTAT
GGTGAACTACTCACGCATCATTGGATAGGTCATGGTGTTGATGAAGAAGCCCTCCGTGTC
CGAATCCCCCCTCCGACAGGGCACCAGAACATGCCCCAGATGGGATCTTGCGGAGACAGA
AGCTTGCGGCGGCGAAAAAGTACTTTCGATGATCTCCTTATTTTTTATGGAATTTTAGGG
AATATATAGGCGCAAAACCTAGAGAAAAGGAGCCTCAGGGAGCCCACAAGCCAGGGGGCT
GTGGGCCCCCCTGGCCGCGCCATGAGGGCTTGTGGGTCCCTGGTGGCCCCGTGCCCSGAT
TCTCCGCCYCCCSGGGTTCGGGCCCCCCCGGGTAACGTTTTCCCGTTTCCCCCGGGTCCC
CCCCGTTTCCCCCCCCCGGGTAACCGTTTTACCCCGTTTTTTTTTTTTCCCCTTTCGGGT
TTTTTTACCCCCCGGGGGTTAAAAAAAAAAAAACCGTTTTCCCGTTTTTTTTTTTTTAAC
GGGGGGTTACCCCGTTTAAACCGGGGTTTTTTTTTTTACCCCGTTAAAACCCGTTTTTTT
TTACCCCCCCGTTTAAAAACCGGTTTTTTTTTTTTTACCCGGGGGGGTTAAAAACCCCCG
GTTTTTTTTACCCCCCCCGGGGGGTTTTTTTTAAACCCCCCGTTTTAAAAAAAAAAAAAA
ACCCGGTTTTTTAACCCCCCCCCGTTTTTTAACCCCCCCGTTTTTTACCCCCCGGGTTTT
TAACCGGGGGTTAAAAAAAAAAACCCGGGGGGGGGGGGGGGTTTTTTTAAACCCCCGTTA
AAAAAAAAAAAAAACCCCCGGTTAAAACCGTTTTTTAAACCCCCCGGTTTTAANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACCAAAATTACCAAATTGGTACCGG
AAATTCGACCCAACGACAATAGGAGATTCGCCGAAGAAAAGAATTAACCTAACCCATTCT
TAGACAACGAAACACTTACCCGGAAACTAACTACCCAACGAAGAACTCATAAGCATCCCC
GGAGAAACAATGTCCAGAGACTTAGCCAACTCTTGAAGATGGAAATCATGCTTTGCTAGC
AAAAGGATATGACAAGAAAGAATGCGATGCACCAGAATCAAACAACACTTTAGCATGAAT
ATCATTGACGAGGAGGTTACCCATAATCACATCTGACGAGTTTTCTGCCTCAGCCGCATT
CACCATGTTGACTCGAGCAGATCTGGGGTTGAACTTCACGAGAGCATTGCTTGGAGGTTT
GCCTGGAGGAGGAGGCGGAAGACGGAGCTGAGAAGTGCACTTGTTCGCATAGTGACCCTT
CCGCCCACACTTGTGACAAGTACCATCTGCTGGCTGGTGGTACTGTGTCTGAGGAGGCCC
TTGCTTCTGCTGCTGGAATCTCTGTTGAAAAGCTGGGTTGGGTGGGTGGGAAGAACCACG
ACCACCAGAATGCTTGAACTGCGTCGTGTGCTAAGGAGGAGGAGACACCCTATACTTCTG
TTGCTTCTGAACCACCTGAGTTGAGGAAGACGAGTTGGAATCTCTGAAGCGCTTCTTAGA
ATTATCCACCCTGAGCAAAGCTGCCTCAGCCTTGAGAGCTAAGTTGTAGAACTTATCGAA
CTCCTCAGGATCGTGCAAAGCGAGAGCTAACTGCAAATATTCTTTCAAGCCACCTCTGAA
CTGATATATCCTGCTCTTCTGATCAGGGATATCCTGCAAGGCGTATCGGGCTAGCTCGTG
GAACTCGACGTTGTACTTGTACACAGAGTTACCACCTTGCTTCAAGCGCCTGAACTTCTC
ACGCATTTCCTCCACAAAGCTGGACGGAATGTAGTGGGATATGTAGTCACGGCAGAACTC
ATCCCAAGTGTTCACTCTAGCACCCCTGGAATCCTTCATCTGTTGCCACCAGATAGATGC
TTGCCCCTTCAGCTGGAATGTTGCAAACTTGACGAAATCCTCTGGACGAACATTGCTGCA
TTCAAAGTACTTGTTCATGTCGCGGATCCAATCCTCAGCATCAAATGGCTGGTCACAGGA
AGTGAAAGTCTCCGGCTGATTTGACAGGAACTAACTCAGATTAGCAAACTGATTGCCACC
ATGATTGAAGTTGCCTTGCTGCTGATTAGTCCTCTCTTGCAAGAACTGTATCAACATCTG
AGTGTTTGCATTTGTAGCAGTCATCACCGCTTGCCAAGCCTCTGCAGGAGGAGGCGACGG
AGGAAGAGGATTCTCCGGAGGAGGAGGTGATGGCGGCACATCCTCACGACCTGGATTCTG
ACGAGTTGGTGGAGCCATCCTGAAGACGGACAACACATTAGCCCACTGAATAAATTGACG
GTATAGCTGAATCAAAAAGGCAGGAACATCTCAAGAGGAATATTAGCAATTGCACTCGAA
CAAAATAGTAAGAATGCTTCCTCAAAGTGACTGTCGACAAAATTCTGATTAAGACCACTT
CAAACAAGTATGAGCTAGAACTGCTCAGAACAAACATATGATCGAGATTTCATCCGACAT
CTTCATGGATAAGATCGCACGGGCTCGAATTTACAGTAGCCATCCTGTGCAAGGTAGTGC
ACACGACTTACGAAGTATCCCCGAGTCGTAGCAAGCTACACGGACTCTTTAAGACACAAC
GAGAACCGCTGTAAGACGATCGTGAACAAACATACCCACTGAATGTCGAATCCCAACCTC
ACATCATGCATCTGTAGGAAGATTTCCCTATAAGTCACTACTTGATATCCCACCTATGAA
TTCCCGAAATATCAGGTCATGCAATCTGATACACGGATACAAGGAGTAATATTCACACAA
CTCCTATACTAACTCGTCCACTGTATCACATCCGTCAACACATAAGCAGAATCTCAGACA
TTCATCTACAACAAACCCTCGTGATCACAACGATACAAAGTATGGCAGTACTCCCGAACA
ATCTGCACCAGTACTGGGGACATCGGGGTTATCTTGCCACTACTTGTACTGAAGCAATTA
CGAACATCCTTCGTTCAGAGATACTCAGAAATCTGAATGATAGCAATGTCCACAAGAATC
CCCTGGAGCTCAACTCCCCGGAAGAAATCAAGGTAGACAAGAGGCACCAAGACAGAACTC
CATCACATCGATATCATATAGATTTCAAAAATACACGCCTGATCCTAAAAAAAATTTGAG
CGAGAAGAGGAGTAGAATTAAGATTTCTTAAGTTGGTAACCTCACCAGAGAATCGAAGAG
GAGAAGAAAGAATCCTACTCTCCGATATAACTAAGACTCAAAACATTTTACTAGACTCGA
CTCGGCCAAGTACGATCACACAAAGGCTCCTATGGTCGTAGGGCTCTGATTACCAACTTG
TAACGACTAAGATGCGGTCCTTTCCGATTTAGGGAACGAGGCCCCAAAATGGAAAGAAGC
GTATCTAAGCGTTTCGCAAGCACGATAACATAGCACATACATAATAATATAATGACAAAT
AGGGAATCATCTGCCATCTCATAGATAATATCAGAGTTTATATCACACATTTATTCAGAC
AAGGTAGTTCCGGCATGACCTTTGCTAAATAGTGGACATATGGAGCGCCTGAAATTTGCC
GGAACGAAAATGAATCAACATTCCGGCAAAACATAGGCCACTCTGACATTCCGGCAAAAC
TTTGCACAACTTAGCAAGCAAAAGTGAGAAACTCACTACTGTTTTATGCATTAACACCAA
CAAAAGGATGATATTTGTAGGTTGGTGAAATATGTATGTGCCCTTTTTCCTCTCCAAAGT
TTAAATTAGTTGTTTGAAACCATTGGTTTTCTAATTCAAACCTAATGTGCCTACTTACAT
GAAATTTAAAAACATGATTTTTTCCTTCTTTCTAGTTAGCCCATCAAAAGATCTTCAACA
AACATATCTTAATTTTCTTATTAACATGCATCTCAAAATGACATATTGAACCGATGGCCC
TAAAATCAAAATGGCAGCAGCCTTGGGGTGCCTAGAGCGGGAGGGGAGGGGGCGACGACG
CCTGGAGGGGGTGGGGGGCTTACCGGAGCGGGATGGGGAGGGGGCTTACGTGGAGCAGGA
GAGGGGAAGGGGGCTTACCAGAGCGGGAGGGAGGGGGCAGGTGGCGACGACGAGGGACGG
GCGACGGCGACGACGACGACGGCGAAGGCGAGGGAGGCGACGGCSAACGACGATGACGAT
CACGGCGAGGGAGGCGGCGACGGCTTGAGATCGAGGAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCGTTTGGATTTCGGCACAGTAGCTTCAGTTGAGTGCATAAC
CTGTTTACCCTATCCCTTCTGTCGAACCAGAGTGGTGTAGTGCAGTGGTGTTGGTCCCTG
GTGGTGAACCAGGGAGTCTTGGGTTCGAATCCCCAAGCCCTTTTATTTTATTTTGCCTTT
CCTTTTGCTGGTTTTTCTTTTGTTTGCCATGATAGTTTCTGTGGAGAGCTAGGGCAGCAT
GTATGGTATTTTGCTTGCCTCCTACCAGTAGGTTGCCTAGTTATTTTGCTAGTATGTGTA
GTGATGCATGTGTAGGCTTTGTGTGCATATGTGTATTGTGAGCTAGTGATGTATGTGGTG
TGTGTTTATAAGTGAGTGATGCACTAGCTTGTGCAAGTGTGTGTGTGTGTCGGGTTCCCC
CCCCCCCACATACTTTGTGTTTGTGATGTGCTTATGCATATGACTATATGTGGTGCAACT
CCTATGCATGTGTGCTTGTGTGGTGCAAGCACCCAAGGAGTGTGTAGGTGTATGTCATAT
GTGCATGTGAGTGTGAGTATTTCCATGTGGAGTTGTGTGTGTGTGTGTGTGTGCATGTGT
GTGTGTGTGTGTGTCACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCAACTATGCACTCACAAACATCAAAACATCAAAACTATACAATCTATCCAAAACAGCAT
CATAGCAGTTTGAGAGCTACATGCAAAGCACCTACAGCCATCCAAATGTGCCAAAAGGAT
ATGTGACAGAAACTATTCAAAAGCTCTACAAGCATGAGCAAAAATATAGTACAAAGGAGT
TTCACACAGAAAGTTCTACAACTGCTAACATGGACAAAATACCAGTTTTCAGGGACTTAG
TGAAAATCTCAGATTCTCACTAGCTGTTTATGCTCTGAAGCATTTTGATAGCACCCAAAA
CAATATCTATAGGAAGCCAAGTGGAATGAAAATTGACAGAGACCTATACAAACACGAAAG
CTCCAACTTTTGAGTTGAATGCAAGGGTTGATTCCCAACACATGAACATTTACAAGCACA
ACTACAAGGGAAGAAAATATCAGGAGTTTCTGAAATTTCAGCCACATGCCTACTTATACT
AAGCACCACTTGCACACATAAACTCCTAAACATGAAACAACAACACCATGTTGTAGAGGG
GTTCACCCTCTACTACCACAACACGGAATCCTCCTCTTGGGCCCATCACATCTCACATGG
AACCAAGCTCTAAACATTGAACAAAACAGAAAATGACATTCCCAGAAAGTGTACCAAAGT
GGAATCTGATTCCACCATTGGATTCCTGGGATGATTCTATCCCAAAAACATATATAATAC
CTAGGTACTTACATAGAACAAAAGGGCACAAAGCTAAGAAGAAGAAATGCATGGAATCAC
AAAGAGGTAAATAGTGATTTATCACATGTGACCCCACTAAGCTCAACTCACCTCACATGC
TACTTGCACACACTCACATACTCCAAGTGGTCGACCACTAAGTTGGGAACGGGGGGGTTA
AACGTAACCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTGGGC
TGGCGGCATTCCAAAGTTTAGTCCCACCTCGCTTGTCGAGAGGAGCCACCACTGGTTTAT
AAGCCCCGTTGTCCCAACCGTGTCGAGCTCCTCTCTAAAGCAGGCTTATGGGCCTAAACA
GACTTTAAATTTAAAAGTTGAAAATATATTTGAAATTATGGACAAAAATTCAACCTGAAT
TCAAAGTGAGGTCACTTTGAATTTAGGTTGAATTTTTCTCTATAAATTCTCATATAGTTT
CAATTTTTTTCCATTTTTTTTGTTCTTTGCTTTATTTATTATTTCTCTTCTATTTTAGTT
TTCTATTGAGTAGATCTTTTTTTGTTTCTTTTTAGTTAATGTTTTACTTGATTCTTTCCA
ACAAATAAGCACTTTGAAAATTTTAGTAAATTATTCTTAATTCATTCATTTTAGTTAATA
TTTTAGTTGATTCTTTTTAGTTGACTCTTTTTTTGTTTTCTATTAAGGATTTTAACAAAA
AAATATGAAATTTCTGACTTCATTTGATATTTTTCGTGAATTTACTTATTTTTTTGAGCT
AGTTGAGCCTGAAATTGAAAAGCACTACAAATGAACTCTAGAAATGTTGAAAGTTGGCAT
GGTATCATCATTTTCACCCGCATAGCATGTGCTATAGAGTTGAGAGGGTTACGGCAAAAA
CTGGATGCATTTCGTGTACAAAACGGACAATCTCTCTCGAAGTATCACGGTTTCGAATGA
GAACTCATCTGTTACAAAGGTATTTCATTTTTTGAACTTATTTGAACTCCATACTTTTTG
TGTGTTTAAAATGCACCATTCAAAGGCACATCATAAATTTTCAACAATTTCTGACTTTAT
TAGGTATTCCTTGTGCATTTACTTTTGTTTTTTTGGGCTAGTTGACCCTAAAATTGAAAA
GCACTACAAATGAACTCTGAAAATGTTGAAAGTTGGCATGCTATCATAATTTCACCCACA
TAGCATGTGTTAAAAAGTTTAGAGGGCTACGACAAAAACTGGATGCACTTCGTGTACAAA
ACGGACAATCTCTCCCGAAGTATGAGCGTTTCGAACGAGAACTCATCTCTTACAAAAGGG
ATTTCATTTTTTTGAACTTATTCAAACTCCATACTTTTTGCTTTCCAGCACAGTGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCAACGGTTATCCTAATAATT
TTTGATGGTTTCATGGCTATTATCTTGTCAAACTTTGGTATGTTTTGCATGCCTTTTATA
TATTTTCTGTGATAACTTATTAACTCAGTGCAAAGAGACAGTTCCTATTTTTCCATGGTT
TTTACCCCTTTTAGAGGAGGATTTCGAACGGAKTYYWGTTGTCCTTGAATTTGGCTTGGG
ATGCCTTGGGCATCCCCAAGCTTGAGCTCTTTCCACTCCTTATCTCTTTGTCCATGAGAA
CATCACCCAAAACTTGAAAACTTCACAACACAAAACTTAAACAGAAACTCGTGATAACAT
TAGCACAAGAAAACAAACTACCACCTCTTTTGGTACTGTAGCAAACTTGAATTCTATCTA
TATTGGTGTTGGGCTACTGTATTCTCACTTTTCCATGGCTAGTACCCCCCGGTACTAACC
ATAGTTTCATCAAAACAAGCAACCAACTCAACGAAAACAGAATCTGTAAAAAACAAACCA
GTTTGCAGCAATCTGTATACTTCGTATACTTCTGGTACCTCAAAAATTCTGAAAAATTAC
GACTGCCTGGTCAAAAGGCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCCATGCCTAGCAGGCTTGTGGGGCCCTCAGGGCTCCGCCGCCTCCAACTCCAGCT
CTATTTAGTCCCTTTCATCCGGAAAAAAATCAAGGAGAAGAGTTCATCGCGTTTTACGAT
ACGGAGGCACCGCCACCACCTGCTCTTCCTCTGGAGGGCAGATCTGGAGTCCGTTCTGGG
CTCCGGAGAGGGGAGATCGTCGCCATCGTCATCACCAACCTTCCTTCATCGCCAATTCCA
TGATGCTCTTCACCGTTCGTGACTAATCTCATCGTAGGCTTGCTGGACGGTGATGGGTTG
GATGATATCTATCATGTAATCGAGTTAGTTTTTGACGAGGATTGATCCCTAGTATCCACT
ATGTTCTAGATTGATGTTGCTAGTACTTGGCTATTCTTAATGCTTGTCACTTGGGCCCGA
ATGCCATGATTTCACATCTGAACCTATTATGTTCTCGTCAATATATGTGTGTTATTAATC
CTATCTTGCAAGTTGTAGTCACCTACTATGTGTTATGACCCGGCAACCCCGGAGTGACAA
TAGCCGGAACCACTCCTGGAGATGACCATAGTATGAGGAGTTCATGTATTCACTATGTGC
TAATGCTTTGTTCCGGTTCTCTATTAAAAGGAGAACCTTAATATCCCGTAGTTTCCATTA
GGACCCCGCTGCCACGGGAGGGATGGACAAGAGATGTCATGCAAGTTCTTTTCATAAGCA
CGTATGACTACATATGGAATACATGCCTACATTACATTGACGAGCTAGTTACATATCTCC
CCATGTTATAACTGTTGCATGATGAATGTCATCCGGCATAATTATCCATCACCGATCCAA
TGCCTACGAGTTTTTCCTACTGGTCCTTGCTACATTACTTTGCCGCTACTGCTGTCACTG
TTGCTACTGTTACTCTGTCGCTACCGCTGTCACTGCTGCTACTATTACTAACGCTACTAT
TGCTATCACACCACTTTGCTACTGATACTTTGCTGTAGATACTAAGTCTTTCAGGTGTGG
TTAAATTGACAACTCAACTGCTAATACTCGAGAATATTCTTTGGCTTCCCTTGTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGTGTTACCCGTAGAATGTTACC
CTCTATAGTGCAGGGCAAGATTGGAATTAGYRAWGMMKATATGTATAATCATTGCCTTAG
ATATCGTCATGACTTTGCGCGGTTCTATCAATTGATCGACGGTAATTTGTTCACCCACCG
TGAAATTTGCTATTTTGAGAGAAGCCTCTAGTGAACACTATGGCCCCCGGGTCTACTCCA
CACCATATTTTCAGCCTTACTCTTTTTACTTCGTTGCACTTTCCGCCTTCAGATCTCACT
TTGCAATCAATCTTGAAGGGATTGACAACCCCTTTATAGCGTTGGGTGCAAGCTCTTTTG
TGTTTGTGCAGGTACTCTGGACTTGACGAGATTCTCCTACTGGATTGATACCTTGGTTCT
CAAACTGAGGGAAATACTTACTGCTCCTGTGCTGCATCGCCATTTCGTCTTCAAGGGAAA
AACCGACGCAAACAAGAGAAGTAGCAAGAAGAATTCCTGGCGTTGCTGGGGAAGGACTTT
TGTTGCCGTAGCATGGACTCGCATGAAGCGTGAGATTGCTCAGTTCGTAAATGAATGTGA
TGTATGTCGAAGGGTGAAAGCAGAGCATCAACGTCCAGCGGGTCTTTGCATCCATTGCCC
ATTCCCGAGTGGAAGTTCGACCATATTGAGATGGATTTCGTCACCGGGTTTCCGAGTCCA
AGAGGGTAATCATGCCATCTTCGTCGTCATCGACAAGTTGAGTAAAGTGGCTCGATTTCT
TCCAGTCAAGGAATCCATCTCCGCAGCTCAGCTTGCAGAGGTGTACACTTCCAGGATAGT
GTCTTTGCACGGCGTGCCTATGATGATTCTCGGATCACACAAGTATCTTCACTTCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCTAGGGCAGATTTAGATGAG
AATACAGAGAGACGGAGAAACGGAGGCACAGCGCGGCGGCCACGAAAGGATAACGATCCA
GGAAGGAAAAGAGATAACTTATATAGGGCTTAGCGTATTGGATATCTACCGTTCATCTTT
AGTACAAAGGCACGATTAGAGCTTGAGCTAGAGTCGTTCATGGTAGCGACTCAGCATGCG
ATTTTACACGATCCTACGACTTGTAGCTAGACTCCACAGCGACTCAACAAAAAACGACTA
TGCTTGCGTTGGGTCGTTTCCTACATGTAGGGTCGTAAAGTCTTGTGATTTTAAGATCCG
AGTCGCGATTCTGACAACTTTGCCGTCTGGTTAGACTGCCAGAGTCCTTTCATAATCATC
ATGTCACTATTTGTTTTTAAGTTTTCTCGTTTTTCTGCTTACCATGCTAGCTAACACTAG
CCTACCTGATGCAAACTTGCTGAATATATGTATGGGTAGTTCTTGGTGGTCACTTATATT
ATCCAAGGGAGTAGTTTTGGTACTTAACGAATGGTGTTTCAGCTAGCTTGCACCTCATCT
AGCTACTCACTGTTATTGTTACCTAAAATAAAATTGCTTGGTGCTGGATAGACATTGTTT
TGCATGACGAAATCCTTTAGTTTGCGTATGATGGATGGGTGGTTCCTACCCGTGGAGGTC
CTTTATCAGCCTAGTTTTTTTAGTACAAATTAATTTGTAGTGGCTATCAATGCAATAGTG
GCTATCAATTCAATAGCAAAAAATGCTTACAAATTAATTGGTGTAGTGCTGCTGTGTACG
CATACCCTATAGTTCATGCATGTCCTATAGTCCAGTGCGGTGGTGAGTTGCGATCTCGTG
CGGTGGTGGGTTGCGATCTCGTGCGGTGGTGGTAATGTAAAGCAAGTTCCAGTCATAGTG
TCTGTCTTTTTAATGGTCTGAAGGACATAAGTATGCTACCACCATCACAGGCTCACAACA
CATATTGTAGCTTTATTCTACTCTAAAAGAACCCAGAGAAGATTAATCTGCAGCAGTTTT
CTCGCCAACTTTGGTAACGAGAGTATATCTGTTACTTCATATTCCTGAAGATCTGAACAT
TTTCTTTTATTTTTGCCTCATATTTTGTTTAAACTTACGCTACAGTTTCACCTGAGATGA
TATTTTGTTCTTCGAAAGACTTTTTTTCAATTTAGCATTGCCATCTAGTTCCTGCGCCTA
AACAATACATTATTTTGTTTGGATGCAGGTATACTAGAGCCCATAAAAGCTGGTATCAGG
GATGCAAAACTAGGAGTGGGGAAGCAAGAGCAGGATGACTTCTTCACAGCGAGTGCTAAT
TTCTGTATTTTCTTTTGAGATTCTTCTGGGTTGATGCTTCAGCTGTGAAAATTGGTATCT
GATTGTCAAGTGTGAATCAGATGAGTTATTGTATTATGTAAACCTGGAGATGTATTATGT
GATGTTATATTATGAATGATTTTAATCGACTTGGAGTTTTCTTGATTTGAATTATGAAAT
AGTGTCTGCATTTAATATTGGACAAATTAATTGGTTTAGAAAAAGGGGTACCCCCTAAAA
GTTTAAATTTAAACGGTAAAAATAGGTAAAAACCCTAAAGGTTTCCTAAACCGTTAGGAA
CGGTAAACCCTTTACGGGTACCCCGTAAAACGGGGGACCCAAACCGGTTAAACCCGAACG
GGGGGGTAAACGTTTAAACGGGGAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTAACCCCCCGTTTAAAAGTTTAACCCCCCCCGTTKWCRGGWRKGSYTYYAGS
ACCGAGAAATTGAATTGTHTTGAGCTTGAACCAGGTACTAAGGCTGTGTGCAAACGTCTA
GAAGAGCTGAAGGAACTTAAGAGGCAACTCGATGAGCAAGAGCGTTTGGGTCTGATCAGA
CCGAGCTCGTCTCCTTGGGGCTGTGGAGTTATGTTTGTCAAGAAGAAGGATGGCACGGAC
CGATTGTGTGTCGATTACCGTCCATTGAACAAGAAGACAATCAGAAACAAGTATCCACTT
CCGAACATAAATGAGTTGTTCGAACAGTTGAAAGGAGCTAAGATCTTCTCCAAGCTCGAT
CTTAGAATGGGCTATCATCAAATTTGCATTTGCGAAGAGGATATTCCGAAGACTGCTTTC
AGGACTAGTTTTGGCTCGTATGAGTATACGGTCATGTCTTTTGGTCTGGCAAATGCTCCA
CCGACATTTTGTCAAATGATGAACTACATATTCTCTTCGTTCAAGAATGAGTTCGTCTTC
CTGTATCTCGACGATATTCTGGTCTTTTCGAAAACTGAGGAAGAACATGAAGAACATCTC
AGGCTGGTGCTTGATAAGTCAAGAGAGCACAAATTCTATGCCAAGTTTTCCAAATGTGAG
TTCTGGTTGAAAGAAGTCGTCAATCTTGGGCACATCATCCCTGCCGAGGGCATCAAAGTT
GATATGTCGAAAGGTGCAGACCATTGTTCAGTGGGAGCCTCCGCAGAATGTGAAGCAGCT
TCGAAGCTTTCTCGGGCTTGCAAGCTATTGTAGAAGCTTCGTTGAGAACTTATCCAAGAT
TTCTAAGCCTCTCTCAAGTCTTCTTCAAAAGGGTGTGAAGTATGCCTGGTCTCCAGAGTG
TCAGTTGGCCTTCGACACACGCAAAGAGAAGCTCACCTCTACTCCAGTCTTGGTTCCTCC
TGATGACTCCAAACCTTACCACGTGTTCTGCGACGCCTCTCTTCAAGGTCTTGGTGCAGT
TCTGATGCAAGAGAAGAAAGTGGTGGCTTATACCTCCGGGTAGTTGCAGCCAGCGGAGAA
GAATTATCCTGTGCATGATCTTGAGCTGGCAGCAGTGGTACATGCTCTGATGACTTGGAG
ACACCTCTTGTTGGAACGAAAGGTTGAAGTGTTCACCGATCACAAGAGTCTCAAGTACAT
CTTCACCCAGCCTAACCTAAATCTCCGGCAAACTCGTTGGGTGGAAATGCTCCAAGATTT
TAATCCGAGCGTTGAGTACACGCCAGGCAAAGCTAATGTCGGGGCAGATGCCTTGAGCAG
GAAGGCTTATTGCAACAGTCTCATTCTGAAGCCTCTCCAGCCTGACCTTTGTGAATCTTT
CAGAAAGCTCAACCTTGAGTTAGTACCTCAGGGATTTCTTGCAAATCTTCAGATCTCTCC
TACCTTGGAAGATCAGGTCCGAGCAGCACAGCTTCTTGATGCAATGGTGAAGAAAGTCAA
GATTGGCTAGGCAAAGGGACTTCCCAAATATAAGTGCTTCAGTGTTGATGCCAGAGACAC
GTTGTTCTTTGAGGATCGCCTTGTCGTTCCGAAAGGTGATCTCAGAAAGGTAATCATGGA
AGAAGCTCATAACTCTCTGCTCTCAATACATCCAGGAAGCTCCAAGATGTATCAGGACTT
GAAACAGACCTTCTGGTGGACTCATACGTTTCCAACGTATCAATAATTTTTGATGGTTTC
ATGCTATTATCTTGTCAAACTTTGGATGTTTTGCATGCCTTTTATATATTTTCTGTGACT
AACTTATTAACTCAGTGCAAAGAGACAGTTCCTATTTTTTCCATGTTTTTACCCCTTTTA
GAGGAGGATTTCGAACGGAGTCCAAACGGAATGAAACTGCCAAAAAGATTTTTTCCGGAG
CAGAAAAAGATCGGGGAGCCGGAGAATCAGGGCAGGGGGCCACCAGGGACCACACAATCC
CTCATGGCGCGGCCAGAGGGGGCCCGCGGCCCCTTGGCTTGTGGGCTCCCTGAGGCTCCT
TTGCCCTAGGTTTTGCGCCTATATATTCCCTAAAATTCCGTAAAAAATCAGGAGATCATC
GAAAGTACTTTTCCGCCGCCGCAAGCTTCTGTCTTCGCAAGATCCCATCTGGGGCACGTC
TGGTGCCCTGCCGGAGGGGGGATTCGGGACAGGGAGGGCTTCTTCATCAACACCATGACC
TCCMCCGATGCKTKASKWCAACGTTACCGATAAATATCACGTAGATGGCTGAATNTCACA
TGAACTAATCGAATGTCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATTCTCTCATAAACTGAGATGAAGTGTCGCACTTCAACTCTTTGAGGCCTCCTGAAAAG
AGGTGTTTCCTGCGCACGCCGCACCTGATCGAGCAATATTGATGGTGGAATTGTTTGTTG
CTCCACCGCACGCTGGAGATGGTCTTTTGTGTAAGCCATCGCACTGCTGAGTGTTTCTTC
ACCATGGGTTCGAATATGGGCAGCGTTGTACATGGCCAAAAGGCTTCTTGTGTCGTTGCA
GGTAATATTTCCTTCGGCATCTATGAACTTTAAGAATACATCTGCGGCATTGTCATGTAT
AGTGCATAGTTCTATTAGGACAAATATTTATAGAAAATCACACCTGTCCACCTCTTTGAG
ATTTTAGTTATGTTTGTAATACCTGGTGAAACATTGAATCCCTGTTTCCTGAGCAAATAA
AACCGAAGGGCCACTGTGTGAAGATCGCTGGCGTCATCGCCGGCATCATGAATCCCACAC
AGCAAATCATTGATCTCCTTCCCATAGTGGTAATCCAAACCAAGCTGTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATGTCTCTCTCTCTCTCTCAAAAAGGTGT
GCAGCAAGGATGATTGTGACACAACAAAAAGAAAAGACTCCTAAGATACAAGACACTCCA
AGCAAAACACATATCATGTGGTGAATAAAAATATAGCTCCAAGTAATGTTACCGATGGAT
TGAAGACGAACACTACAAGAAATATGCTCATACTTGACGTTTTTTAAGACGACGTTGATG
AATTCGTCATAAATTTATGACGATTTCATCCAAAATCATCATAAACCGTTTGTGGGGATC
AAATCTACATATAAATTACGACAATGTGAGTCAAAATCGTCGTAACCGCATAAGATGAGA
TCGTCATAACTTTTAGGACGATTACAAAAATGTCGTAACATGTTCTAACCAATCAAAACT
CTTCCCACGGATCAATGACATGGCACCCATCCATCCATCCATCTATCTCACCATCTCACA
TCCATCCATCCATGTATTTACAGAAAAAAAGAAAACCCCAACCACAGCCCAAACCCTAGC
TCAGACCCTCCCTCCTCCCCATCTCCTCGCCGCCGCCACCTCCTCCCCGTCCCCGCCCCC
CTTCCGATCCTGTCCTTTCCCCGCCACTCCCACCAATCGCCCACCTCGCCATCCTCCTCA
CCCACCATTCCCCATTCAACATACCTCCATGTTCCCCATTCCCCTCCATTTTCTACCTCT
CCTTCAGGATCCAGATCCAGGAGAGCTCCCTCCCTCTCCTGCAGGATCCAGATCCAGGAA
CGCACCCTGAACCGTGCAACCGCCAGTCCGGGCGGAGCTTACCCCGATCCGATCAGATCC
CTCACCCCCCGCCCTCCTCAGATCTCCCCACGCGCTCGGATTTTTGACACAGAGGTTGGT
GGCACCGCGGTGCTGCTGCTGTTGCCGCTCGGTTGCTTTGACCAGCGGGAAGCCCATCTC
TTGTCGCGGTTGCTTGATCGAAATGTGATCTTCTTCCTGTTGCGCAGGTCCTGCCGGTGG
GGGTCCGCGTCTGGAAGCTCCTCGGCTGCTGCTGCTTCTTGCTTCGGGTGCTCAATAGCA
AACCCAGCCGGCAGAGATGGGGGTGGTGGGGGAGAAGTTCCAGTTGGGGACAGTGGGGGC
GCTCAGCCTCTCCGTGGTCTCCTCGGTCTTCATTGTCATCTGCAACAAGGCGCTCGTGAG
CGCCCTTGGCTTCATCTTAGGTATGGGATCCAATATCGCGCTCTCCAGATGTGCTCCACT
CCTTCTCTTTGCTACCAGCGCTTCGCCTCCCTGGTCGTATTCTCTGCATTCATTTCAGTC
TTAAGTCTTCTCCATGATTAGTGAAATATACTACTACTACCATTCAGGGTCGTTCATTGT
AAAGCCGTCACACTGCAAGGAATAGCGTCAATGATAACGTAACAAGTACTGCATTTTCTA
GGAGTATCAACTCTGGTAGCATCCCTAAAGTAATAAGTATAATATACTGTATTAGTAGCA
ACTTAGGCTGACTTGATAGCTGTGACTAGTGACTAATCTGTGCATGTTCCCACGAGAGAT
GCTGCAGTCCATTCACTTTACAGCTGCATTTATTTGAGACGAAACCAGCACTTTATCTTT
GCGGAAGAGATGGCTGACAGGGCTTCGATTGGAATTTTGTTCTGCAGGGGCTGCGGCTGT
ACGATGCAGACAAATCCATTCTCCGTCTGGAGGCGAATTCGGAGGCAGCACTTCTGGACT
GCTGCTTCAAGGACGAGTCTGTGGCATTTGCCGGCGGTTCGGATGGATGTGTAATAAGGT
ATCAACAAAATTAGTTGCAACACTCCACCAAGTCCATGTGCTTCGTCATCACAGAAACAT
AATGCTTGTAGCGTTTTTCTTTTCCAAATGCAGGGGCACCATCCTCTATTCTGACTAGAG
CTCCCTTCGAGGCTCCATGTTAACTCTAAGAGACAGAAGTAGAAATAAAATCTGATCCAT
CCAACTAGAAGATCTAATTGTATTGACGTGTTACACTTCATAAAGCCTGGTAGAATTCGT
TCAGAGTATGGCAGTAGGAATTGTCTTATTTACCTTTGTAATTATTTAAGGTAAACTATG
AAGTTAGAATAATTTCAGTTACATATCTATGTACTTTATTTCGACAGAAAAATTTAAGTA
TACAATGAAAATGAAAATAATTTAGACAAAGCTAATGTAATCCCATCTATGTCAGCTGCT
TGGCTTTATGGGTGGAATTCTGATAATACGATTTGTCTGAGTCACTTTTATGTGTTTGCT
TTTAGTTATGTGTTTAAGGTAAATATTGGGCAGATGAAAGTTGAAATTTAATGCTGAATG
CCAACTATTTGAGAGATGCATGCTAGGGGCATATATGATTCTAGACTCCTAAAACTTTTT
AGTCCCTTACATACTTTTGGCTAGCTCATGTCACACTGCAAGCAATTCAATAATGTGATA
TCTCAAACTACTTTACCATCTCTTACAGGCAAGGTGCATGGAGGTAGGCTAAGCTTCGTC
GTCTTCCATTGGACTGCCCCACTGCTGCCGGCGACGCTGTTTGGCATCGGCACGGTGAGC
TCCTCTCCCTCCTCTGCTCCGTGCCTTCTATCCCCAGTTGCTCTGATGATCCTCGTGGCC
TTCGAGCCACGGTCATGGTGTGGGTCTATGGCCTTCGTTCCATGGCTGTCTGGCAAAGTT
GTCAGAATCGTGATTCTGAAACGGATCGGAAAGTCTTCGGTAGAATCGAGTCGTAGAATC
GAAGATTCTACGCGATCCTACCAGTACAATACTTTTAGACATTTCCGTGTAAAATTTCAT
GAACAAATATGTTTTGTGAGCTACACAAAATCAAAATGGACGAGTTTTTGTAGTGAGCGT
CCATGTGCTTAAAATATATGTTTTTTGGTACAACTCACACCAAAAAAAATTCATCGTGAA
ATTATGTCGAGAGGTAGTGTACATATGTAAAAAATTAACATGGTAAAATTATATAGGATA
AGCTCATAAACAGAAGTAGAATTCAGCATAAACCATAGGTCTCCGACATATATGTTCATT
AAAGGGCATAGTCACAAATATGCTGGTTCAGCCTGAGCGGACAATAGTAAATAGTTCACT
AAGTTTTTTGTAGAATTGATTCACAGTTGTCTGGGTTTTACTCTAGTTTGCCAGCTGATC
TCCAACATGATCTTGGTCATTCTCTTCTATGGCATTTACTTCATGAGTATCAGTTGCTAT
CTGTTCTAACTTCCTCTTCTTTGCATCACTCTGTTCTTCCTGACATTGTAACAGCTTCAG
GAACATTGCTCGGACATCATCGGGTACTTTCGACAGATTGCCCTAAAATAAATAAAACGA
AAAATAAGAGTAGTGTTAATTAGGAAGTAAAGCACATAAGTAAGATAGCAGTCTAATTAC
TAGACTTTCTAGCCGATCATTAACAACAAGTCTAGCAATTAGTGACCAGCTAGATATTCT
ATTAATCGGCTTGTAGTGATCGGCTAGAAATTATAGTACAGAGACAATGGATGGATCGGA
TAGAATACAGTACAGAGACAATGGATGGATCGGATAGAATACTAGAAACAGTGATCAGCC
ATTAGCCGTATAATTACTAGAATTCTACTATCACGACTTCACAAGTAGTAGTAGCAGACT
TGTTGTATACATGCGCAAGCACAACCATTCACCCCACCCAGATCTGAGACTTTTTAATTT
AAAAAGTAGTATCAAGCTCGTGTATTACCTACGAAGTGGAGCACCTTTGTGATATTCTCG
TCAATCCCTTTCTTCATCCATATGCTTACCAGCTCGGATTGGATCTCAGCAATTCCTAGG
GCAGATTTAGATGAGAATACAGAGAGACGGAGAAACGGAGGCACAGCGCGGCGGCCACGA
AAGGATAACGATCCAGGAAGGAAAAGAGATAACTTATATAGGGCTTAGCGTATTGGATAT
CTACCGTTCATCTTTAGTACAAAGGCACGATTAGAGCTTGAGCTAGAGTCGTTCATGGTA
GCGACTCAGCATGCGATTTTACACGATCCTACGACTTGTAGCTAGACTCCACAGCGACTC
AACAAAAAACGACTATGCTTGCGTTGGGTCGTTTCCTACATGTAGGGTCGTAAAGTCTTG
TGATTTTAAGATCCGAGTCGCGATTCTGACAACTTTGCCGTCTGGTTAGACTGCCAGAGT
CCTTTCATAATCATCATGTCACTATTTGTTTTTAAGTTTTCTCGTTTTTCTGCTTACCAT
GCTAGCTAACACTAGCCTACCTGATGCAAACTTGCTGAATATATGTATGGGTAGTTCCTG
GTGGTCACTTATATTATCCAAGGGAGTAGTTTTGGTACTTAACGAATGGTGTTTCAGCTA
GCTTGCAACTCATCTAGCTACTCACTGTTATTGTTACCTAAAATAAAATTGCTTGGTGCT
GGATAGACATTGTTTTGCATGACGAAATCCTTTAGTTTGCGTATGATGGATGGGTGGTTC
CTACCCGTGGAGGTCCTTTATCAGCCTAGTTTTTTTTAGTACAAATTAATTTGTAGTGGC
TATCAATGCAATAGTGGCTATCAATTCAATAGCAAAAAATGCTTACAAATTAATTGGTGT
AGTGCTGCTGTGTACGCATACCCTATAGTTCATGCATGTCCTATAGTCCAGTGCGGTGGT
GAGTTGCGATCTCGTGCGGTGGTGGGTTGCGATCTCGTGCGGTGGTGGTAATGTAAAGCA
AGTTCCAGTCATAGTGTCTGTCTTTTTAATGGTCTGAAGGACATAAGTATGCTACCACCA
TCACAGGCTCACAACACATATTGTAGCTTTATTCTACTCTAAAAGAACCCAGAGAAGATT
AATCTGCAGCAGTTTTCTCGCCAACTTTGGTAACGAGAGTATATCTGTTACTTCATATTA
CTGAAGATCTGAACATTTTCTTTTATTTTTGCCTCATATTTTGTTTAAACTTACGCTACA
GTTTCACCTGAGATGATATTTTGTTCTTCGAAAGACTTTTTTTCAATTTAGCATTGCCAT
CTAGTTCCTGCGCCTAAACAATACATTATTTTGTTTGGATGCAGGTATACTAGAGCCCAT
AAAAGCTGGTATCAGGGATGCAAAACTAGGAGTGGGGAAGCAAGAGCAGGATGACTTCTT
CACAGCGAGTGCTAATTTCTGTATTTTCTTTTGAGATTCTTCTGGGTTGATGCTTCAGCT
GTGAAAATTGGTATCTGATTGTCAAGTGTGAATCAGATGAGTTATTGTATTATGTAAACC
TGGAGATGTATTATGTGATGTTATATTATGGATGATTTTAATTCGACTTGGAGTTTTCTT
GATTTGAATATGAAATAGTGCTGCATTTAATATTGGACAAATAATTGGTTGAAAAGGCCC
AATAATTAGAAATGAAACCAAGTTCTAGAAAAAAGTTGCTGAATTCAAAAATGAAAAAAG
GGCAAAACTGAAACTGGACCAAATGTATTTGGGCATGAAAAGGTCAGGGCTAAAAAAAAT
TCAAAAAAGAAAAACTAAAAGTGGCTATAAATGGGCTAAGGCCGAAACGAAGCCCAATAA
GAAAAAGCCCCAAAAAATAAAACCAGCCATATGATCAATTGAAATGGGTTGGGCTGATTT
CAACTATGATGTTTTGATTTCGTCGTAATTTTGCCACGTAGGACTGCCATGTAGGACTGG
GTTAGATTGTCAACGACGATTTAGGATCGTCGTAGAGGTTACGACGATCCATGAATCGTC
GTAAAAGTTACGACGATTTTGATCAAAACATCGTTGCTGTTCATTTCTAACGCTCCGTTT
TCGACGCTTGGTTTTTCGTCGTGAGATCGTCGTAAACTAAAAACCGTGACGATGTAGCGA
CGAAAATATAGCGTCGTGTATTAGCATATTCCTTGTAGTGGAAAGAGGGGATGCCTTCCC
GGGGCATCCCCAAGCTTGGGATTTTTGTTGTCCTTGAATTTGGCTTGGGATGCCTTGGGC
ATCCCCAAGCTTGAGCTCTTTCCACTCCTTATCTCTTTGTCCATGAGAACATCACCCAAA
ACTTGAAAACTTCACAACACAAAACTTAAACAGAAACTCGTGATAACATTAGCACAAGAA
AACAAACTACCACCTCTTTTGGTACTGTAGCAAACTTGAATTCTATCTATATTGGTGTTG
GGCTACTGTATTCTCACTTTTCCATGGCTAGTACCCCCCGGTACTAACCATAGTTTCATC
AAAACAAGCAACCAACTCAACGAAAACAGAATCTGTAAAAAACAAACCAGTTTGCAGCAA
TCTGTATACTTCGTATACTTCTGGTACCTCAAAAATTCTGAAAAATTACGACTGCCTGGT
CAAAAGGCATATAAACGAGAAGCAAAAAGAATCAACTCAAAAGCTCTTTCTGAATAAAAA
TGAACAATCATCTCGTGAGAGAAAAGTTTCTGTCTTTTTCCAGCAGGATCAAACAACCAT
CACCAAGACTAGTCATAAAGGTTTTGCTTGGCTCAAACACAAAAATAAACACAAAAAACA
CAATCACAACAGAATTATGATGGTGTGGACGCAACAAAACAAAAAGAAAAAAGATAAATT
TATTGGGTTGCCTCCCAACAAGCGCTATTGTTTAACGTCCTTAGCTCGGCATTGATAATT
CAATGATGCTCACATAAAAGACAAGAATTGAAGCACAATGAGAGCATCATAAAGCATGTG
AAAATCACATCTAAGTCTAACATACTTCCTATGCATAGGCATTTTATAGGAAAACAGATT
GTCAAGACAACCAATAGTTACCATATGCAAGGAAGAAGAAAGAGACAATAGCAATCTCAA
CATAACGAGGGGTGATTTAGTGATATGAAAGTTTCTACCATCATATTTTCCTCTCTCATA
ATAATTACATGTGGGATCATATTCGAATTCAACTATATAACTATCACATAGGATATTCTT
TTCATGATCCACATGCATGCAAAGTTGACGCTCTTCAAAAATAGTGGGATTATCATCAAC
TAAAGTCATGACTTCTCCAAACCCACTTTCAAAATTATTGCAAATATCATATTCATCATG
AGGCTTAAACAAATTTTTAAGATCATAAGAAAAATCATTACCCCAATCATTATCATTGCA
ACAAGTAGTGGACATAGCAAAACTAGCATCCCCAAGCTTATGGTTTTGCATATTTTTAGC
ATGATTGTCACTAATAGAATTTATAGTGAAACCATTGTAATCATGCTTTTTATCCAAGGA
GCCCTCGTGAATCACTTCATAAATTTCTTCCTCACAATTTTCAGAGTCATGCATCTCAAG
CAAAACTCCATAGAAATAGTCAAGTGCACTCAACTCACTAGCAATTGGATCAACATAATT
GGATCACTTAAAGAGATTAGCAAGTGGATGAGGATCCATATCACTAGATTTTCAGCAAGC
GAAGATGCAGGCATATTGAAGGCACATAGCACACAAGCGAACAGAAGGCAAGCGAAATAA
AAAGGGCAAACGAAAAAAAGGCAAATGAAAAATGCAAAGATTTGTGAAGTGGGGGAGAGG
AAAATGAGAGGCAACTCGCAAACAAAGTAAATGCAAGAGATGAGTTTGTGACACTTACTT
GGATGAGTTCTTGAATTGATCCTCCCCGGCAACGGTGCCAGAAATTCTTCTGCTACGGCA
ACAAAAGTCCTTCCCCAGCAACGACGCCAGAAATTCTTCTGCTACAACAACAAAAGTCCT
TCCCCGGCAACACCAGGAATTCTTATTGCTACTTCTCTTGTTTGCGTCGGTTTTTCCCTT
GAAGAGGAAAGGGTGATGCAGCACAGGAGCAGTAAGTATTTCCCTCAGTTTGAGAACCAA
GGTATCAATCCAGTAGGAGAATCTCGTCAAGTCCAGAGTACCTGCGCAAACACAAAAGAG
CTTGCACCCAACTCTATAAAGGGGTTTTCAATCCCTTCAAGATTGATTGCAAAGTGAGAT
CTGAAGGCGGAAAGTGCAACGAAGTAAAAAGAGTAAGGCTGAAAATATGGTGTGGATTAG
ACCCCGGGGCCATAGTGTTCACTAGAGGCTTCTCTCAGAATAGCAAATATCACGATGGGT
GAACAAATTACTGTCGAGCAATTGATAGAACCGCGCAAAGTCATGATGATATCTAAGGCA
ATGATCATACATATAGGCATCATCACGTCTGAGACAAGTAGACCGATACTTTCTGCATCT
ACTACTATTACTCCACACATCGACCGCTATCCAGCATGCATCTAGTGTATTGAGTTCATG
ACGAATAGAGTAACGCCTTAAGCAAGATGACATGATGTAGAGGGATAATCTCAAACCAAT
GATGAAAACCCCATCTTTTTACCCTTGATGACAACAACATGATGCGTGCCTCGCTACCCC
TTCTGTCACTAGGTGAGGTCACCGCACGGTATGAACCCAAAACCAAGCACTTCTCCCATT
GCAATAATCATAGATCTAGTTGGTCAAACAAAACCCACAACTCGAAGAGAATTACAAGGA
TATGAAATCATGTATAAGAGAGATAAGAAGAAACTCAAATAACATTCATAGATAATCTGA
TCATAAATCCACAATTCATCGGATCTCGACAAACACACCGCAAAAGAAGATTACATCGGA
TAGATCTCCATGAAGATCATGGAGAACTTTGTATTGAAGATCCAAGAGAGAGAAGAAGCC
ATCTAGCTACTAGCTATGGACCAGTAGGTCTATGGTGAACTCCTCACGCATCATCGGGGA
GGTCATGGTGTTGATGAAGAAGCCCTCCCTGTCCGAATCCCCCCTCCGGCAGGGCACCAG
ACGTGCCCCAGATGGGATCTTGCGAAGACAGAAGCTTGCGGCGGCGGAAAAGTACTTTCG
ATGATCTCCTGATTTTTTACGGAATTTTAGGGAATATATAGGCGCAAAACCTAGGGCAAA
GGAGCCTCAGGGAGCCCACAAGCCAAGGGGCCGCGGGCCCCCTCTGGCCGCGCCATGAGG
GATTGTGTGGTCCCTGGTGGCCCCCTGCCCTGATTCTCCGGCTCCCCGATCTTTTTCTGC
TCCGGAAAAAATCTTTTTGGCAGTTTCATTCCGTTTGGACTCCGTTCGAAATCCTCCTCT
AAAAGGGGTAAAAAACATGGAAAAAATAGGAACTGTCTCTTTGCACTGAGTTAATAAGTT
AGTCACAGAAAATATATAAAAGGCATGCAAAACATCCAAAGTTTGACAAGATAATAGCAT
GAAACCATCAAAAATTATTGATACGTTGGAAACGTATGAGTCCACCAGAAGGTCTGTTTC
AAGTCCTGATACATCTTGGAGCTTCCTGGATGTATTGAGAGCAGAGAGTTATGAGCTTCT
TCCATGATTACCTTTCTGAGATCACCTTTCGGAACGACAAGGCGATCCTCAAAGAACAAC
GTGTCTCTGGCATCAACACTGAAGCACTTATATTTGGGAAGTCCCTTTGCCTAGCCAATC
TTGACTTTCTTCACCATTGCATCAAGAAGCTGTGCTGCTCGGACCTGATCTTCCAAGGTA
GGAGAGATCTGAAGATTTGCAAGAAATCCCTGAGGTACTAACTCAAGGTTGAGCTTTCTG
AAAGATTCACAAAGGTCAGGCTGGAGAGGCTTCAGAATGAGACTGTTGCAATAAGCCTTC
CTGCTCAAGGCATCTGCCCCGACATTAGCTTTGCCTGGCGTGTACTCAACGCTCGGATTA
AAATCTTGGAGCATTTCCACCCAACGAGTTTGCCGGAGATTTAGGTTAGGCTGGGTGAAG
ATGTACTTGAGACTCTTGTGATCGGTGAACACTTCAACCTTTCGTTCCAACAAGAGGTGT
CTCCAAGTCATCAGAGCATGTACCACTGCTGCCAGCTCAAGATCATGCACAGGATAATTC
TTCTCCGCTGGCTGCAACTACCCGGAGGTATAAGCCACCACTTTCTTCTCTTGCATCAGA
ACTGCACCAAGACCTTGAAGAGAGGCGTCGCAGAACACGTGGTAAGGTTTGGAGTCATCA
GGAGGAACCAAGACTGGAGTAGAGGTGAGCTTCTCTTTGCGTGTGTCGAAGGCCAACTGA
CACTCTGGAGACCAGGCATACTTCACACCCTTTTGAAGAAGACTTGAGAGAGGCTTAGAA
ATCTTGGATAAGTTCTCAACGAAGCTTCTACAATAGCTTGCAAGCCCGAGAAAGCTTCGA
AGCTGCTTCACATTCTGCGGAGGCTCCCACTGAACAATGGTCTGCACCTTTTGACATATC
AACTTTGATGCCCTCGGCAGGGATGATGTGCCCAAGATTGACGACTTCTTTCAACCAGAA
CTCACATTTGGAAAACTTGGCATAGAATTTGTGCTCTCTTGACTTATCAAGCACCAGCCT
GAGATGTTCTTCATGTTCTTCCTCAGTTTTCGAAAAGACCAGAATATCGTCGAGATACAG
GAAGACGAACTCATTCTTGAACGAAGAGAATATGTAGTTCATCATTTGACAAAATGTCGG
TGGAGCATTTGCCAGACCAAAAGACATGACCGTATACTCATACGAGCCAAAACTAGTCCT
GAAAGCAGTCTTCGGAATATCCTCTTCGCAAATGCAAATTTGATGATAGCCCATTCTAAG
ATCGAGCTTGGAGAAGATCTTAGCTCCTTTCAACTGTTCGAACAACTCATTTATGTTCGG
AAGTGGATACTTGTTTCTGATTGTCTTCTTGTTCAATGGACGGTAATCGACACACAATCG
GTCCGTGCCATCCTTCTTCTTGACAAACATAACTCCACAGCCCCAAGGAGACGAGCTCGG
TCTGATCAGACCCAAACGCTCTTGCTCATCGAGTTGCCTCTTAAGTTCCTTCAGCTCTTC
TGGACCCAATTTGTTAGACGTTTGCACACAGCCTTAGTACCTGGTTCAAGCTCAATAACA
AATTCAATTTCTCGGTGCGGAGGCATTCCTGTCAGCTCTTCTGGAAACACATCTTCATAT
TCGCAGACCACTGGGACTTGCGAAATAGGATTAATCTCACCCTTTTCATTCAAAGATAAC
AGACGGATTGTGTCATCACGCGCCACGAAGATAATCACGTCCTCCGAAGAGTGAGTAAGC
TTCACAATCAATGGATGCCTTGTTCATGGCCAACCAGTCCATACCAAGGATCAAATCAAT
GTCGGAATTGCCCAAGACAATAGGAGATGCCAGAAAAGAATAACTACCCATCTTGACAGA
AACATCCGGAACAATCCAACGAGAACTCATAAGCATCCCCGGAGAAACAATGTCCAGAGA
CTTAGCCAAAAGTTTCAAAAAACGAAACCGCTATCTGTTGGCCAAACAAGTTGATGAATG
GATAGCGATGTTTCTTAGCAAGGACAGACAATGTCACAGCTGTTACAATGGCTTTATTGG
CGGCGACGACAACAATACTATTATTGTCGACTGTAGCCCTTGAGCGTACTAATTATCGGT
GCTAAAATGCTATCAAGTGTGCTTCCGTATAACCATCTGAAGATATCTTTTCTGACCAAT
ATCAATAAAAAAATGAGTCTAATCAGTTGTTGGGTAATCTATTTGGGCATGCGTGTGTGA
GAAGATTCGGCTCAAAGTTCATAACCCAGCTAGTCCTCTACCGGGTTCCTAGGTAGGCAG
CTAAGTGATGGTGGCAGCTAAGTGATGGTGGCAGCTAAGTTCATAGCTCTCATAGATAAT
ATCAGAGTTTACATCACACATTTATTCAGACAAGGTAGTTCCGTCACGGACTACATAACA
TGAGAAAAGGCTATGCTACCATGCATGTTTGTCCACGATCACGACCTTGCCTCAGTCTTC
TGGATAGTTCACGTACAAGCGGTCGTTCTCCTCATCGTACTGCCATGCCAGCTGCGTGCC
ATCGGGATCACCTGTGTCGGGCGTACCTGTACCTGTTGGGGTGTTGAAGTAATCTGTGAG
CCACAGGGACTCAGCAATCTATGACCTCGGTGCCAGAACTAGACAAGTTTTAGGTAGGGA
AGGTTCAATGTTTATGTTGCAGCATCCTAAGCATTTATGGTTGCTAATTTATGTAGAACA
AGTTATTAATGGTGGTCTATACTAGCGGGCGATGACTAGCTGATCAATAAGTGACCCTGA
ACACCTACCTACGTCAAACATAACCCCACCGTGTTCCCGATCGAAGAGAGGTCTTCGAAG
GGGACAGTCACGGTTACGCACACAGTTAGCAATTTTATTAGATTAGGTTCAAGTTATCTA
TAACCGGATGTTAACAAATATTCCAAGTTGCCACATAACCGCGGGCACGGCTTTCCGAAA
GATTAAACCCTGCAGGGGTGCTCCAACTAGTCCATCACAAACGGTCACGGGCCGCAAAGT
AATCCTCTATCACGAATCTCGTGATCTCGTCGGATTCCTTTGAGAAAAACCTCAACTCTG
GGGAGAACCAAAGCTTCGCCGGGATTCCTATACGCAAGATATATCGCTAAGGTAAGACAA
GACTAGCAGGACCTCCCGTCGTGTCGACGACCCTGATAAGAGCCGCGTATCTCAGTCTCA
GGACACGACGGATGAGTCACACTACGGGTATACCAAACCTCAGGTTGCCCTGTGGTGGCC
CCATAGTCTGCTCAATTTGGACCAACACTTATGAGGAGCACTGGCCCGGGTTGTTGATTA
ATTCCTCGGGGTAGCTATTCCCTATGCAGATTATTATTAAGTAATTAGCAAATTAACACC
AATGTTGGGTCCTGCCGGACAAGTTTTAACACTACAAGATTTATCAAGGGGGTCCCCATA
ACAACCCCGAACATGTTAGGAGCGATCAGTTATGGAATCAAACACCCGACAAGAGGCTAG
GCCTTCCGTCATTTACCAAGTATATAGGTGCATTAATTTAATAACAGATTTAGCATAATG
ATATCAAACACATGTTATCACATGAGACAATTGCACCTGCAACTAGCAACGCTAACATTA
GAAGCTGAGCAAGCCTACTTAGCCATTCAATATTTGCTAGGAGGCGAAAGTGTTTGGGTT
TCATGGCAATATCAGGAGGCAATTATTTCAGTGATAGGCAGCGAGCATATGATGAAGGAA
ACGTGAATCTAGGCATAACAAGTCTAGAGATGGAATCAAGGTCATGTCATCTTGTCTGTG
ATGTCTTCAGCTTGGAACTGCTCTTGTTCGTCCTGCACGTACTCTCCCGGATCCACGTAA
TCGCTCTCCGATCTCGTTGCTATCCAACATAAAAATAGCATCCAATGAACAACAGCACCA
CAATATGCAACAAACACATGATGCATGAGATGAGAATGAACATGCATCTCTATTCTAGTC
ACTTGCACATGCATGAGAAGAAAGTACAAACTTCTGGACAGAACTGCACTCTAAGCTATC
TTGACATGCATGTGGATGACATGAACGGATGTATCACACGAAAACGATGCAAAAACATAT
AAAGAACGTTACGAACGGAGCTATGGATCAACCGGAAACAACAAAACAAGAAATGGAGTT
CTACGGAACAAATCCATCACAACACACTCCAATGGCATACTTCTGGTATTCCCAGGTTGC
CAAATCACAAAACAAACAAGTATAGATGGGGTGGTGCAAAGAAACTCACAACACCATCAA
CTATGCACTCACAAACATCAAAACATCAAAACTATACAATCTATCCAAAACAGCATCATA
GCAGTTTGAGAGCTACATGCAAAGCACCTACAGCCATCCAAATGTGCCAAAAGGATATGT
GACAGAAACTATTCAAAAGCTCTACAAGCATGAGCAAAAATATAGTACAAAGGAGTTTCA
CACAGAAAGTTCTACAACTGCTAACATGGACAAAAATACCAGTTTTCAGGGACTTAGTGA
AAATCTCAGATTCTCACTAGCTGTTTATGCTCTGAAGCATTTTGATAGCACCCAAAACAA
TATCTATAGGAAGCCAAGTGGAATGAAAATTGACAGAGACCTATACAAACACGAAAGCTC
CAACTTTCGAGTTGAATGCAAGGGTTGATTCCCAACACATGAACATTTACAAGCACAACT
ACAAGGGAAGAAAATATCAGGAGTTTCTGAAATTTCAGCCACATGCCTACTTATACTAAG
CACCACTTGCACACATAAACTCCTAAACATGAAACAACAACACCATGTTGTAGAGGGGTT
CACCCTCTACTACCACAACACGGAATCCTCCTCTTGGGCCCATCACATCTCACATGGAAC
CAAGCTCTAAACATTGAACAAAACAGAAAATGACATTCCCAGAAAGTGTACCAAAGTGGA
ATCTGATTCCACCATTGGATTCCTGGGATGATTCTATCCCAAAAACATATATAATACCTA
GGTACTTACATAGAACAAAAGGGCACAAAGCTAAGAAGAAGAAATGCATGGAATCACAAA
GAGGTAAATAGTGATTTATCACATGTGACCCCACTAGCTCATCACCTCACATGCACTTGC
ACACACTCACATATCCAATGGTGCACATGAGGGGTAGACCTCATGTTCATGTGACTTAGC
ACACAAACACATACACACATCAAGCACCTACACATGCTAGTTAAAACACACACACACTAA
CTTACTCACTTCATGCATTCCTACACCTACACATACAAGCTTGCCATAAGTGCTAATCAA
GGCACACCAGGTGCCTTGAGCATGTGTGTGACACACACACACACACACATGCACACACAC
ACACACACACAACTCCACATGGAAATCTCACACTCACATGCACATATGACATACACCTAC
ACACTCCTTGGGTGCTTGCACCACACAAGCACACATGCATAGGAGTTGCACCACATAAAG
TCATATGCATAAGCACATCACAAACACAAAGTATGTGGGGGGGGGGAACCCACACACACA
CACACTTGCACAAGCTAGTGCATCACTCACTTATAAACACACACCACATACATCACTAGC
TCACAATACACATATGCACACAAAGCCTACACATGCATCACTACACATACTAGCAAAATA
ACTAGGCAACCTACTGGTAGGAGGCAAGCAAAATACCATACATGCTGCCCTAGCTCTCCA
CAGAAACTATCATGGCAAACAAAAGAAAAACCAGCAAAAGGAAAGGCAAAATAAAATAAA
AGGGCTTGGGGGATTCGAACCCAAGACTCCCTGGTTCACCACCAGGGACCAACACCACTG
CACTACACCACTCTGGTTCGACAGAAGGGATAGGGTAAACAGGTTATGCACTCAACTGAA
GCTACTGTGCCGAAATCCACAAAACAAAAGGGGTGGCGCCGCGGGGTTTCGAACCCACGA
CCACCTGATGCCACAAAACCGCCCTACCACTATGCTGTGCGTGGATCTTAACAGAGTAGA
GGAGGTTCTATTGAGCAACCCCTGTGGTCCTTCCTCTGCCTGACGGTGGCCGGAACAGGG
GAAGCACCTCGCCGGCGATATACGCCAAATTTCACTGCGGCTCGTCGATGGAAGGGAGAA
GGGGCTCCAGGGTTCCATTCCACTAGCTAACTCTACTCGAGGAGGCCTACATCTACCGCT
CAACGGTACGCGGCGGCGCCGACGATAGAGAGAAGAACACGGCGCGGCTACGGGTTCCTA
CTCTCGATCTGGCGATAGGGAAGGGGAAGGAAGAAGCTAGGTCACCCAATGGACGAGGAC
GCTGTGCCTGTCGGAGAGGAAGTAGAGGAAGGAATGGAAGAAGCCGCGGCGGAGGGGATC
GACGGAGAGGAAGCCGCTGTCGTCGAAGTAGGCGTAGCAGTGCAGATCTGCTCCTCCTAG
CTGCGGGAACGGGTTCCCTGGAGGTCCCGCATGCTCGCCGAAGGGTTGGAGAGGACGCAG
AGGCACGACAGCGGCGACGAGGACCTTCTCAAGTCACGGCCATGGCGGAGGAGCTCGCTC
TCTTACCTGCTGCCGACGAGGGAGAGGGAGGAGGAGATGGGGAAGGAGTGGCGGCGGCTA
GGGAGGAACCCTAGGCCTTGCACGGACGCCAAGGGTTATTTATGGAGGAGGAGGAGGCGA
GGGACGCGCGGCCTCGACGTCCGTGAGACGGTGTTGCTCGCTGGCGCGCTGTCTCTGAGG
GAGTCCGACGGAAAGCGACAGGGGAAGGGGACGCCATCTACAGGGAAAGGCTGGCGTGCG
GGAGGAAGTTGGGCCAGCTTGTGGGAGAAAGCCCACTCGCAGGTGCGAGATAAGAAAAGA
AAACCCACTGGGGTTTGCTAATTTCAAACAAACAGAGACAAGAAATAAAACATAGGCAAA
TCTGTTGAAGCTAAAAATAAAACAAAAATACCCCTGGTCATAAGGAATTATGACCTATTT
AAATAAAATATAAAAGGAATTTTTGGAGCATAAAAATATTTACAAAACATAATTTAGTTG
ATGTGTTTTGTGAATATTTGCACCACTAAAACATAGTTTCAAAACAACAAATACATAACA
TCACATCCACCACAATCATACTAAAACATGGGCATTTTTGAAACCGGAATGGAGCAAGAG
AATTTTGAGCTTGAGAAAATAGAGAAGGGGAGTTTTATAAAACCTATTGCAACTAACATA
GATGCTTCCTACTTACAATTGCACCACTCCAGAACACTTCACATAGAACCACATATCATC
ACATGTCATCACAACACATACACATGATCACATTAGCAACAACACAAGAGACATGGATGA
ATGGATGCATGAATGCAAAAGAAAACAAGGCGTGCACATGAAATACCACATGGAATATAA
CTCTCATTGCAAAGACAAGATGGTCTCACATACAGAAGGTTCCAAATAAGGCAAGTTACA
CTCTTGGGGCATTACAAACTCTGCCACACTACAAAAAGATCTCGCCCCGAGATCTAAGAC
TGAAAGAACTCTGGGAATTCAGAATGGAGGTGATCCTCGCGTTCCCAAGTGGCCTTTTTA
TCGGAATGGTGTGACCATTGCACCTTGAGAAATTTGAAAGTCTTGTTGCGGGTCTTGCGC
TCAGTCGCCTCGAGAACCACAATTGGATGCTCACGATAGGATAGGTCGGGTTGAAGGTCG
ATGTCTTGAAGATGAACAGTGTGCTTGGGAGTCTTGAAGCATCTCCGGAGCTGAGAGACA
TGGAACACGTCATGCACATTTGCAAAGTTTGACGGGAGCTCGAGCTGATATGCAAGGTCG
CCTCTCTTGCCAACAACTCTGAAAGGACCCACGAAACGAGGCACAAGCTTGGCTTTGATG
CCAAAGCGTTGTGTACCCTTCATAGGGGAGACCTTGAGATAGACGAAGTCATCGAGCTCA
TAAGACATGTCAAGATGCTTGCTATCATAATAGCTCTTCTGACGGGACTGCGCTGCTCTG
AGATTATCCCGAATGACCCGACACATCTCTTCAGCTTCTTCTATCAAGTCATTTCCAAGA
ATCTGACGCTCGCCGGTCTCGGACCAGTTGAGCGGGGTACGACACTTCCTTCCATAGAGA
ATTCAAACGAAGCTTTGCCTGAACTAGCTTAATAACTGTTGTTATACGAGAACTCAGCGA
AAGGCAGGCAGTCTTCCCACTTCATGCCCAAAGAGATAACACATGCTCTCAGCATATCCT
CAAGGACCTGATTGACTCTCTGCACTTGACCACTAGTCTGAGGATGAAAAGCTATGCTGA
AGCGTATCTTCGTGCCCATCGCAGACTGAAAAAAGTCCCAGAACTTGGAAGTGAAGATAC
TTGTGTGATCCGAAGAAATCATCATAGGCACGCCGTGCAAAGACACTATCCTGGAAGTGT
ACACCTCTGCAAGCTGAGCTGCGGAGATGGATTCCTTGACTGGAAGAAAATGAGCCACTT
TACTCAACTTGTCGATGACGACGAAGATGGCATGATTACCCTTCTTGGACTTCGGAAACC
CGGTGACGAAATCCATCTCAATATGGTCGAACTTCCACTCGGGAATGGGCAATGGATGCA
AAGACCCGCTGGACGTTGATGCTCTGCTTTCACCCTTCGACATACATCACATTCATTTAC
GAACTGAGCAATCTCACGCTTCATGCGAGTCCATGCTACGGCAACAAAAGTCCTTCCCCA
GCAACGCCAGGAATTCTTCTTGCTACTTCTCTTGTTTACGTCGGTTTTTCCCTTGAAGAC
GAAATGGCGATGCAGCACAGGAGCAGTAAGTATTTCCCTCAGTTTGAGAACCAAGGTATC
AATCCAGTAGGAGAATCTCGTCAAGTCCAGAGTACCTGCACAAACACAAAAGAGCTTGCA
CCCAACGCTATAAAGGGGTTGTCAATCCCTTCAAGATTGATTGCAAAGTGAGATCTGAAG
GCGGAAAGTGCAACGAAGTAAAAAGAGTAAGGCTGAAAATATGGTGTGGAGTAGACCCGG
GGGCCATAGTGTTCACTAGAGGCTTCTCTCAAAATAGCAAATTTCACGGTGGGTGAACAA
ATTACCGTCGATCAATTGATAGAACCGCGCAAAGTCATGACGATATCTAAGGCAATGATT
ATACATATAGGCATCACATCCGAGACAAGTAGACCGATACTTTCTGCATCTACTACTATT
ACTCCACACATCGACCGCTATCCAGCATGCATCTAGTGTATTGAGTTCATGGCGAACAGA
GTAACGCCTTAAGCAAGATGACATGATGTAGAGGGATAATCTCAAACCAATGATGAAAAC
CCCATCTTTTTACCCTTGATGGCAACAACACGATGCGTGCCTCGCTACCCCTTCTGTCAC
TGGGTGAGGTCACCGCACGGTATGAACCCAAAACCAAGCACTTCTCCCATTGCAAGAATC
ATAGATCTAGTGGGCCAAACAAAACCCACAACTCGAAGAGAATTACAAGGATATGAAATC
ATGCATAAGAGAGATCAGAAGAAACTCAAATAAGATTCATAGATAATCTGATCATAAATC
CACAATTCATCGGATCTCGACAAACACACCGCAAAAGAAGATTACATCGGATAGATCTCC
ATGAAGATCATGGAGAACTTTGTATTGAAGATCCAAGAGAGAGAAGAAGCCATCTAGCTA
CTAGCTATGCACCCGTAGGTCTATGGTGAACTACTCACGCATCATTGGATAGGTCATGGT
GTTGATGAAGAAGCCCTCCGTGTCCGAATCCCCCCTCCGACAGGGCACCAGAACATGCCC
CAGATGGGATCTTGCGGAGACAGAAGCTTGCGGTGGCGAAAAAGTACTTTCGATGATCTC
CTTATTTTTTATGGAATTTTAGGGAATATATAGGCGCAAAACTTAGAGAAAAGGAGCCTC
AGGGAGCCCACAAGCCAGGGGGCTGTGGGCCCCCCTGGCCGCGCCATGAGGGCTTGTGGG
GTCCCTGGTGGCCCCGTGCCCCGATTCTCCGCCTCCCCGATCTTTTTCTGTTCCGGAAAA
AATCTTTTTGGCAGTTTCATTCCGTTTGGACTCCGTTCAAAATCCTCCTCTGAAAGGGGT
CAAAAACATGGAAAAAGCTCTTGGCACTGAGTTAATAAGTTAGTCCCAAAAAATATATAA
AAGGCATGCAAAACATCCAAAGTTTGACAAGATAATAGCATGAAACCATCAAAAATTATA
GATACGTTGGAAACGTATCAAGCATCCCCAAGCTTAACTCCTGCTCGTTCTCGAGTGGGG
AAGTGATAAAGAATGAATTTTTGATGTGGAATGCTACTTAGCATAGTTGTCCTTTGCAAC
TTCTTTCACGTGACGTGAATGTTCAGATCCGTAAGATTCGAAACAATAGTTTGCTATTGA
CATGAAAACAATAATACTTCAAGCAAACTAGCAAAGTAATCATGAACTTTCAAAATAACA
AGGCCAAGGAAAGTTATCCCTACAAAATCATATAGTGTGGCTATGCCCCGTCATCCTCAC
ACAACTAATGTAAATCATGCACAACCCCGATATTGGCCAAGTAATTGCTTTCACACTCTT
ACTTTCTCAAACTTTTTATAACTATCACGCAAATACATGAGCGCGAGCCATGGATATAGC
ACTATAAGTGGAATAGAGTGTGGTGGTGGTTGTGAGACAAAAAGGAGGAGATGGTCACAT
TGACTCGGTGTATCAAAGGGCTATGGAGATGCCCATTAATAGATATCAATGTGAATGAGT
AGGGATTGCCATACAAGAGATGCACTAGAGCTATAAGTATGTGAAAGCTCAAAAGGAGAA
CTAGTGGGTGTGCATCCAACTTGCTTGCTCACGAAGACCTAGGGCAATTTTGAGGAAGCC
CATCATTGGAATATACAAGCCAAGTTATATAATGAAGATTCCCACTAGCATATGGTAGTG
CCAAAGCAAGAAGCTCTCAATCATGAAGAACATGGTGCTATTATGAAGCACAAGTGTGGA
AAAAGATAGTAGCATTGTCCCTTCTCTCTTTTTCTCTCCTTTTTTTTATTTTTTTATTTG
GGCACTTGGCCCTCTTTTTTCTATTTTTTTTATTTGGGCTCTTTGGCCTCTTTTTTCTCC
TCACATGGGACAATGCTCTAATAATGATGATCATCACACTTTTATTTACTCACAGCTCAA
AGCTCAAAATAATGATGACTCTATAGAAAATGCCTCCGGCAGTGTACCGGGATGTACAAC
GATCTAGCATGGCGTATGACGTTGAAAACATCTCGCTGGCTATCTTACGATCATGCAATG
ACAATATGAGAGTGACGGCACAAGTCATGAGACAGAACGGTGGGAGTTGGATGGCAATAT
ATCTCGGAATGGCTATGAAAATGCCATAGTAGGTAGGTATGTTGGCTGTTTTGAGGAAGG
CATATGGTAGGTTTGTGCACCGGTGAGAATTGCGCAGCACTAAAGAGGCTAGCAAAGGTG
GAAGGGGAAAGTGCATCTATACCATGGACTCACATTAGTCATGAAGAACTCACATAGTTG
TTGCAAAAGTTTTTATTAGTAATCAAAACAAAGTGCTAAACGCATACTCCGAGGGGAAGG
GTTGGTAGGTGTTAACCATCGCGCGATCCCGACCTCAATACAACGGATGACAATCAATAG
ATCAATTATGCTCTGACTTTCTAACATAGCGGTTCACCATACGTGCATGCTATGGGAATC
ACTAACTTCAACACAAGTATTTCTAGATTCACAACACCCTACTAACATAGCTCTTAATAT
TACCAAATCCACGTCTCAAAACTAATTGAGAGGAATCAAGACTTCTCTTTCTACTCAATG
CACATGAAGATGGAGGTTTTTGTATCCTGTTTGGGTACCTATCACCTTTGAGACTACTTT
CATAGCATAAGCCAACTACCAAGTCACGCACCGCCGTGCTCTATAAGATATAAGTGAAGC
ACATAGAGCAAAGTATCTAGCTCAAAAGATATAAGTGAAGCACTAGGAGCATTCTAGCAA
AATCACGATTAGTGCATGTCTCTCTCTCTCTCAAAAAGGTGTGCAGCAAGGATGATTGTG
ACACAACAAAAAGAAAAGACTCCTAAGATACAAGACACTCCAAGCAAAACACATATCATG
TGGTGAATAAAAATATAGCTCCAAGTAATGTTACCGATGGATTGAAGACGAACACTACAA
GAAATATGCTCATACTTGACGTTTTTTAAGACGACGTTGATGAATTCGTCATAAATTTAT
GACGATTTCATCCACAATCATCATAAACCGTTTGTGGGGATCAAATCTACATATAAATTA
CGACAATGTGAGTCAAAATCGTCGTAACCGCATAAGATGAGATCGTCATAACTTTTAGGA
CGATTACAAAAATGTCGTAACATGTTCTAACCAATCAAAACTCTTCCCACGGATCAATGA
CATGGCACCCATCCATCCATCCATCTATCTCACCATCTCACATCCATCCATCCATGTATT
TACAGAAAAAAAGAWGAAYSYNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGCTCCTTCTCCTTCTCCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTTCTC
CTTCTCCCTCTCCTCCTTCTTCTTCTCCTCCTCCTTCTCCTTCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCCTCCTTCTTCC
TCCTTCTTCCTCCTTCTTCCTCCTCCTTCTCCTCCTTCTTCTCCTTCTTCTCCTTCTTCT
TCTCCTCCTCCTCTCTCTCCTCCTTCTCCTTCTCCTCATTTTTCCTCTTCCTTCCTTTCA
TTTTTCCTCTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCT
CACGCGCTCGTTCCTTTGCTGCTGCTGCCGCCAGCGACTCCATCCCGTTCACCGCGTACA
CGGTCGACGGGAGAGCAGGCCTCAGAAACCCCGCCTCTCCGGTTCCTGTACAGGAGAGGG
CGATTAGGTTTTTGACGAGCGATCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTCGTTTATCCCACTCTTGTTCGTTTCAATCCTAGCAGT
ACTACTTGCATGCATAGATGTATCAACTATATGTGTAGTATGTGCTACATTAGTTCATGA
TCAGTATGTCATTAGTCTAGTCAATGTCATGCTAGTTATTATATTGTGGATTAATCTACT
CGGAAAATTACCTATTTTCTCAACACTTTAGAGTGTAGATTCACTCATTTTGTTTTGTAT
GTAGTCCACTAGTAAAATCTCTTAAAAGACTTATATTTAAAAATAGAGGGAGTAACTACC
ATCTTATCCAAATGGACATATGAGGTGGTGTTTCTTTCCAAGGGACTAGACTTTTTTAGT
CCCAGGGACTAAAGAAAAAAGTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCCCTCCAATAGAGACTTTTTCTAATCCCTT
AAAGAAAAGTCCCTCCTGTTTCTTTACCTAGGAACTAGAAGGGACTTTTTAGTCTAGTCC
CTAGGTAAAGAAACACCACCTGAGCTTTGTCCACTCCCGAGGTAGGACTAAAATCCCACA
GGCATGCATGGATGCACCCACCATTGTCCAACAGCCAGGGTTCGCACATGTATCTAGGCT
AGGGATGGCAATGGGTACCCATTACCCATGTACCATGCGGGTAAAACCCCTATTAGGGTA
AGGGTACGTGACAAAAATTTATCCATGGGTATATAAATAGGAAAATCTGAAACCCATCGG
GTAGAGCGGGTATGGGTATGGGATCATATAACCCATACCCATATACCCATGTACCCATAT
GAAATCTATGTAAACTCAAAATTATCTCTACAATCTACACGATGTCAATAATTTATGAAT
TGAAAGTGTATGCCTATGTGTTGTTGTTTATGACTATATGATGTTGTTTTATAAGTATCT
ATAGTAGTTATAATCTATCTTTGTAAACTATATGATACTATGCAGTTTATAACTATAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAAGGGATGAACAAGTCT
CCCGGCGAGTTGTTTGCGATGCTGAAAGTCGCAGAGTCTGAACTCCGTAAAGAGCATCAA
GTGTTGATGGTGAGCAAGACCACTAGTTTCAAGAGAAACGGCAAAGGCAAGAAGGGCAAT
TCGAAGAAGAGCGGCAAACCTGTTGCCAATCCGCCGAAGAAACCCAAGGCTGGACCTAAG
CCTGAAACGGAGTGCTACTATTGCAAGGGTATGGGTCACTGGAAGCGCAATTGCCCCAAG
TATCTGGCAGATAAGAAGGCGGGCAAAGAAAAATCAGGTATATTTGATATACATGTTATT
GATGTGTACTTAACCGGCTCTCGTAGTAGTGCCTGGGTATTCGATACCGGTTCTGTTGCT
CATATTTGCAACTCGAAACAGGAACTGCAGAATAGGCGAAGGCTGGCGAAAGATGAAGTG
ACGATGCGCGTAGGAAATGATTCCAAGGTTGATGCAATTGCCGTCGGCACAGTGTCACTT
CAGTTACCGTCAGGATTAGTGATGAACTTAAATCATTGTTACTTAGTGCCTGCGTTGAGC
ATGAACATTATATCTGGATCTTGTTTATTGCGAGACTGTTACTCTTTTAAGTCAGAGAAT
AATGGTTGTTCTATTTCTATGAGTAACATCTTTTATGGTCATGCACCGAATGTGAGAGGA
TTGTTCATGTTGAATCTTGATAGCGATACGCATATACATAACATTGAGACCAAAAGAGTT
AGAGTTAACAATGATAGCGCCATATTTTTGTGGCACTGCCGCTTAGGTCATATTGGTGAT
GGACTTTTGGAGTCACTTGACTTTGATTCACTTGACACGTGCGAACCATGCCTCATGGGC
AAGATGACTAAAACTCCGTTCTCAGGAACAATGGAGCGTGCAAGTGACNNNNNNNNNNNN
NNNNNNNNNNNNACTCCGTTCTCCGGAACAATGCAGCGTGCGAGTGACTTGTTGGAAATC
ATACATACCGATGTGTGTGGTCCAATGAGCGTAGAGGCACGCGGCGGATATCGTTATTTT
CTCACCTTCACTGACGATTTAAGTAGATATGGTTATGTCTACTTGATGAAGCACAAGTCT
GAAACATTTGAAAAGTTCAAGCAATTTCAGAGTGAAGTGGAAAATCATCGTAACAAGAAG
ATCAAGTTCCTACGGTCTGATCGTGGGGGTGAATATCTGAGTTTCGAGTTTGGTGCTCAC
TTAAGACAATGTCGAATTGTTTCACAGTTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACCTCATCGAAGAGAACGACCAGCTCCTCCACCTCGTCGTCAGATGTG
TCATCGTCGGAGTCGTCGTCTGGCCTGAGCACCCATGGATTGCGATTCTCCCAGTAGGCG
GTGTTGATGGGGGCTGGGAGAGCAAGGACGACGTCGGTGACGTGCTCCGCCCTTTATGCA
ACGCGCGCAAGATCCTCGCATGCCGGCGGCGTGGTGGATGAGTGGTACATCCACCAACGA
GCTCGCTGCCTGGGGTCGGGGGAGAGCTGCGTGTCGGGCATCNNNNNNNNCAACGAGCTC
GCTGCCGGGGGTCGGGGGAGAGCTGCGTCTCGCGCATCGCCCACAACAGAACGGTCGGCG
GCGGGATGTTGAAGCCGGCAGGGAAGGCATGCTTCTTTTCAGCAGCGGTCATGACCTTCA
GAAGGCTGCGGGCGTGGTTCCGCATCATCTACACATTGGGGAACCAGCGTGCTATCTCCC
AGTACTGGGCACACAGCTGCTGGTTGTTGTGGGCGAGGTCTTCGACGGCCTTCTGCCAGC
CCAGGCTGCCGTCCATTGCTGATTTCGACAGGAGAGAGGGGGGAGGGGATTGGGGGTGCG
AGTGGAGAGTGGGTCGAGACAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCGAGACAGAGGTTGGCGGACACGTTTTAATGCCTTAGAATCCGAAACGACAGCAGCGAG
TGGCGAGTGGGTCGAGACTTTGGTTGGCGAACCTGTTTTAATAACTAGGATGGCCGATGA
TAGTGAAACAAATCACTTGACTTATCCCACTGGCATTGAACTTAGGGTTACAACCCACAG
GTCCTGGGTTCGAGCCCGAGGCCAAACAATTTTTGTTTCTTTTTTGTGGTTTTACAAAAT
GAAGTTGACTTTAACCTCAAACATGACTGTAAATAAAAACCCTAAACTCTTGGTTTAGGG
TTTATTTATATGAACATTTCTGAACATGCAACAAACATGACTGTAAATGAAACACAAACA
TGCACTTGCCACTGAAACAAATTTAGTACAATACATTGAATGTAAATAAATCACAAACAT
GCACCGCCAGTGGAACAAATTCAGTACAAACACAATCTTAGTACCAAATCACAATCTTAG
TTCAATTTAGCAAATCAATGGTTTCCACTTGCACTGAAATAGGCTGCAAACTTGCTAGTA
GGTCTCCTCTTCCTCTTGCTTGTTAATATCACAGCTTGTCCAGTGGATGTTCTAGGTGCA
TTGAATCTTCTAACTGCATTTGCAGCTCTTGTTGATGTTGATCCTCTTGGAGGTGCTGGT
GAAGACTTGGCTGGTCCTGTTGAAACTGTTGAAACTGTCGATGCTGATCTTCTTGGAGGT
GCTGCTGTTTTTCTGGTTCTCATTATTTTAGGACCAAGTGGTGGAGCAGATGAGGCTAGG
ATGTGTGAACTTTGGTGTTGTTGTGGTGGTTCTGGAGGTACTTGTGTAGCACTAGAGGAA
CCACTGAATATTTCTCTATTTTCCTGCATGCCAAAATTAAAATAGTTAGTGATTAGACCA
CACCTAAAATAATGAAACATATAATGCAAATTTTTGTAAACATACAAAAGAGTTAAATGA
CCTGGTGTAAGTTCTTTCTCATCTGCAGACTTGGTTTCAGAGCTTTCCCACAGTTTGTAA
ATCTATGGCCTTGTAGACCACAATTGTTGCATGTAATTGTTACCATCCTACTTGTTTTCT
TTGGTGCAGGCACCTCAAATTGCCCCTTCCTCCTAGCTGTCTGTTTATTGCCTGCTTTTT
GTTTGAACACTGGGGGCTTAATATCATAGGTTTGGGTGTCAGGCCAGAATTCAGGACCAG
GGATAGCGTACACAATGTCTTTGTATGCTTCAATATATAGTGTTTTTTTGAAAAATTCAT
GCACAAAGTCCTTTGGGTGCATATGAACCTTGCTCATAGCTGCTATTGCATGACTGCATG
TCACACCTGTCATGTCCCACCTCCTGCAGTCACATGATTTAGTAGCAATGTTCACACAGT
ACTGTTTCTCACCACTTGACACTTGCCAAATGTCAGGACCAGCCCTATGTTCCTCACAAT
ATTTGGCATACTTCTTATTCTCCTCCAGTTTCTCTGAATAGTTGGGTGTGATCGTCCACC
TGCTGTACTCTGTCTTTTCCCTAGTCTTTTGCCTTTTGATCATCTGCTTAGTCCTAATTC
CTTCAAACATTGTCCTAATTGGTTTGGCCCTAACATCAAGGATCGTTTTGTTGAAAACCT
CACCAAGGTTGTTCACAACAAGATCAGTTTTGCAATTATAATCCATTGCATACCTACACC
AAGTCTCCTTTTTTCTCAAGCCAGTTCCAAGCACGCTCANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGTCG
ACTAGGGTTTGGGGCTCCCGTCTCGTGAGGGAGACGACAACAGAATACTATTTATTGTCT
GCTTAATATCGAAGGGGTACATGTGTTTATAAAGGAGGACAACCTCCACTAAACCCTAGA
TAACTTGGACTCTAATATAATTTGGACTCTAATATAACTTGGACTCTAAGATCTAATATA
ACTTGGACTCTAAGATCTAAGATAACTTGGGCTAAGCCCGTAACTAACCCTGGCCATTGG
GCCTCCTCCATTGGTACGTTGTACCGGTCATAACACCCACTATCAAAAATAAGGAATGGA
TTTGTACAATAATCAGTTGGTACTTTCTTTTAATTTGAGTTTCATAATTTGGACGGTGTT
TTTTTCTCAATTGAACTATGGTTGTTATTGTTGTTCCATGCATTTGTTAATCACTATTGT
CCCACCTTATGTTACTTGACAATATTGCAAAGCATATGTGTTGGTGGAGCTATTTGAATG
ACTATGATTTTACCTTGTTTACTATTTTTCTATTGATACTTGATAATACCATTTGGATAG
AAAATTCATATGTGATTAGTAAGTTTGTATTTAGATTTTCGATTATATTTCATTTGTTTC
CTCAAAGATTTATTTCACAAGGTAATCTCATTTGCAAGAGACCTACTCATCGCCTCCAAA
CATTTGTCTCTCTGTAAGTAATAAACTGGTTAGAAATTTTTGATTTGTGGTATGGTTAGG
AGGTCAACATTATTTTTTGTATGATAGTATTATCCAATAATGGGAAAATGACACTTTTTT
CATTACCAGATATGTTGTCTTACCATTAACTATACTAAATCTGAAATAATGTTAATTGGC
GTTTCAAGTACTCCACTACCTGCTAGCTTTTGGAGAGGAAATTATAACTGACCAAATTTG
CGTACTTTTTGAAAATTTCCATGGTAACAAGGGATCATGTTCGTAGCTACAGCCCGGAGC
TAGAAAAGAAGTACCTTCATATTTTATTTGATGTCTTGACTATTGCAAATATTGGCATTC
AGTCAATGTTCTAGGCTACTTGCATACAAGGTCTTGCTTTTTAGAGTGGTTTTGTACTAG
GAAATGACCTACTATCACATAAAATATTTTGACATGCCTTCACTAAACTAACTCCTTACC
TTCTAATACCGCAATTTTTTTTTTGAAAAAATGCAGGGTGTTGTTTGTCACGTGTGATAC
ACAACTACTTTGAGATTTCTAATTCAACTCATGTCTGCCTCGGCATAAAGTTCTATGCCA
GTGCCCTTTCCAATTTATTCTCAATTTAAAGATAATGGGTAAAGTAGCTCCCTTATGTAC
AGTGTATTACGTTGGCCATATTGTTATTGCTTGTATATTGTCACTTTATTATGGACCAAC
TATTTACATTATTGTATTTTTCACTGAATGTAGTGTGGAGTGTACATATTGTACTACCGT
TGTTTATATATACATAATTATACTACATAGGTTTTCCAAATATTTATATTATTCTTTTAT
CATAATGGGTGACTGAACTTACATTTGTAGATATATGGATCACAGTGTTATCCTCCCACA
TTGTTCGTCCTAAAAGTACTACTCTCATTGTTTTATGGAATCATATATACTATTGCAATT
CCTACCATTCTATTGGTAAAATCGACGGGCGCAACAACGCGCGCCACCAATGATCTAGTG
AGACGATAGGAGAGGAGGGGAGGAGAAGGTGGAGGAACGCTCCCCAACCGGCCGCTGGGA
GGCGACGGCGGAGGGGTGGGAGAACACAGAGACGAAATGAGAAGGCCTGCTGCTGCTGGG
CTGGGCCTTCCGTGGGCCACCTCGGCCTAAAAAAATCTCTCAAAAAACAAATGTGTATAA
AAAATCCTTCAAAAATACCATGGGCTCCCATTTAAAAAAAACTCTTTCAAAAAGAAAAAT
AAACCTCAAAGAAATCTTTCAAACAACAAATTATCTAAAAAAATCTTTCAAAAACAAACT
GAATGTTTGAAAAGTTTGATTTTTTTAATGTTCACAATACGTATTTGTAATCTCTAAAAA
AATGAATTTCAAAATACACATGGAGAAACAAAAAAGGCAAATCGCATGTGTATTTTGTGT
TTGGATTTGAATTGCTATTACGGATTGTAAACACACATGTTGAGAACATTCAAAAGAGAG
AGAAAAATAGGAACATTGGAGCATTTAAGTGGTGGGACCACTTGAATCCAACATTGGCGA
TCTCTACATTCCTCCATTTATTTTTATGTTCATCTATGTTTGAGTGATTCATTCAGTTCT
AGGTCAAGGTATGATCTAGTATGCATAATTAATCTTTACTAGAAGGGTTAGGCGGGCTTT
GCTGTGTCGTTGATGTTGTCGGGTTTGCTTTTATTTTACTCCCTCTATTTTAAAATATAT
GGTGTATTTGTTTTTAGAAAAGTAAAAACTCTTTTAAGTTTGATCAAATATGTAGAGGAA
TATATCAATATTCATAACATCAAATCAGGATCATTGGATTCATCATTAAATAAATTTCCA
TACTTTATTTATTAGTACACCATCCATACATTTTTTGACATTGTCTATGCCAAAAAATAT
CTTATATTTATATTAAGGTAGAGAGATAGTATTGTGAATGTTGATATTTTTTGCTCTGAA
CTTTGTCAAAGTATAGGAAATTGGATTTTTCAAACACTTAACATTTTGGAATTGAGGGAA
TGTTTGGTTTGGTGAGTGGGCGAGATGATGAAGTATGGTTTTTCTTTACTTGGTGTGGTG
TTTTGGTTGGTCTTCTGTGGTGCGATTCTGTGTTATCTGCCAACCAATCCATATTTAGGT
GAGGAAATTATCTGCATCAGGAACTACATGTACTATATTGGTGCTACAATTTACATGTTG
GCACTACTTTTCTCTAGATGGTGAGAGGGTGCACTCGGTTAATATATTTTAATGGTATGT
TGCTGCCGATTGATTTGAGTAATTAATTGTTGATCCCGTCAAAATGTGAACCAAATTCAA
AATTGTATATGTCCATCAAATGTGAGAGCTCCAAAATTAGGAAGTATTTGAACTAAAAGT
ATTGAAAGAGAATGCTCATTGAGAGATTGTTGACCCCGTTAAAATCGGACGGCCCAATTT
TGAATTTCAATTAATTGTGAAGATTTAAAAATTAGAAAACATAGTGCATTATATAAGAAA
ATGAGGGAGCTTTGAAAAGTTGTTGACCCTGTCAAAATTGGATGACCAAATTTCAATCAG
AGACCTCAATTTGTTGTGAGGCCTCCAATCCTAGGGAGCTTAGTGACATAATATAGTATA
CGACATCATCTAGTGTTTACTCTTGTGGTGTTCTACATATGATCGTGTGAGCACTTGCAC
TTACATAGACTGGATAGATGAAATTTGTGTGATCCTTTGGTTCGTTGTGTATTATTGGTA
CCCCGTGTGACCTTGGTGCGAGGTTATGTCTAATACGCCTATGGAAATGACAGTCCACGG
ATCAAAATCGAAAGAGATCGTTTAGTATTTTAAGAAATCTTTCCTTATTCTTAGAATAAT
TTTTATGCTCTTTTGAGGCATTACTCCGTGTAATACGAGCTAGTATGTCGCTGCCACTTA
GTCGCCCCTCTAGTATTAGTCAGACCGAAAGCCTAGACATAGTCTTTCGCTTTATCCGTT
ACAAGCCTCTGTTACTGTATATTCTAGCTTAGTTCATCATACGTCTTAATTGTAGTTTCC
TTAAAGAAAACCTTCAGTTATCACTTTCCTACCAACCGATGGAATAGAATATATTGATCA
GAGTTTAAGCTCAGCGATTGTTGGCATCTGTCGTACTTATTGAGGTCTTTAATATCCTTT
ACGTGTATAAGTTATATTCTTGGCATCGGTGGTCTGCATGCTAGGCCCGGGAAACCACGA
ATTTTCTCACATTTCACCATGTGATCTATTTCTTGCTGCTCTTTCACTTACTTATAGGCA
CGCAATGCATATTGGGATGATTACAAAAATACATCGAATAATTTAACTTCTTCATATTGT
CAAGACTAGACACTCTTCACCATACACCAACGCAAGGTGGTTTGTATGCACAAGATTTGG
AGGAGAAAGCAATAGAGGTGAGTGCGAGTACTTGAGCAGTCCAAGCGATGTGTGTATTGC
AAGGCTACATGTCCACATGTCTTCGCTTTTGCTTCGGTAGCCCCCTCCCAAATAAAAGTT
TTAAAAAAATCGATGCAAATCAATGTAGAGATTAGAACAAACCTTATGTTGTAAATCTCA
AAGCGGTTGCTCCCTTTCCACCAATTCCTCTCATTCTGGAATCATGCATGGGTTAGCTAT
TCAGCCAAAATTAACATCTCCAAGGGTTCATGGGAGTCTTAAAGAAATATGTCCCCCTTC
GAGAGGTTCATGGGAGTCTTAAAGAAATATGTTCGTAACCGTGCTAGGCCAGAAGGAAGC
ATCTCCAAGGGCTATGGAACAGAGGAGGTCATTGAGTTTTGTGTGGACTTTCTTCCTGAC
CTTAAGCCGATTGGTGTTCCTGAATCTCGGTATGAGGGTAGGCTGACAAGAAAAAGGCAC
ACTAGGAAGGAAAGCAAAAGTATGTATGGACGGGCATTCTTTCTCTCAAGCACACTACAC
AGTTCTACACAATTCCATCGTGGTGGCTCCGTATATCGTGAGACACAAGAATATTCTACG
CTCCGAAAACCCGGGGAAGGCTGACTCTTGGATTAAATGGGAACACGAGAAGACTTTCAG
CAGTTGGTTGCGGACACATCTCATGAATGACGACACCGTTGGAGATGATCTGTACTATTT
GGCCAGGCCACCATCTTCGACTATATGTACTTTCCAAGGGTATGAGATAAATGGGAATAC
ATTTTACACGGTTGCCTAAGATAAAAAGAGCACCAACCAAAATAGTGGTGTCCGTTTTGA
TGCAACAGACGAGAATGGGCACTGTTTGGAAACATATTACGGGTACATAGAGGAGATATG
GAAACTTGACTATAGACCTACTTTTAAGATCCCTTTGTTTCGGTGCAAATGGATGAAGCT
GACAGGAGGCGGGGTAGTTGTAGACCAAAAGTACGGCATGACAACAGTGGATCTCAACAA
TCTTGCGTACATGGACGAACCATTTGTCCTAGCCAATGATGTCGCTCAGGTTTTCTAAGT
GAAGGACATGTCTACAAAAACGAGAAAAATAAATCAGCAAAAGAAGATATCGTCCGATGA
GCCAAAACGCCACATAGTTCTTTCAGGGAAAAGAAACATCGTGGGAGTAGATGACAAGAC
AGACATGTCACTAGATTATAATAAGTTTCATGAAATTCCGCCCTTCAAAGTGAAAACTGA
CCCAAGCATCCTACTAAATGATGAAGATTCTCCATGGCTACGACCCAGAAGAAAACAGAA
ATAATAGATAGGAATATTGGTGCAATAATGTAATAATGTATTAAACCTTTTATGTAATGC
ATGTATGGAATGAACTAAACCTTTTAGTTTTAAATTATTTATTCAATTTCAAACACTTTT
CATTTTCATAGTTTTGTCAAATTCTCAAATATGCAAAAAGAATTTTAATAAACCTTTGTA
AGAGATGAGTTGTCGTTCGAAACCCTGATACTTCGAGAGAGATTGTCCGTTTTGTACACG
AAGTACATCCAGTTTTTGTCGTAGCCCTCTCAACTTTTTAACACATGCTATGTGGGTGAA
ATGATGATAACATGCCAACTTTCAACATTTTCAGAGTTCATTTGTAGTGTTTTTTAATTT
TAGGGTCAACTAGCCCAAAAAAAACAAAAGTAAATGCACGAAGAATACCAAATTAAGTCA
GAAATTGTTGAAAATTTGTGATGTGCCTTTGAATGGTGCATTTTAAACACACAAAAAGTA
TGGAGTTCCAATAAGTTCAAAAAATGAAATCCCTTTGTAATAGATGAGTTCTCCTTCGAA
ACCCTCATACTTCGAGAGAGATTGTCTGTTTTGTACACGAAGTGCATCCAATTTTTGCCG
TAGCCCTCTCAACTTTTTAACACATGCTATGTGGGTGAAATGATGATACCATGCCAACTT
TCAACATTTTCAAAGTTCATTTGTAGTGCGTTTCAATTTTAGGATGAACTAGCTCAAAAA
CAATAAGTAAATGCACGGAAAATACCAAATGAAGTCAGAAATTGTTGAAATTTTGTGATG
TGCCTTTGAATGGTGCATTTGAACACACAAAAAGTATGGAGTTAAAATAAGTTCAAAAAA
ATGAAATCTCTTTGTAAGAGATGATTTCTCGTTCGAAACCGTGATACTTCGAGAGAGATT
GTCCGTTTTGTACATAAAGTGCATCCAGTTTTTGTCGTAGCCCTCTCAACTTTTTAACAA
ATGCTATGTGGGTGAAATGATGATAGCATGCCAACTTTCAACATTTTCACTGTAGTAGCC
CTCTCAACTTTTTAACACATCCTATGTGGGTGAAATGATGATAGCATGCCTACTTTCAAC
ATTTTAAAAGTTCATTTGTAGTGCTTTTCAATTTCAGGGTCAACTAGCCCAAAAAACAAA
ACTAAATGCACGAAGAATACCAAATTAAGTCAGAAATTGTTGAAAATTTGTGATGTGCCT
TTTAATGGTTCATTTTAAACACACAAAAACTATGGAGTTCAAATAAGTTCAAAAAATGAA
ATCCCTTTGTAATAGATGAGTTCTCGTTTGAAACCCTCATACTTCGAGAGAGATTGTTTG
TTTTGTACACGAAGTGTATCCAGTTTTTGTCGTAACCCTCTCCACTTTTTAGCACATGCT
ATGTGGGTGAAATGATGATACCATGCCAACTTTCAACATTTTCAGAGTTCATTTGTAGTG
CTTTTCAATTTTAGGGTCAACTAGCTCAAAAAAAAACTAAGTAAATGCATGAAAAATACC
AAATAAAGTCAGAAATTGTTGAAATTTTGTGATGTGCCTTTGAATGGTGCATTTTGAACT
TACAAAAGTATGGAGTTCAAATAAGTTCAAAAAATGAAATCCCTTTGTGATAGATGAGTT
CTCGTTCGAAACCGTGATACTTCGAGAGAGATTGACCGTTTTGTACACGAAGTGCATCCA
GTTTTTTGTAGTAGCCCTCTCAACTTTTTAACACATCCTATGTGGGTGAAATGATGATAG
CATGCCTACTTTCAACATTTTAAAAGTTCATTTGTAGTGCTTTTCAATTTCAGGGTCAAC
TAGCCCAAAAAACAAAACTAAATGCACGAAGAATACCGAGTTAAGTCAGAAATTGTTGAA
AATTTGTGATGTGCCTTTGAATGGATGGTTCATTTTAAACACACAAAAAGTATGGAGTTC
AAGTAAGTTCAAAAAATGAAATACCTTTGTAATAGATGAGTTCTCGTTCGAAACCCTCAT
ACTTCGAGAGAGATTGTCTGTTTTGTACACGAAGTGCATCTAGTTTTTGTCGCAACCCTC
TCCACTTTTTTAGCACATGCTATGTGGGTGAAATGATGATACCATGCCAACTTTCAACAT
TTTCAGAGTTCATTTGTAGTGTTTTTCAATTTTAGGGTCAACTAGCACACAAACAAATAA
GTAAATGCACGAAAAATACCAAATGAAATCAGAAATTGTTGAAAATTTGTGATGTGCCTT
TGAATGGTGCATTTTGAACACATAAAAAGTATGAAGTTAAAATAAGTTCAAAAAAATTAA
AATCCCTTTGTAAGAGATGAGTTCTCGTTCGAAACGCTCATACTTCGAGAGAGATTGTCC
GTTTTGTACACGAAGTGCATCCAGTTTTTGTCGTAGCCCTCTCAACTTTTCAACACATGC
TATGTGGGTGAAATGATGATAGCATGCCAATTTCAACATTTTCAGAGTTCATTTGTAGTG
CTTTTCAATTTTAGGGTCAACTAGCCCAAAAAACAAAAGTAAATGCACGAAAAATACCAA
ATTAAGTCAGAAATTGTTGAAAATTTGTGATGTGCCTTTGAATGGATGGTTCATTTTAAA
CACACAAAAAGTATGGAGTTCAAGTAAGTTCAAAAAATGAAATACCTTTGTAATAGATGA
GTTCTCGTTCGAAATCCTCATACTTCGAGAGAGATTGTCTGTTTTGTACACGAAGTGCAT
CCAGTTTTTGTCGTAACACATGCTATGTGGGAGAAATGATGATACCATGCCAACTTTCAA
CATTTTCAGAGTTCATTTGTAGTGCTTTTCAATTTTAGGGTCAACTAGCTCAAAAAAAAA
GTAAATGCACGAAAAATACCAAATGAAGTCAGAAATTGTTGAAATTTTATGATGTGACTT
TGAATGGTGCATTTTGAAGACACAAAAAGTATGGAGTTCAAATAAGTTCAAAAAAATGAA
ATCTCTTTGTAAAAGATGAGTTATCGTTTGAAACGCTCATACTTCGAGAGAGATTGTCCG
TTTTGTACACGAAGTGCATCCAGCTTTTGTCGTAGCCCTCTCAACTTTTTAACACAAGCT
ATGTGGGTGAAACGATGATAGAATGCCAACTTTCAACATTTTCAGAGTTCATTTGTAATG
CTTTTCAATTTTAGGGTCAACTAGCCCAAAAAAACAAAACTAAATGCACGAAGAATACCA
AATTAAGTCAGAAATTGTTGAAAATTTGTGATGTGCCTTTGAACGGTGCATTTTAAACAT
AAAAAATTATGAAGTTCAAATAAGTTCAAAAAATGAAATCCCTTTGTAATAGACGAGTTC
TCGTTCGAAACCCTCATACTTCGAGAGAGATTGTCTGTTTTGTACACGAAGTGCATCCAC
TTTTTGTCGTAACACTCTCCACTTTTTAGCACATGCTATGTGGGTGAAATGATGATACCA
TGCCAATTTTCAACATTTTCAAAGTTTATTTGTAGTGTTTTTCAATTTTAGGGTCAACTA
CCTAAAAAAATAAGTAAATGCACGAAAAATACAAATGAAGTCAGAAATTGTTGAAATTTT
GTGATGTGTCTTTAAATGGTGCATTTTGAACACACAAAAAGTATGGAGTTCAAATAAGTT
CAAAAAAATGAAATCTCTTTGTAAAAGATGAGTTATCGTTTGAAACGCTCATACTTCGAG
AGAGATTGTCCGTTTTGTACACGAAGTGCATCCAGCTTTTATCGTAGCTCTCTCAACTTT
TTAACACATGCTATGTGGGTGAAATGATGATAGAATGCCAACTTTCAACATATTCAGAGT
TCATTTGTACTGCTTTTCAATTTTAGGGTCAACTAGCCAAAAAAAACAAAAGTAAATGCA
CGAAGAATATCAAATTAAGTCAAAAATTGTTGAAAATTTGTGATGTGCCTTTGAATGGTG
CATTTTAAACACACAAAAAGTATGGAGTTCAAATAAGTTCAAAAAATGAAATACCTTTAT
AACAGATGAGTTCTCGTTCGAAACCCTCATACTTCGAGAGACATTGTCTGTTTTGTACAC
GAAGTGCATCCAGTTTTTGTCGTAACCCTCTCCACTTTTTAGCACATGCTATGTGGGTGA
AATGATGATACCATGCAAAATTTCAACATTTTCAGAGTTCATTTGTAGTGATTTTCAATT
TTAGGGTCAACTAGCTCAGAAAAAATAAGTAAATGCACGAAAAATACCAAATGAAGTGAG
AAATTGTTGAAATTTTGTGATGTGCCTTTGAATGATGCATTTTGAACACACAAAAAGTAT
GGAGTTTGAATAAGTTCAAAAAAAATGAAATCCCTTTTGTAAGAGATGAGTTCTCGTTCG
AAACGCTCATACTTCGGGAGAGATTGTCCGTTTTGTACACGAAGTGCATCCAGTTTTTGT
CGTAGCCCTCTAAACTTTTTAACACATGCTATGTGGGTGAAATTATGATAGCATGCCAAC
TTTCAACATTTTCAGAGTTCATTTGTAGTGCTTTTCAATTTTAGGGTCAACTAGCCCAAA
AAAACAAAAGTAAATGCACAAGGAATACCTAATAAAGTCAGAAATTGTTGAAAATTTATG
ATGTGCCTTTGAATGGTGCATTTTAAACACACAAAAAGTATGGAGTTCAAATAAGTTCAA
AAAATGAAATACCTTTGTAACAGATGAGTTCTCATTCGAAACCGTGATACTTCGAGAGAG
ATTGTCCGTTTTGTACACGAAATGCATCCAGTTTTTGCCGTAACCCTCTCAACTCTATAG
CACATGCTATGCGGGTGAAAATGATGATACCATGCCAACTTTCAACATTTCTAGAGTTCA
TTTGTAGTGCTTTTCAATTTCAGGCTCAACTAGCTCAAAAAAATAAGTAAATTCACGAAA
AATATCAAATGAAGTCAGAAATTTCATATTTTTTTTGTTAAAATCCTTAATAGAAAACAA
AAAAAGAGTCAACTAAAAAGAATCAACTAAAATATTAACTAAAATGAATGAATTAAGAAT
AATTTACTAAAATTTTCAAAGTGCTTATTTGTTGGAAAGAATCAAGTAAAACATTAACTA
AAAAGAAACAAAAAAAGATCTACTCAATAGAAAACTAAAATAGAAGAGAAATAATAAATA
AAGCAAAGAACAAAAAAAATGGAAAAAAATTGAAACTATATGAGAATTTATAGAGAAAAA
TTCAACCTAAATTCAAAGTGACCTCACTTTGAATTCAGGTTGAATTTTGTCCATAATTTC
AAATATATTTTCAACTTTTAAATTTAAAGTCTGTTTAGGCCCATAAGCCTGCTTTAGAGA
GGAGCTCGACACGGTTGGGACAACGGGGCTTATAAACCAGTGGTGGCTCCTCTCGACAAG
CGAGGTGGGACTAAACTTTGGAATGCCGCCAGCCCAAGCCTTTAGTCCCGGGTCGGGGCT
CGAGCCGGGACTAAAGACACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCGAGATTGCACATGGTAAATACCATTGTCAGCTTCTCTTGGAAAACAGTTGGCAC
TCAAGTCTGCATTCTTCTCCAGCTTCTTCCTGATTTTTGGACAAATTCTTCCAGTCCACT
TCTCCACTGCTTCCCTATGCTTGCTAGCATGTGTTACAGAAATTTTTCCCAAGATACATT
CTAACATGGATATAATGCACAGACCTCTGGCTTCTAAAGTGTAGCTGCAATATGTGAAAC
ATAGATATGATGAGCAATCTGCAATATGTGAAACACAGATATGATGAAACTGATAATTTA
CCTATTGTAGACCTCACATATTGTTAAAGAGGATATCACATTTTGGGAAATCACTGAAGA
AGTTCTTCACCCATTGGTTAGGTGGCTTTTTCTCTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGCTAGCCTCCTTCA
TTTTCTCTCTGTTCATGTTCCACTTTGGTAAGTTTGTTGACCTTGCAATGGCCCAGAGCA
GGTTTTTCAGCGTTTCCCCTTTGAAAAGCTTGTGGAAGTTCTGGTATAAGTGCCTCACAC
AAAATATATGCTCTGCATCTGCAAAAACTTTCCCAACTGCATTTATTAAACCCTGAAAAT
TGGCAGAAAGTCACACATAAAAACACAAGACATATCAAATTTGTAGATAGCACAACATTA
CAAGAGGTACCATTACCTTCTGCTTGTCATTCATGATAGTATATGGGCATGTGTTGATAA
TGTTGAGGTCATTCTTAAGTGTTGTCAAGAACCATTCCCATGTATAAGTAGATTCCACTT
CTACTAATCCCATGGCAATAGGAAATATGTAATCATTTGGGTCTATGCCCACTGCTGTTA
GTAGCTGGCCTTTGTATCTACTCTTCAAGTGGCAACCATCAACAAATATTATAGGCCTAC
ATACATTTAGAAAGCCTCTCTTGCAAGCATCATATGACCAGTATAATGATGACAAATGGT
CCTTTGGAAGAACATCATTTGTCTCCTTGACCTTGGTAGTTCTCACAATAAATTTGCTCC
CAGGGTTGCACCTTCTCAGTTCTTGGCCATAGTCCCATAGCTGGTTATATTGTTCTGATT
CATCTCCATGGATGATATCAAGTGCTGCCTTTCTAGCTCTTCCTAGTTTCATTTTGTTGG
GCATCAACTTGAACTCTCTCTGCACTTTATTCCCAAATGTTGTGAGATCCATTTTTTGGT
TGTCTCTAAACTCATCAATAAATTTCTGTGTAAGCATCTTAACTGTCAAACACTCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATATTTTTGGTCAAGTTAGCAGTT
GTGTAACTTTCTGTGTGAAACTCCTTTGTATTATCTTTTTGCTTGTGCTTGTAGTACTCT
TGAATAGCTTCTGCCACATATCTTGTTTGGCATATTTGGGTGGCTATAGGTGCTTTGCAT
GTAGCCCTCAAACTACTATGATGTTGTTTATGGCAGATTGTGTAGTTTTGATGTTTTGAT
GCTTGTGAGTGCATAGATGATGTTGTGGTGATATTTCCTTGCACCACCCCATCCATTCTT
GTTTGTTTTATGTCTTGGCAACCTGGGAATACCAGAAGTATGCCATTGGAGTGTGTGGTG
ATGATTTTGATACGTAGGACGTCATTTCTTGTTTCGTTGTTTCCCGTTGATCCGTAGCTC
CGACCGTTACGTTCTTTATATGCTTTTGCGTTGTTTCCCATTGATCCGTAGCTCCGGTCG
TTACGTTCTTTATATGCTTTTGCATCGTTTTCACGTGGCGCATCTGTTCATGTTATTCTC
ATGCATGTAAACATATATTAGGGTGCAGTTCTGTCCCGGAACTTGTATTTTCTTCTCATG
CATGTGCAAGTGAGTAGAATAGAGATGCATGTTCATTTTCGCCTAATGCATCATGTGCTT
GTTGCATCTTGAGGTGCTGTTTTTCATTGGATGCTATTTTTATGTTGGGTAGCACCGGGA
TCAAAGAACGAGTACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNATGACCTTGATTCAATCTCTAGACTTGTTATGCTAGATTAC
GTTTCTTCGTCATATGCTGGCTGCCTACCACTGAAATAATTGCCTCCTGATATTGCCATG
AAACCCAAACACTTATTCCTTCCTAGAAAATCTTGAATGGCTAAGTAGGTTTTGCTCAGC
TACTAATGTTAGCGTTGCTAGTTGCAGGTGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACATGAGTTTGATATC
ATTATGTTAAATTTGTTATTTAAATAATGCACCTATATACTTGGTAAATAACGGAAGGCC
TAGCCTTTTGCCGGGTGTTTTGTTCCGTTATTGCCGCCACAGTTACCGGTTACCGGTGTT
TGATTCCATAACTGTTCGCTCCTAACACGTTCGGGGTTGTTATGGGAACCCCCTTGATAA
ACCGCGTAGTGTTAAGACTTGTCCGGCAGGACCCAACATTGGTGTTAATTTGCTAATCAC
TTAATAACCTGCATAGGGAATGAGCACCCCGAGGANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAACTCCTTTGTATTATCTTTTTGCTTGTGCTTGTAGTACTCTTGG
ATAGCTTCTGCCACATATCCTATTTGGCATATTTGGGTGGATGTAGGTGCTTTGAATGTA
GCCCTCAAACTGCTATGATGCTGTTTATGGCAGATTGTGTAGTTTTGATGTTTTGATGCT
TGTGAGTGCATAGATGATGTTGTGGTGATATTTCCTTGCACCACCCCATCCATTCTTGTT
TGTTTTATGTCTTGGCAACCTGGGAATACCAGAAGTATGCCATTGGAGTGTGTGGTGATG
ATTTTGATACGTAGGACGTCATTTCTTGTTTCGTTGTTTCCCGTTGATCCGTAGCTCCGA
CCGTTACGTTCTTTATATGCTTTTGCATCGTTTTCGCGTGACGCATCTGTTCATGTCATT
CTCATGCATGTCAAGATAGCTTAGGGTGCAGTTCTGTCCAGGAACTTGTATTTTCTTCTC
ATGCATGTGCAAGTGAGTAGAATAGAGATGCATGTTCATTTTTGCCTCATGCATCATGTG
CTTGTTGCATCTTAAGGTGATGTTGTTCATTGGATGCTATTTTTATGTTGGGTAGCACCG
GGATCGTAGAACGAGTACGTGGATCTGGGAGAGTACAGGCAGGACGAACAAGAGCAGTTC
CAAATTGAGGACATCACAGACAAGATGATATGACCTTTATTCCATCTCTAGACTTGTTAT
GCTAGATTACGTTTCTTCGTCATATGCTCGCTGCCTACCACTGAAATAATTGCCTCCTGA
TATTGCCATGTAACCCAAACACTTATTCCTTCCTAGCAAATCTTGAATGGCTAAGTAGGC
TTTGCTCAGCTACTAATGTTAGCATTGCTACTTGCAGGTGCTTTGTCTCATGTGATAACA
TGAGTTTGATATCATTATGTTAAATCTGTTATTTAATTAATGCACCTATATACTTGGTAA
ATAACGGAAGGCCTAGCCTTTTGCCAGGTGTTTTGTTCCGTTATTGCCGCCATAGTTACC
GGCTACCGGTGTTTGATTCCATAACTGTTCGCTCCTAACACGTCCGGGGTTGTTATGGGA
ACCCCCTTGATAAATCGCGTAGTGTTAAGACATGTCCTACATGACCCAACAATGGTGTTA
ATTTGCTAATCACTTAATAACCTGCATAGGGAATGATCACCCCGAGGATCTTTAATCAAC
AACCCGGGCCAGTGCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC
CGTTTCAGAGTGAAGTTCGTCGTAACAAGAGGATAAACTGTCTACGATATGATCATGGAA
ATGAATATCTGAGTTATGAGTTTTGGTACGCAGTTAAGACAATGTGGAAATTGTTTCGCA
GTTCATGCCACCTGGAACATCATAGTGTGATGATGTGTCTGAACGTCATAGCCACGCACT
ATTGGATATGGTGCATACTATGATGTCTCTTATCGAATTACCACTATCGTTTATGGGTTA
TGCATTAGCGACAACCGCATTCACTTTAAATAGGGCACCGCGTATTTCCGTTGAGATGAC
ACAGTATAGACTATGGTTTGGAGAACCCTATGCTGCCGTTTCTTAAAAGTTTGGGGCTTC
AATGCATATGTGAAAAAGTTTCACTCTGATAAGCTCGAACCCAAAGCGGATAAATGCATC
TTCATAGGATATCCAAAACAGTTGGGTACATCTCCTATCTCAGATCCGAAAGCAAAGTGT
TTGTTTCTAGAAACGGATCCTTTCTCGAGGAAAGGTTTCTCTCGAAAGAATTGAGTGGGA
GGGTAGTAGAACTTGATGAGGTTATTGAACCATCACTTCAACCAGTGTGTAGCAGGGTGC
AGGAAGTTGTTCCTGTGGCGCCTACACCAATTGAAGTGGAAGCAGATGATGGTGATCATC
AAGCATCGGATCAAGTTACTACAAGCCTCGTAGGTTGACAAGGTCGCATACTACTACAGA
GTGAGTTACTACAAACCTGGTAGGTCGACAAGGCCGCATACTACTACAGAGTGGTACGGT
AACCTTGTCTTCGAAGTCATGTTGTTGAACAACAATGAACCTACGAGCTATGGAGAAACG
ATGGTGGGCCCGGATTCCGACAAATAGCTGGAGTCCATGAAATCCGAGAGAGGATCCATG
TATAAAACAAAGTGTAGACTTTGAAAGAACTACTTGATGGTCATAAGACTATTGAGTAAA
GATGGATCTTTAAAAGAAGACAGACGATGATGGTGATAAGTCACTATTAAGAAAAGCTCG
ACTTGTCGCAAAGATGTTTTCGACAAGATCAAACAGTTGACTATGATGAGTCTTTCTCAC
TCGTAGCGATGCTAAAGGTCTGTTAGAATTATGTTAGTAGTTGCTGTATTATTTATGAAA
TATTGCACGTAGGATGTCAAAACATTGTTTCCTCGACGGTTTCCTTGAGCAAACATTGTA
TGTGATACAACCAGAAGGTTTTGTCGATCCTAAATATACTAGCAAGTATGCAAGCTCCAG
TGTATACAACCAGAAGGTTTTGTCAATCCTAAGGATGCTAACAAGTATGAAAGCTCCAGC
AATCCTTCTATGGACTGATGCAAGCATCTCGGAGTTGGAATATACACTTTGATGAGATGA
TCAAAGATTTTGGGTTTGTACAAGGTTTATGAGAAACTTGTATTTCCAAAGAAGTGAGTG
GGAGCACTATAGAATTTCTGATAGGTATATGTGGTTGACATATTGTGGATCAGAAGTAAT
GTAGAATTTCTGTAAAGCATACAAGGTTGTTTGAAAGGAGTTTTCAAAGGAATACCTGGA
TTGAGCTACTTGAACGTTGAGCATCAAAGATCTATGGAGATAGATCGAAAGCGCTTAATA
GAAGTTTCAACAAGATGCATGCCTTGACAAGTTTTTGAAAGAGTTCAAAATAGACCAGCA
AAGAAGGAGTTCTTGGTTGCGTTGTGAGGTGTGAATTTGAGTAAGACTCAAAACCTGACC
ACGGCAGAATAAAGAGAATAGACGAAGGTCGTCTTCTATGCCTTAGCCGTAGAATCTAAA
GTATGCCATGCTGTGTACCGCACCTGAAGTGTGCCTTGACTCAAAGTATGTTGAGAGGTA
CAGAGAGTGATCCATGATTGAATCACTAGCAGCGATCAAAATTTATCCTTAGTAGCTAAT
GGACTAAGGAATTTTTCTCGATTATGGAGGTGGTTAAAGAGTTCGTCGTAAAGGGTAACG
TCGATGCAAGCTTTGACACTAATCTGAATAACTATGAGTAGTGAAACGGATTCATATAGT
AGAGTGGATATTTGGAGCATTTCCGAATAGCACGTAGTAGCAGCATCTATAAAGATGACA
TAAAGATTTGTAAAGAACGCACGGATCTGAAAGTTTCAGAACCGTTGACTAAAACCTCTC
TCACGAGCAAGACGTGATCAGACCCCATAACTATATGGGTATTGGATTCGTTGGAATCAC
ATGGTGATGTGAACTAGATTATTGACTCTAGTGCAAGTGGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCGTGAGTTGTTACTTTTGTTCCTGAGGACAAGGGATAA
GTCATGCTAATAGTAGTCATGTGAATTTGGTATTCGTTCGGTAATTTGATATGTTGTATG
TTGTTTTCCCTCTAGTGGTGTTATGTGAACGTCGACTACATAACACCTCACCATTATTTG
GGCCTAGAGGAAGGCATTGGGAAGTAGTAAGTAGATGATGGGTTGCTAGAGTGACAGAAG
CTTAAACCTTAGTTTATGCGTTGCTTCGTAAGGGGCTGATTTGGATCCACTAGTTTAATG
CTATGGTTAGACTCTGTCTTAATTCTTCTTTCGTAGTTGCGGATGCTTGCAAGAGGGGTT
AATCATAAGTGGGATGCCTGTCCAAGTAAGGGCGGTAACCAAGCGCCGGTCCACCCACAT
ATCAAACTATCAAAGTAACGAACATGAATCATATGAATATGATGAGAACTAGCATGACAG
AAATTCCCGTGTGTCCTCGGGAGCATTTTTCCTCCTATAAGACTTTGTCCAGGCTTGTCC
CTTGCTACAAAAGGGATGTAGCCACCTTGCTGCACCATTGCTACTTTTGTTACTTATTTC
TTGCTACGAATCATCTCACCACACAATCACTTGTTACCGACAATTTGAGTGCCTGCAGAT
TTTACCTTGCTGAAAACCACTTGTCAGATCCTTCTGCTCCTCGTTGGGTTTGACACTCTT
ACTTATCGAAAGGACTACGATTGATCCCCTATACTCGTGGGTCATCAACCCTTCATAGGC
GACACCTTGACATAGACGAAGTCATCAAGCTCATAAGACATGTCACGATGCTTGCTATCA
TAATAGCTCTTCTGACGGGGCTGAGCTGCTCTGAGGTTATCACGAATGACCCGATACATC
TCTTCAGCTTCTTCTATCAAGTCATTCCCAAGAATCTCACGCTCGCCGGTCTCGGACCAG
TTGAGCGGGGTACGACACTTCCTGCCATAGAGAATCTCAAACGGGGCTTTGTCTGAACTA
GCTTGATAACCGTTGTTACACGAGAACTCGGCAAAAGGCAGGCAATCCTCCCACTTCATG
CCAAAAGAGATAACACAGGCTCTCAGCATATCCTCAAGAACTTGATTGACTCGCTCCACT
TGACCACTAGTCTGAGGATGAAAAGCTGTGTTGAAGCGTATCTTCGTGCCCATCACAGAC
CGAAAAGAATCCTAGAACTTGGAAGTGAAGATACTTCCGCGATCCGAAGAAATCATCATA
GGCACGCTGTGCAAAGACACTATCCTGGAAGTGTACAACTCTGCAAGTTGAGCTGCCGAA
ATAGATTCCTTGACTGGAAGAAAATGAGCCACTTTACTCAACTTGTCGATGACGACGAAG
ATGGCATCATTACCCTTCTTGCACTTCGGAAACCCGGTGACGAAATCCATCTCAATATGA
TCGAACTTCCACTCGGGAATGGGCAAAGGATGCAAAAGACCTGCTGGACGTTGATGCTCT
GCTTTCACCCTTCGACATACATCGCATTCATTTATGAACTGAGCAATCTCACGCTTCATG
CGAGTCCACCAGAAGGTCTGTTTCAAGTCCTGATACATCTTGGAGCTTCCAGGATGAATA
GAGAGCACAGAGTTATGAGCTTCTTCCATGATTATCTTTCTAAGATCACCTTTCGGAACG
ACAAGACGATCCTCAAAGAACAACGTGTCTCTGGCATCAACACTGAAGCACTTATATTTG
GGAAGACCCTTTGCCACGCCAATCTTGACTTTCTTCACCATTGCATCAAGAAGTTGTGCT
GCTCGGACCTGATCTTCCAAGGTAGGAGAGACCTGAAGGTTTGCAAGAAATCCCTGAGGT
GCTAACTGAAGGTTGAGCTTCCTGAAAGACTCACAAAGGTCAGGCTGGAGAGGTTTCAGA
ATGAGACTATTGTTGTAAGCCTTCCTGCTCAAAGCATCTGCCACGACATTAGCTTTGCCT
GGCGTGTACTCAACACTCGGATTAAAAACTTGGAGCATTTCCACCCAACGAGTTTGCCGG
TGATTTAGGTTAGGCTGAGTGAAGATGTACTTGAGACTCTTGTGATCGGTGAACAATTCA
ACCTTTCGTTCCAACAAGAGGTGTCTCCAAGTCATCAGAGCGTGTACCACAGCTGCTAGC
TCAAGATCATGCAGAGGATAATTCTTCTCCGCTGGCTTCAACTGCCTGGAGGTATAAGCA
ACCACTTTCTTCTCTTGCATCAGAACTGCACCAAGACCTTGAAGAGAGGCGTCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGTGAGCTTCTCTT
TGAGTGTGTCGAAGGCCAACTGACACTCTCGAGACCAAGCATACTTCACACCCTTCTGAA
GAATACTTGAGAGTGGCTTAGCAATCTTGGAGAAGTTCTCAACGAACCTTGTACAATAGC
TTGCGAGCCTGAGAAAGCTTCGAAGCTGCTTCATATTCTGCGGAGGCTCCCATTCAATAA
TGGCATGTACCTTCAACAGATCAACTTTGATGCCCTCGGCAGAGATANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATAATTAGCCAATTTAGCCTTTCTTGGATG
AGTCTAAGCTACGTGGAAGAAGAGATAGAGAAGAAGAAGTAAAATAAAGAGGAGAAGGAG
GAGGTGGAGGAGGAGGATAAGAAGGAAGAGGAGAAGAAGAAGAAAAGAAGAAGGAGAAGG
ACAAGAAGAAGGAGAAGGAGAAGGAGGAAGAAGGAGGAAGAAGAAGGAGAAGGAGGAGCT
CCTTCTCCTTCTCCTCCTTCTTCTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTCCTTCTTCTTCTCCTCCTCCCTCTCCTCCTTCTTCTT
CTCCTCATTTTTCCTCTTCCTTCCTTTCATTTTTCCTCTTTTTCTCTTCTTGTCCCCTTC
TTCGGGCTAAATTGGCTAAGAATGCCTTTTTGGAGCTAATTATGTCATTTCGAGGATAAT
TAGCTAAGTATAGGTCATTTTTTATTAAACAGGCCATTTTGGAGCTAACTAAGCTAATTA
TGTCATTTCGTAGGATAATTAGCCAATTTAGCCTTTCTTGGATGAGTCTAAGCTACGTAG
AAGTAGAGATAGAGAAGAAGAAGTAAAATAAGGAGGAGGATGAGGAGGAGGAGAAGAAGG
AAGAGGAGAAGAAGAAGAAAAGAAGAAGGAGAAGGAGAAGAAGAAGGAGAAGGAGAAGGA
GGAAGAAGGAGGAAGAAGAAGGAGAAGGAGGAGCTCCTTCTCCTTCTCCTCCTTCTTCTC
CTTCTTCTCCTTCTTCTTCTCCTCCTCCCTCTCCTCCTTCTTCTTCTCCTCATTTTTCCT
CTTCCTTCCTTTCATTTTTCCTCTTTTTCTCTTCTTGTCCCCTTCTTCGGGCTAAATTGG
CTAAGAATGCCTTTTTGGAGCTAATTATGTCATTTCGAGGATAATTAGCTAAGTATAGGT
CATTTTTTATTAAATAGGACATTTTGGAGCTAACTAAGCTAATGATGTCATTTCGTAGGA
TAATTAGCCAATTTAGCCTTTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGCTAGTGAAATACTCCTACACACTTGCAACCAAGACTACTACTGCAGTCTGCAG
ACTCTGCTTCCTCTGCTTTGCTCAGCTGAGCAAGACTAGCACCAAGATCAACAAGGCTGC
AGCGCTGATGATTTCTTCCTCTGCTTCGATCATCCATGGATTTGCATCGCTTCAGCATAG
TCCCGTTGACGAGCCATCTCGATGAGCCAAGCTTGATAAAACCATGCTTCCTGTCTTGCT
TGGAGCAGCTCCTCAGGGGACTTGGTCACGTCGGAGTAATGGATCCAGGGGTCGTTGAAC
TGCACGGTGTCCGTCATCTGCTCCAATTTACGCCGGGCCTCCGTGACAAGGCCCCTGAGG
CGAGCTTTGGCGATCAGTTCGCGCATGCTGAGCTGCGGCTTCGTTTGCGTCGCGCTCTCC
GGAGATTCGACGACCTGGTTCTTGATCGCGAGCTGGTTCTGATCTTTGCCGCTGCTGGGA
CACAGAAGCTCGCTGCTGTTCTTGATGTTGGTTGCCACCGCGACATGGAGCTCGCCCCCG
GAGCTGACACCGCGTACGCGCTTCGGCGCCGGCGGCTGCACGTCGCGCTCTGATCCTGGA
CGCTTTGGCCTCTTGGCAGCCGCGGGGTTCGCCATCAGGGTAGGGTTTAGGCACACGCGG
GAGAAGCAGGAGTGCAGGTCATCGTCGTTGTCGGCGGCGCTACGGCACGGGAGCAGAGAC
GGCGGAAACTCCGTGGTGCCGGCCATGGTCGCGGCGGCGGAGTCGCGAGAGCAACGATCC
GGTGACGGGAGGGAGGATGAGAATGCCGATGAGATTGAGATGGATNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGGGC
GTGCAAGAAAGAAGAGACGGGGCAGGGGCAACCAGGAGTATATCTGTCGAGTTTGAATCC
GAATATAGCTCGAAAGCGCGGGGATTTGCACATTTTATTACTGCTATCTTTCTTTCCAAC
TCGTTTCAGGAAGAAAACAACGACAGCAACACCTGTACGTACTGAACGATAATACTACAC
CTACGTAACGAGTTAATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATTTGCCACATGGGCTGCCACGCATACCTGGATCATCCTGATGTG
TGAAGGGCATTTTTGCTGATAACCCCCCGGAAGCCTCTTGCAGCACTATCAATAAAAAAC
CTGAAAGTCATGAAGGTGTTCAGGAAGCTGCACCTAGTTTCAGCACCTAGTTTCAGAGTA
AGAAGAAGGAGAAGTTACTGCAAGTTCAGCATACACTTAATATAACTGATAAACACAACA
CAGGTAACTGATAAACACAGCACAGGTAACTGACCAGAGTAGACAACACTTAATTTGTTA
CTAAGCTGGATGATCATAGAGCACAACAAGTGGAAGAAAACCAAATGGAGCAGAAACATG
ATGATTACTAAACATGAGCACAACAAGTGGAAGAGCACACGTGGTTTTCAAACACAATTG
GTTACTAAGCTGCCACCTGTACTAACCATTCAACTGAAGTGATTCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAACCATTCAACTGAAGTGATTCACCAATGCTCTTT
CTAAAATGAAGCACAAAAAACTGAAGCACATAGAACACATAAATAGCCCAAAATAGGTCA
AAGTTTTCTAGATCTTTCGGTGCACACTAACAGTGTTTTGCAGTACAAAATTCTAATTCT
TCCTGCAAGCTTCTAGTTCATGTATGAACTGGGACATTTTTGCAGTTCGGTGATGAACTA
ATTGAACATATCAGTGATGACCTAATTATCTCGAGTCCTAGGGGCATTCTGGGTCAGTGG
AATCTCTTCATTCAAGTTTGGGATTGCTCCATCATGTCCAAACATTAGCTGCCATAGAGG
ATAATCTTCCACTCTTCTTCCTCCTTCAGCTCCTCTTCCAGCTGCTGCTCCAACTCCAGT
TCCAGCACCTGCTCCAGCTCCAGCTCGAGTTCCAGCACCTGCTCCAGCTCGAGTTACAGC
AGCTGATCCAGCTCCAGTTCCAGTTTCAGCTTCTGCTCCAGCTCTTGGTCTTGCAACAAC
AGCTCCTCTTGCTCCAGTCATTCCACCTGCAGCTCCTCTTGCTCTTGCTCTTCCACCTCC
TCTTTTTTTTTCTTTGCTCTTCCTGCATTGGCACTTGTTCCTGGCTCATCTGCATTTGTA
AATTTTAGTAAATTCAGCAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCAAATGGACTAACTATTGTTTCTAATTCTTGTAAAGTTTCATTGCAC
TTGTTCCCGGCTCACCTGCATTAGGTTCCACTTCTGGTGCTGCTCTTCTTTTGCCTCTAC
TTGCCATTGTAGTTCTTCCTCGAATAGTTGCAGTTGTGTTTGTTCTTCTTTGGGGGATCA
AATCCCTGGCATCAACTACAAAAGTTGATTCCTCTGGTAGAGGTCCAGGTGGCACCATCC
TTGTCACATGAGCCCTCTCCTAGATTATATACCCCAACATTCAGTATAAGATTCAGTGTA
AAATACAGGTAAACTATGTAAAATACAGTGTTAATACCTCTTGTCCCATTGTGTACACCA
TGCTGCTCCTATCATTGATTGGATCCAGCCTATGGTTGTTGTTCTGGGTCAGTATATCCT
GCACGTGATAATTAGGTCAGTCCAAAAAAGGAATTAAGTGCATTAAAAAAGGAATTAAGT
GCATTAACCTGAAGAATTTCTGGACATGCAAACTCATCATCCACTTCAACTTCTGGCTCC
TGCATTTGCCTTTCAATGTATTTACCATGACCCCTTTTGTTGTGGTCACCTTTTCCACAA
ACTGAGCAGTGCATAGTCGCCCCATTCTTACTGAGATAAATTGTGCCATCTTTCTTCTTC
TTCTCTTCTGGAGTTTTCCTCCTTTTTGTGGCTGGTCTTCCCATTCCCTTAGTAAACACG
GGGGGGTGGATGTCAATACCATTGAGCTTCTCCCAGTGGGCCCTATCTCTAAGAGGCATG
ATTTCGTGACCATAGGCTTTCAAATAGGTGTCAATGGTGTAACATTTGTGCACCAACTCT
TCAGGGTCAATCCTCTCAGTCCTACAAACTGCTATAGCATGTGGACAAGGGATCCCACTT
AATCCCCAGCTCTTGCAATCACAGCTTCTACCAATGATGTCAACTATGTATGAGTTGGGG
CGAGATTGCACATGGTAAATACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTATGAGTTCTAATGACGACAAGTGTCTCTCCTCTGCAGCCTTGTGAGGCTTGCGAGG
TTGCTTTGCTTGTACACATGAATGGCACTTAGAACCTTTGGCTAAAGTGAAACTCGTGAT
TAAAAGCAGTTTTGCTAGCCGCGATATAACACCAAAACTTATGTGACAAAGACGTGAATG
CCAAACTTCAGATTCATTAACACTCGAATGAATATTGTTCACGACTACATTACAAAAATC
TGCAAGGGAAAGGCGGAACAGACCTCCGCATTCATAACCTTTTCCAACAAAAAGTCCATA
TTTCGTAACAACTATTTCATAAACTTTTCCAACAAAAAGTCCATATTTCGTAACAACTAT
TTTATTAGACTCGAAGACCAACTTAAATCCTTCTCTACACAGAAGGGAGCCACTAACAAG
ATTCTTCTTGATGGCGGGGACATGCTGCACGTTCTTCAACTGCATGATCCTTCCCGAAGT
AAACTTCAGATCGACCGTGCCAACACCAAGAACAGAATCACTCGCGTCATTCCCCATCAA
TATGGACCCGCGACCTGTGGCCTGATAAGAAGAGAACAATGAGATGTCAGCACACACATG
AATATTTGCACCTGTGTCCACCCACCAATTGATGGACTGACAAACTGAAAATACAGTAAA
TAAATTACCGTACCCAGGTGCACCACTTTCATTGTTGCCCACAATCATATTGGCAGACTT
GGAGTCCTGCGTCGGCTTCTTGTACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCCT
CTGATGTACCATATTGGCAACGAAAGAGCTTCCAACCGCTTTTCCATTGGAGTCCTTTTC
TCTCGAATTCTGCTCAACAGTCAGATAGCCGATGATGTCCTCTACTGAGAACTTACGGCT
CTGATATTTCAGAGTAGTAGCAAAGTTCCTCCAGGAATTAGGGAGCTTAGCAATTATACA
GCCCGCGACAAACTTGCTCGGCAAATTGCACTTAAGAACCTCAAGCTCTTTAGCTATGCA
TATTATCTCATGAGCATGTTCCAATACAGAACGGTTGTCAACCATTTTGTAATCGTGGAA
CTGCTCCATAACATACATCTCGCTCCCAGCATCGGCGGCTCCCAATTTAGATTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTTGGCAACATGCATATGTAAATATGCATCAACCCGCTTATCTCCGATCAC
ACTTATAACTGCTCCAAGGAATAAGACGGTGGCCTCCGCGAACATCTTCTCCTGTTCAGA
AGAGATCGTTTCCGTGGGAGTGACACCGGCTACCCAGAANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTGCTTGCCCCTTCAGCTGGAATGTAGCAAACTTGACGAAAT
CCTCAGGACGAACATTGTTGCATTCAAAGTGCTTGTTCGTGTCGCGGATCCAATCCTCAG
CATCAAACGGCTGGTCACAGGAAGTCAAAGTCTTCGACTGATTCGACAGGAACTGACTCA
GATTAGCAAACTGATTGCCACCATGCTCGAAATTGCCTTGCTGCTGATTACCCCTCTCTT
GCAACAACTGTAGCAGCATCTGAGTGTTTGCATTTGTAGCAGCCATCACCGCTTGCCCAG
CCTGTGCAGGAGGAGGCGGCGGCGGAGGAGGATTCTTCGGAGGAGGAGGTGGTGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCTCAC
GGCCTGGATTCTGACGAGTTGGTGGAGCCATCCTGAAGACGGACAACACATTAGCCCACA
GAATAAATTGAAGATATAGTTGAATCAAAATGACAGGAATATCTGAACAGGAATATAGCA
ATCACAGTCGAACAAAATAGTAAGAATGCTTCCTCAAAGTGACGGTCGACAAAATTCTGA
TTAAGACCACTTGCAAACAAGTATGAGCTAGAACTGCTCGGAACAAACAAATGATCGAGA
TTTGATCTGATATCTTCGTGGATAAGATCGCACGGGCTTGAATTTAAAGTAGCCATCCTG
TGCAAGGTAGTGCACACGACTTACGAAGTATCCCCGAGTCGTAGCGAGCTACANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCA
AGCTCACATCATGCATCTGTAGGAAGATTGTCCTATAAGTTACTACTTGATATCCCACCT
ATGAATTCCCGAAATAACTGGTCATGCAATCTGGTACACGGATACAAGGAGTAATATTCA
CACAACTCCTATACTAACCCGTCACCTGTATCACATCCGTCAACACATAACCAGAATCTC
GGACCTTCATCTACAACAGGCCCTCGTGATCACAACGATACCAAGTATGGCAGTACTCCC
GAACAATCTGCACCAGTACTGGGGACATCGGGGTTATCTCGCCACTACTAGTATTGAAGC
AATTACGAACATCCTTCGTTCTTAGATACTCCGAAACCTGAATGATGGCGATGTGCACAA
GAATCCCCTGGAGCTCAACTCGCCGGAAGAAATCAAGGCAGACAGGAGGCACCAAGACAG
AACTCCGTCACATCGAAATCATATAGATTTCAAAAATACCCGCGTGATCCTAAAAAAATT
GAGCGAGAAGAGGAGTAGAATTAAGATTTCCTAAGTCGGGAACCTCACTAGAGCATGGAA
GAGGAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAAATCAAC
AACATGCCACTAATTTTCACCACTAATCTGGCATCCAACTGGGAGAAATTGAGCAGCCTA
CTTATAAGTATTTTAGTTATATGTTGTTAGCATCTGATTCGGTCTTGTCCTTGTTAATTA
ACGAGCAGAAGTGCGACCACGCGAAGATGTACGAGAAGATCTCGGAGGAGAACCTGGAGC
TGATGCGGGAGAGGCTCATGGAGACGGTCATCTGGCCAACCGACGACACCAACACGGAGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGTGATCTCAGCCGCTCAACTTCATCAATTAATTAG
CTCATCGGTTAATTAGGTAGAGCGAGGACTATGCATGCATGCACGCACGATTGAGTCAAA
CATGTGTATATAATGTACGTATGTGATCTACTAGCACAGAGTGTATATGGTTCGGTCTTT
TGGTGGAGATACTGCAAACTGCTTCGTGCCATTCGCATGCATCAAGCCTGCGGCCACTGG
ACAGTGTATAATGTGCCTGTGTTCTGTCGATAGGCACATTGACTAGCTGGGTTCAATGTA
TGGATTTATTCATCACTTATCGGTGCAAGGGTGTGTTTGAGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATACAAATAATGC
TCACCTGTTATGTGCCTCTCGCCTCAGTTTAAATTTCTTCTCCTCCCATGCATTTAATGT
TTATTGCATGGCATTAGGCATTGAAGTTCAACACTCAGTCTCATATGTCCACACTTAAAA
TGGATTGGTCGAATCTTTAATTAAGAGAATTAAGCTCATTGCACGACCCTTACTAATGAA
TTGCAATTTATCAACTTCTTGTTGGGGTTACGCAGTTTTACACGCTGCTGACTTAATCCA
ATTACGACCAACTGCATATCACAGCACTTCCCCTCTGCAATTAGTACATGGAAATCAATC
AAATATTTCTCATCTGCGTAAATTCGGATGCGCCGCATATGTCCCAATCTCACCACGGCA
GCGTACATCCATGGGTCCACACAGAAAATTGGGGTCTATGTGGGGTACAAATCACCGTCG
ATAATCAAGTACCTTGAACCCCTCACGGGGAATCTATTCACAGCTCGTCACGCTGACTGC
ATCTTTAATGAGGAACATTTCCCAGCATTAGGGGGAGACATCAAGTACCAAAAAGAATGC
CCGGAAATCAATTGGAATGCCCAAGACATTTCCTCCTCTGATCCACGTACGCAAGAAACT
GAACTCCAAGTTCGGAAAATTATTGATTTGCAACATATTGCAAATAACNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGCATTTATTCGGCCTAGTATTTTTGATA
AATCGGGAAAAAAATCCTCGTTGATTTTTACAGCGCTTGGAGTTGTGCAGAATAGGTACC
TCAAACTTGCTCCACTTTCAGGCCAGAATTCCAGTTGCCGGTATTCTCCCTCTTCATGTA
AACCTTGCGAAATAAGAGAGAAAAGGCATAAGAACTGTACCGTGAAGTGAAATAACAGCC
CAAGAAGGGATAAATATCAACATGAAAACATGATGCAAAATGGATGTATCAAGGGTACGC
AGCGCTTTGTCATCAAAGGCAAGCTTGTGCCTCGTTTCGTTGGTCCGTTTAGAGTGGTTG
GCAAGAGAGGCGACCTTGCGTACCAGCTTGAGCTCCCATCAAACTTTGCAAATGTGCATG
ATGTGTTCCATATCTCTCAGCTCCGCAGGTGCTTCAAGACCCCCGAGCGCACTGTTCATC
TTCAAGACATCGACCTTCAACCTGACCTATCTTATGGTGAGCATCCAGTTGCGGTTCTCG
AGGCGACTGAGCTCTTTTGAAAGACGAACATGTGTATTTTCTTCGTAGGTGGTGTGTCAC
ATATGTTTTATCCAGGTCACGGAGCTATGGAGATGTATCGACGATAGTAATGTGGTGCTG
GGCCGTGCCCCAGGTCCAGAAACGGACGGGATTGTTAGGAGTACTCTGCTGGTTAGATGT
AATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATT
GATTTGAGAGCTCAATGCATATGATTTCATGTGTGTCACCTTGTATTGTTCTTCCTTTGC
ATGCATGCATCACTATCATTTCATGTCCTTGTGTTGTTTCCTTGTGATCTTATGTGATGG
TGTGATCCATGTGATGTGGTGGTGTGATGTTGGAAGTGTGAAATGAAGTGGGTGTTTCTT
GGGTGTTGCTTGTAGTAGTAAGTTTCTAAGTTGGTTTGCACTGGGGTTTCAAAACCATCT
CTCTCTTTTATCTCAAGCCCATATATTCTTTGCTTCTTCCCTGTTTTTAAAATGTCCATN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCAAGTGGGAGACTGTTGG
AAATATGCCCTAGAGGCAATAATAAAATGGTTATTATCATATTTCCTTGTTCATGATAAT
CGTCTATTGTTCATGCTATAATTGTATTAACAGGAAACAGTAATACATGTGTGAATAAAT
AGATCACAAAGTGTCCCTAGCAAGCCTCTAGTTGGCTAGCTCGTTAGTCAACAGATGATC
ATGGTTTCCTGATCATGGGCATTAGATGTCATTGATAACGGGATCACATCATTGGGAGAA
TGATGTGATGGACGAGACCCAATCCTAAGCATAGCACTAGATCGTATTGTTCGTGTGCTA
AAGCTTTTCTAATGTCAAGTATCTTTTCCTTCGACCGTGAGATTGTGCAACTCCCGGATA
CCGTAGGAGTGCTTTGGGTGTATCTGGGTGACTATAAAGGTGCACTACGGGTACCTCCGA
AAGTGTGTGTTGGGTTGGTACGAATCGAGATCAGGATTTGTCACTTCGTGTGACGGAGAG
GTATCTCTGGGCCCACTCGGTAGAACATCATCATGAGCTCAATGTGACTAAGGAGTTAGT
CACATGATGACGTGCTACGGAACGAGTAAAGAGACTTACCGGTAACGAGATTGAACAAGG
TATTGGTATACCGACGATCGAATCTCGGGCAAGTTCTATACCGACAGACAAAGGGAATTG
TATACGGGATTGATTGAATCCTTGACATCGTGGTTCATATGATGAGATCATCGTGGAGCA
AGTGGGAGCCACCATGGGTATCCAGACCCCGCTGATGGTTATTGGCCAGAGGGGTGTCTC
GGTCATGCCTGCCTGTCTCCCGAACCCGTAGGGTCTACACACTTAAGGTTCGGTGACGCT
AGGGTTATAGGGAATTGTTATATGAGGTTACCGAAAGTTGTTCGGAGTCCCGGATGAGAT
CCCGGACGTCACGAGGATCTCCAGAATGGTCCGGAGGTAAAGATTGATATATAGGACGGA
TGGTTTCGGACACCGGAAGTGTTTCGGGCATCACTGGTAACGTACCGGGACCACCGGGAC
CACCGGAGGTGGCCCCGGGGGTCCACTGAAGGGGGGCAACGACCCCGGGAGGTAAGGTGG
GCCAAGTGGGGGAGGGAACCAGCCCCTAGGTGGGCTGGTGCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGTAAGAGTTTGACATCAGTATCGTGTCTTCAAAGAGGA
AAGGTACTATTAGGCTGAGTTAAACGCGGCTGCTACAAATCATCCGACTGATTTCTAGCC
GTCCGTCCGATCCATCCCCTCACAGCCGTTAGATTTCGTCAACGCGTCATTCTTATCTCA
TTCTCATCTCCTTTAGCCCGCAGCGAAAGCAATGGCGGACGTTGCCATGGGAGCAGCGTC
GCCTGACTAGTAGAAGCAGACGCACCCCCTTTCCCCTCGTTAATGGAGCTTGTCATTCAC
AGCACGCACCACAACCCCGTCTCCTCTTGCAGCAGTCTAGGCGCCGACGAGTGCTGGACC
GGCGCCCTGCATCCGGGTTGCAGCTACAGGAGCACATCGATTCCTCCGTCGCGGAGGTGC
TCCATGACAGCCCATCGCAGCTCCATCACGGAATCGACGAAAAGCTAGCATGCTTCATTC
CAATGACAGCACCACCGCGGCGGAGCTCCATTGCAGCACCGGCGGCCCGTCAGAGTTTCA
CCCAACACCGACGGAAGCCCGCGATGCTTCATTGCAACGCCAGCACCAACGCGGCGGTGC
TCCATCGCAGCGCACGGTGACGACGGCGGTTCATGCTACGTCGACGACGGTTGATGCTAT
GCAGCACGAGATGGCGATGGTTGTTGCTGCTATGCGGCCACGGCAGCGGCAACGGTTGCT
GCGATGCAGTCGTGTGGTGGCGACGACCGGTTGCCGGGATGAGAAGTAGCCATGCTCCGT
TCGTCACCGCGTCAGCGGTCGGTGGTGGCTTGTTGCTGCTTCGTCAGTAGATGCTGCGAT
GCAGCGCGCGGTGGTGATGGAGGTGGCTCATATGCATCGCGTGACATGACGCAGACGTTG
CAATGAAGAGCACGGTGGTGCCGGCCTATGATGCGACGAAGAGCACGGTAGACGCTGCGA
CGAAGATCATGGCGGCGCCTGCCGACGCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTCTCTGTTATCAGCCGGTTGAAAATAAACGATTTCCTAAACG
TATTCTCTAGATATGTATAATGACTCTTGAACTACATACCAGTGTCCCAGAAAGTATTGT
TTCATTTCTTTTAATCTGATGACAAATACCAATGTACAAAATGGGTGTTTATTGGTTTTC
TGGAGCCATTGTTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCG
TTTCCACTAACGCCTCTTCCATGCATTCATTCAAGACGTGAGGCAACTCCTTCAATGCCC
TAGACGTGGGAGCCACTACTTGATTACGTGCATGCAGGTAACGCGCGTAGGAAAAAGAAC
CAGAGAGACGTGGTGATCTCCAACATTCAGATTAATGGGAAGGGGAAAAATGTGGGCTAA
CCGTTTCACTGAGGGACGTGGGACATGCTTTTGAAGGAGTCAGCGCAAAAGCCAGGAAGG
GTCACGCCTTCACGCGGGCAACGTTTTCTTTCCCGGTCGCTGGCTGCTGGACATGGCCAT
TTTTTCCTCTAACCATGCAAGGTATGTGGGACACCTCCTCCTGAATTAGGTGCATGCATG
TAAATGCGTTCAAGCACAGAAAATGGAAGGACGTGGCGCTCATAATATTTTGTAGGATGG
GCTGACCGTTTCGACAAGCTACGTTTGCTACTAATGGCCACTCGTCCGTCATCGTCTCCG
AACAATAGTTTATTGAGACGGAATGTCCATTCGAGCTACTAACACGTTGACAAACAGAAA
TTATTTCAGATGAATTTTGCATACAAATGACCAACATGCAGTGACTCGGTCGTCCTACAT
GTTGTCGCTCGGTCGGACGCGTCGTCATCACTCGGCCGCTCTGCGCACTATCGCTCAGTC
GGACACGCATCGTCCGCACTCAGCCGCCCCACGCGTCGTCACTCCGTCGGACGCGTCGTC
ATCACTCGGCCGCCCTGCATGCCGTCACGCAGTCGAACGCGTCGTGAGCACTCGGTCGCC
CCGCGCGCCGCCCCTTAGTCGGATGTCTCGTCATCACTCGGCCGCCCTGCATGCCGTCAC
TCAGTCGGACGCGTCGTCAGCGCTCAGCCGCCATGCGCGCCGTCCCTCATTCGGATCCGT
CGTCAGCACTCGGTAGCTTCGCGCATCGCCAGTCAGCAAGACAAGCCATCCTCACTCGAC
TGGAGACTCCTTCGTCACTCGGCAGCTCCGCGTGACGCCACTCGATTGGATGCTCTTTCG
TCACTCAGCAGCTCCGTGTGCCGCCACTCGATTGGACGCTCTTTCGTCACTTGGCAGCTT
CGCGTGTCGTCACTCGGCTAGAGGCTCCTTCGTCACTTGGTTGCTCTGCGCGTCGTCACT
CGGCCGCCCCGCGTGTCGCCACTCAGCTAGACGCGTCTCCATCGCTTGACCGCCCAACAC
GTCGTCACTCAGCCGGACGTGTCTACTTCGCTCGACCGCCCCGCGCGTCGTTAGGCAGCT
AAATCATTTTTTCACAGACTGCATTCTATTAAATAATCATTACCGAGTGTCGAGGAAGTC
GCACATGACGTTCACTCGGAGGCCACACCACTGAGTGTACCTCTGCACTCGGTTGTTTAT
TTTTATGTGGGAACACTTCGCTTTCGCTTCGTTTGGGTCCAGTACTCAAACGAGTTCAGC
CGGATCCTTCACTCTTTTAGACTCTTGCTGGTTCCGAACCAGCAGTCATCGTGGCACACC
CAGCGGGTGTCTATGGGTGTAATTTACACGAACTATTTCAGAAAAGATCATATTACTTTG
ATAATTTTTTATGCTGGCTTGTGCTATTTTTCATACACAGGTTACTCGACGCATCCGTGC
GCCATCCTCGTCGCTGCTCAGGCTCAGTCGCCGCAACGATCATTCAAGCGTTTTCACGTG
TTCGGAAGCCCCTTCAATGACGTAGTGGACACGGCCGCCCCGCGGGCCGTCAGTGGGTCG
GACGCCTCCTCGACATACATCACTTGGCCGCCCCGCGCGTTGCCACTCAGCCAGAATCGT
CTACCTCACTCGGATGCCATGCGCATCGCCACTCCGTGTGGCACGTCTTCATCATTCGGC
TGCCCCACGCGCCACCGCTCAGCTTAGCTGTGATTCTGTATCGCCTAAGTTAAAACAACT
CTGAGTGCGGACATGCTCCACACTCGACTCTGTATCGTCTAAGTTAAAAACAACTCTGAG
TGCGGACATGCTCCACACTCGGGGACTTAGCTGCGACTCTGTATCGCCTAAGTTAAAAAC
AACTCCGAGTGCAGACATGCTCCACACTCGGGGACTTAGCTGCGACTCTGTATCACCTAA
GTTAAAAACAACTCCGAGTGAGGACATGCTCCACACTCGGGGGCTTAGCTGCGACTCCGT
ATCGCCTAAGTTAAAAACAACTCCGAGTGCGGACATGCTCCACACTCGGGGGCTTAGCTG
CGACTCCGTATCGCCTAAGTTAAAAAACAACTCCGAGTGCGGACATGCACCACACTCGGG
GACTTAGCTGCGACTCCGTATCGCCTAAGTTAAAAAACAACTCCGAGTGCGGACATGCAC
CACACTCGGGGACTTAGCTGCGACTCCGTATCGCCTAAGTTAAAAACAACTCCAAGTGCG
GACACGCTCCACACTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
GCTAGGGACGGTGTTTTGTCTATGTATCCACACATGTAAATGAGTCTTCATTCAATACAA
TTATAGCATGGATAATAAACGATTATCTTGATACAGGAATTATAATAATAACTATATTTA
TTATTGCCTCTAGGGCATAATTCCAACAGTCTCCCACTTGCACTAGAGTCAATAATCTAG
CCCTCCTCTAGGGCATAATTCCAACACTTTTCTGGCGTCTCCTATTGTCTTGGGCAATTC
CGACATTGATTTGATCCTTGGTATGGACTAGTTGGCCATGAACAAGGCATCGATTGATTG
TGAAGCTAAGGAAGTGAAGCTTACTCACTCTTCGGAGGACGTGATTATATTCACGGCGCG
CGATGATACAATCCGTCTGTTCTCTTTGAATGAAAAGGGTGAGATTAATCCTATTTCTCA
AGTCCCAGTGGTCTGCGAATATGAAGATGTGTTTCCAGAAGAGCTGCCAAGCATGCCTCC
ACACCGAGAAGTTGAATTTGTCATTGAGCTTGAACTAGGTACTGAGCCTGTGTGCAAACG
GCCGTACAAATTGGGTCAGAAGAGTTGAAGGAGCTTAAGAGGCAACTCGATGAGCAGGAG
CGTTTGGGTCTGATCAGACCGAGCTCGTCTCCGTGGGGCTGTGGAGATTTGTCAAGAAGA
AGGATGGCACGGACTGGTTGTGTGTCGATTACCGTCCATTGAACAAGAAGACAATCAGGA
ACAAGTATCCACTTCCGAACATAGCTGAGTTGTTCGAACAATTGAACGGGGCTAAGATCT
TCTCCAAGCTCGATCTCAGAATGGGCTATCATCAAATTCGCATTCGCGAAGAGGATATTC
CGAAGACTGCTTTCAGGACTAGTTTTGGCTCATATGAGTATACTGTCATGTCTTTTGGTC
TGGCAAATGCTCCTCCGACATTTTGTCGATTGATGAACTACATATACTCTCCGTTCAAGA
ATGACTTTGTCTTGCTCTATCTCGACGACATTCTGGTCTTTTCTGAAACTGAGGAAGAAC
ATGAAGAACATCTCAGATTGGTGCTTGATAAGCTGAGGGAGTACAAATTGTATGCCATGT
TTTCCAAGTGTGAGTTCTGGTTGAAGTAAGTCGTCTATCTTTGTCACATTATCTCTGCCG
AGGGCATCAAAGTTGATCTGTTGAAGGTACATGCCATTATTGAATGGGAGCCTCCGCAGA
ATATGAAGCAGCTTCGAAGCTTTCTCAGGCTCGCAAGCTATTGTACAAGGTTCGTTGAGA
ACTTCTCCAAGATTGCTAAGCCACTCTCAAGTATTCTTCAGAAGGGTGTGAAGTATGCTT
GGTCTCGAGAGTGTCAGTTGGCCTTCGACACACTCCAAGAGAAGCTCACCTCTACTCCAG
TATTGGTTCCTCCGGATGATTCCAAGCCTTATCAGGTGTTCTGCGACGCCTCTCTTCAAG
GTCTTGGTGCAGTTCTGATGCAAGAGAAGAAAGTGGTTGCTTATACCTCCAGGCAGTTGA
AGCCAGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCTCAACC
ACAGGTAAGTCCATCAAAAGATCTCGAAGAAATTCTGCTTCGACACCAGATGTGTCTAAT
GTTGTTAATTCTGCTTCCATTGTCGATCTCGTTAAGATCGTTTGCTTGCAAGACTTCCAG
GAAACAACACCACCTCCAAGAGTAAACATATACCCAGTAGTGGCCTTCATCTCATCAGCA
TCAGAGATCCAATTCGCATCACTATACCCTTCAAGTACCGATGGGTATCCCGTACAGTGA
AGTCCGTGGTTGACAGTACCTTTCAGGTAGCGCATAATTCTTTCAACACCACAACAATGA
ACATTGCACGGGTTTGCAACAAACTGGCTAAGTTTGCTCATAGCAAATGCGATGTCAGGC
CTCGTTGCGCTATCTAGATACATAAGTGAGCCGATAATTTGAGAGAATCTCAATTGATCT
ATAGTTGTGCCTTTGAACATTCGAATCAGCACACTAGGATCATATGGTGTTTGAGAAATT
TTGCAGTCTGAATATCCAAAGTGACTCAAAATCTTATCAACATAGTGGGGTTGCAGAAGT
GTAATCCCACCCTCATCATCTCTCAAGAGCTTCATGTTCAAGATAACATCACCTACTCCA
AGGTCCTTCTTCTCAAAGTTTTGAGACAGAAAGTACTTAACCTCCTCAATCACCTTGAGA
TTGGTTCCAAATATCAGCATGTCATCAACATACACGCACAGTATAACTCCTTCGCTCCCA
CCATGGCAATAGTATACACACTTCTCAGCTTCATTAATAGCGAATCCAACAGATTTCAGA
GTTGTATTAAACTTATCATGCCATTGCTTAGGTGCTTGCTTCAGGCCATATAAAAATTTC
AACAACTTACACACTTTTCCTTCCTGACCATCTATCACAAAGCCATCTGGCTGTTGCATA
TAGATTCCCTCGTCTAGCTCTCTGTTCAGGAAAGCCGTCTTAACGTCCATTTGATGAACA
AGAAGACCATGCGAGGCTGCCAATGAGAGTAGTACTCGAATGGTGGTCAGTCTGGACACA
GGTGAATAAGTGTCAAAGAAATCTTCTTCTTCTTTGTGGGCATAGCCCTTAGCCACAAGC
CTAGCCTTGTACTTTTTGATTGTACCATCGGGCCTAAGCTTCCTTTTGAACACACACTTG
CATCCCAGTGGTTTACAACCATAGGGACGATCAGTAATTTCTCATGTCCCATTAGCCATG
ATGGAATCCATCTCGCTACGGACCGCAACTTTCCANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCCAAGGTCCTTCATTGAAAAACTTTTGTTCAAATAGGCCTTTAT
GCTCTCCAACATCTCTATATTATTCCCCATCAATAATATGTCATCCACATACAGTATGAG
GAAAGCTACAGAGCTCCCACTCACTTTCTTGTACACACAGGCTTCTCCGTAAACCTGTAT
GAACCCAAACGCTTTAATTACCTCATTAAAGCGAATGTTCCAACTCCGAGATGCTTGCAC
CAGCCCATAGATGGAGCGCTGGAGCTTGCACACTTTGTTAGAACCCTTAGGGTCGACAAA
ACCTTCTGGTTGCATCATATACAACTCTTCCTTGAGGTTCCCGTTAAGAAACGCTGTGTT
GACGTCCATTTGCCAAATTTCATAATCATAAAAGGCGACAATTGCTAACATGATTCGGAC
TAATTTCAGCTTCGCTATGAGAGAGAAAGTCTCTTCGTAGTCAACTCCTTGAATTTGTCG
AAAACCCTTTGCGACAAGTCGAGCTTTATAAACGGTTACATTACCGTTTGCATCAGTCTT
CTTCTTGAAGATCCATTTATTTTCTATGGCTTGCCGGTCATCAGGCAAGTGCACCAAAGT
CCATACTTTGTTCTCATACATGGATCCTATCTCGGATTTCATAGCCTCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTCTAACAAC
ATGGTTTCCATCACAGGGTTGCCGTACCACTCTGGTGCGGAGCGTGCCCTTGTGGACCTT
CGCGGTTCAGTAGTAACTTGATCCGAAGCTTCATGATCATCATCATTAACTTCCTCTTCA
GTTGGTGTAGGCGCCATAGGAACAACTTCCCGCGCTGCACTACTATCCTGTTCGAGAGGG
GGTGTAATTACCTCATCAAGTTCTACTTTCCTCCCACTTACTTCTTTCGAGAGAAACTCT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATGGCATCAGAAACTA
TGATCTCTAAGTTGTCATTGCAAACATGGTTCTCTCACAACAAAGCTAAATCTGGATCGA
CAAGCTAGTCATATTTACAAAAACAAAATAGACAGAGTTCATACCAGCTTTTCAGTCTCA
GTCACTTCATCATATATCATCATTGTTGCCTGTCATTTGCACGATCGAACGATGTGAACA
ATAATAAGCGCATTGGACTAAGCTGAATCTGCAGGCAAACACAAAGGAGAAGACAAAATA
ATATGGCTCTTTGAAAGCTAAACAGGTAAGCATGCAAGAACCAATAAACATTGTAACCAA
TATCTTCTACCTTGACACAAAGAAAAAGAAAACTGTTTACACGGGAAAGCTCCCAACAAG
CAAAAGAAGAAAGAAATATCTTTTTGAGTTTTCTCAAAAGGACACAAAACAAGAAAACAA
AAAGAAACTAGCATGGATAATACAGTGGCAAAGTGTAAACACCGGCTAACAAAGTGAAAG
CATAAGCATGAATGTAAAGTCGGTGAGAACACGTACTCCCCCAAGCTTAGGTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTATGTAGTATCTTCGTTTAACCTGAAAGTCAAAGAAAG
CAGGAGCAGGAAGGGTAATATGGAAAACACGCTGTCGGTTAAGTATCAAGCGGTATAGGA
GGGATCCATGATTTCTCTCAAGGAACTGGTAGCGTGTTAGAGCGACACGATCAAGGTAGG
CTGTACGGAGAGGAGGGTCTTCTGGACGGATGGATACTCCAAGAAAATTTGCTAAGCGTG
TAGCATAAACTCCACCAAAGAAATCCCCCTCAGTGGCATTTTTATTCAGCCTCCTTGCTA
TTATAGCTCCCATATTGAAGCTCCTGTCACCTGTTACTGCGCTCTTAAGGATACTAAGGT
CGGAAGCGCATAGGTGACAATGTGCACCCTTGCCGTTAATGCACCTACCTATGAAGAGGG
CAAGGTAGTGCAAGGCAGGGAAATGGATGCTTCCTATGGTGGCTTGCGTGATATCACTGG
TTTCTCCAACAGTTATACTGGAGACAAAGTCTCTCACCGAAGACTTAAGAGGATCATTAA
TACTACCTCCATCGGGTATCTTGCAAATCCTATTGAAATCCTCCAGACCCACGGTATAGG
ATTTATCGTACAGATCAAACAGTATGGATGATTCACGGCCAACTAAAAATTTAAATCTAC
GCACGAAATAGGCAGTGAGCATAGCATACTGTTCACATTTATCTGAGAGGAATTCTTCTA
ACCCGGCATTGCGGACAAGTGCATCAAACTCATCCTTGAAGCCTGCTTCGATCATGAACT
CATCAGAAGGCCATTCACATGGTTGCACCGGTGCGTCCCTTAGTTGAAAAGGTTCGGGCT
CCCGAAAGGAGAGACGAGGACCCTTCTTACTTGAGGAACCACCATGAAACTTCCTCCTGA
ACATAATTTCCTTTTGCTGAAATTTTTGAAGTTCAAGAGAAAAGTGAATGAGGACCAACC
ATACCTTGTAGCAACTACTCCTACCAGTGCCTAGAGACCGTATCACGCGCTAAAACTACT
TGGGACCAGCTAAAATCAACTTTTCTAGCTCAAGGACAGGGTCACCAAGGTAGCAAGAAT
TCGCGAAGGATAAAGCACTAGAGCAAAAACTAATTGGACCAATGGAGGAGTCACTTACCA
AGGAGCAATTTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGT
ATCGGCTTTCCTATGGACTCAAGTGTGATTTCTCACAAAATGAAAAATGTAGAGTCTTGA
AGCTTCTTGCTAATAGACGTTCCTTGAATCTAGGGGATCTCCTCACAATCCTTAGCCAAT
CCATTCATTGAACTTTTCCTGAAATATATTTGGTAGAATCATTAGCCCAATGACATATAT
GTTGTTATTAATTACCAAAACCACCTAGGGAGAAGTTGTGCTTTCAATCTCCCCCTTTTT
GGTAATTGATGACAACATATAGATCAAAGCTTCGACATAAATTATAATCAATGAATAGCA
TCACCGCTTTGAGAAGTGTGTGATAACCAAGAGCTCCCACTAAATTTGTGCAATNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGAATGCAAATGGACAATCGATTAGGATCATGGGCCACTCTTCCATGT
CACATACATCTTGTTGGTGCATGTAAATGATATGAGTGGATTATAATGCACATAACACCA
ATAATGAGCGAATTATCATCACATAGATATCTCAAAGATAGGAAGTAGTAGCATCAAACA
TAAAGCATATGATCAATCACAACAAGGTTTTAAGACATCCACACGATAAACGAAATGTTT
TAAGAAACCAAAGAGAGCAACCAAAATGCAACACACGCTCTCTCGAATCCCTATGGTCTA
TACACTTCTACCCCTTTGGCAACAAGTTACCAAAAAAGTTCAAAGGTATAGAGGTAAGCG
TCGTTCTCGGAACGGTCTCCTCCTGTAGTTGTGGAAGGAATCGATAGAAGAGCATCGTCG
AAGGCTTCACATGATTTTCTCTCAGGTGATGGTGTAGACATTGGACGTGTAGGAGCCGAT
GGAGGTGATGAAGATGGTCTCGACTCTGGAACTGGCACGACAGAAGATCTAGCATGTGTC
CTGAACTAAGTGCGTGTCTAGAGAGGAGGACTATCATCATCTCAGTGGAGCTAGGAGCAG
GAAATGGATCTACCTCCTACTTCAACTGGTTGGCCGTAGTAGTCACCTCAGTCACCTTGA
TATCCAGGTCATGAAGTTTTGTTTCCATTTTCCGCTCAAGGCTCTTCTGATTCAGCAGAA
TGTCTTTGATGTTCTTTTCCATCCCTTGGATGGTGCTGATAAGAAATGACATCTGACCAC
TGTTGGTCTTGGGCACTAGAACACTAGTGGCTATGGCTGCCTCAGCCTCAGCCTCAGCCT
CTACCTCAGCATGAGTTTTAGTTGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCCTTCTCCTTGTGCTAGATATTTGTTATGCACTAGGGGAAGTAGGAGTAGCG
ACCATCATCGACGGTCAAAAAATCGGTCATGGACTGTCCACCATATGTGGGAGAAGAAGA
ATGCCGACTGTTGTCCTGGGGGTCGCTCCTCCTCCTTCTCCTTGTGCTAGATATTTGTTA
TGCACTAGGGGAAGTAGGAATAGCGACCATCATCGACGGTCGAAAATTCGGTGAGGGACT
GTCCACCATGTTGCCGTTGCATATTGAGTAATAGTGATCTGTCATATAAGTTTCCTGGTA
GTTGCCTCCAGTTTCCTGAAAGTAGGAGTATTTTCCTGGACTTCGAGATATTAGTACTCA
AAATGTGCGACCACTAGTGTGCGTATTAAACAACAGTCAAATATATTTAGTAAAGATGGT
AATATTTTTACTATTTGTCCTCAGTGCATCCTTTGCATACATTAGTTTTCAAGCTAAACT
TCATTGCTAAGTATGTTACATCTATGTATTGAACATGGACTCCCGATGAGTACTGTTCCT
CGTTGGATCGAGTTTAAAGGTCGCGTGCTTCAGTCCGGGACAACCCTGTGCCGTCTTTGG
ATATGACGATCATCACCGGAGCCCTATCAGATATGACAGGTCACGACATGAAGGAGTATG
CCACCATGAGTTAGGCCGCTTCGACCCATGCATCGTCTTCCTTCTCCTTCTTTCTTTTCT
TTTTTGATATCGTCTTCCTTGTCCTAACACCAATGCACATACATGCATGCATAGCAGTAT
TAGACCTCTTTCCAGGCTACTAAGTGTTTCTTTCAGTGAGTAGGCTAGGGTAGTAATACA
TGTGTATATACATAGACAAATCATTGTCCCTAGTAAGCCTCTAGTTGACTAGCTCGTTGA
TCAAAGATGGTCAAGGTTTCCTGACCATAGACAAGTGTTGTCACTTGATAACGGGATCAC
ATCATTGGGAGAATGATGTGATGGACAAGACCCAAACTATAAACATAGCATATGATCGTG
TCAGTTTATTGCTATTGTTTTCTGCATATCAATGTATCTGTTCCTATGACCATGAGATCA
TGCAACTCCCGTACACTGGAGGAATACCTTGTGGGTTATCAAACGTCGCAACATAACTAG
GTGACTATAAAGGTGCTCTACAGATATCTCCAAAGATGTCTGTTGGGTTGGCATGGATCA
AGACTGGGATTTGTCACTCCGTATGACGGAGAGGTATCTCGGAGCCCACTCGGTAATACA
ACATCACACACAAGCCTTACGGAGAGGTATCTCGGGGCCCACTCGGTAATACAACATCAC
ACACAAGCCTTGCAAGCAATGTGACTTAGTGTAAGTTGCGGGATCTTGTATTACGGAACG
AGTAAAGAGACTTGCCGGTAAACGAGATTGAAATAGGTATACGGATACTGACGATCGAAT
CTCGGGCAAGTAACATACCGAAGGACAAAGGGAATGACATACGGGATTATATGAATCCTT
GGCACTGAGGTTCAAACGATAAGATCTTCGTAGAATATGTAGGATCCAATATGGGCATCC
AGGTCCCGCTATTGGATATTGACCGAGGAGTCTCTCGGGTCATGTCTACATAGTTCTCGA
ACCCGCAGGGTCTGCACACTTAAGGTTCGACGTTGTTTTATGCGTATTTGAGTTATATGG
TTGGTTACCGAATGTTGTTCGGAGTCCCGGATGAGATCACGGACGTCACGAGGGTTTCCG
GAATGGTCCGGAAACGAAGATTGATATATAGGATGACCTCATTTGGTTACCGGAAGGTTT
TCGTGCATTACCGGAAAAGTTTCGGGCTCATCGGTAGTGTACCGGGAGGGCCGGGAGGGG
TGCCGGGGACCATCGGGAGGGGTGTCACGCCCCAAGGGGTCTCATGGGCTATGGGAAGAG
ATAAACCAGCCCCTAGTGGATTGGAATAAGTTCCCACTAAGGCCCATAAGGTTTGAGAAG
GAAAAAACACAAGGTGGAAAGAGTTTCCAAGTGGGAAGGTGGAATCCTACTCCAAGTAGG
ATTGGAGTAGGACTCCTCCACCTCCAATTTCGGCCAAACCTTTAGGTTTTGAGGCTGCCT
CCTCCCCTCCCTCCCACCTATATATACGGAGGTTTTAGGGCTGATTTGAGACGACTTTTC
TCACGGCTGCCCGACCACATACCTCCATAGTTTTTCCTCTAGATCGCGTTTCTGCGGAGC
TCGGGCGGAGCCCTGCTGAGACAAGATCATCACCAACCTCCGGAGCGCCGTCACCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCCAACCTCCGGAGCGCCGCCACGCTGCC
GGAGAACTCTTCTACCTCTCCGTCTCTCTTGCTGGATCAAGAAGGCCGAGATCATCGTAG
AGCTGTACGTGTGCTGAACGCGGAGGTGCCGTCCGTTCGGTACTAGATCGTGGGACTGAT
CGCGGGATTGTTCGCGGGGCGGATCGAGGGACGTGAGGACGTTCCACTACATCAACCGCG
TTCACTAACGCTTCTGCTGTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGAAATGCGCCCGAAAGAGTGGAGGTACCAACAAAAACCACTCAACCCCCTATTCAA
AGCAAGAGGGGGAGAAATACGACCACAGAACATTATTCAACTTCTCGCAAGCAACAAAGG
AAACAGGGGAAGAAACCTTCTGAACCAGTAAATGTAAATCAACCTAGCGTTGATAATCAT
CAAATGGGTAATGAACACCCAGTGGAAGAACGACNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATCATCGGAAAACCCTGACTTAATCGTATTGGGAAATCACGACCATGGGTAA
ATGAAATTTCCACCAACTATATGGATTCTGGAGAATGTTACAATCGTAAGTCTACTATTG
TCGACATATATTTCTCAACTACAGTTGCAGACAACCTTCTAAATGATCATGATCCAAAGA
CCATGGCAGAGTGCAAGAAACTCTCCGCCTGGCCTAAATGGAAGGATGCAATCCAAGTAG
AGTTAGCCTCGCTCAATAAACGAAAGGTATTCACTGAAGCAATACCTACACCTCCCAGAG
TTTTCGCTGTGGGATTCAAATGGGTTTTCGTCCGTAAAAGAAACGAGAACAACGAGGTGG
TGAGATATAAAGCAAGGCTTGTAGCCCAAGGTTTCACGCAGAGACCAGACATTGATTTCA
ATGAAACATACTCTCCAGTAATGAGTGGTATTACTTTCCGATACCTAATTTCTATGGCAG
TACAATATCGTCTATCTATGCAGTTGATGGACGTAGTGACCGCTTACCTTTACGGTTCAC
TTGATATAGACATATACATGAAGGTTCCTGATGGAGTCCCAATCCTGAATCCAAATGCAA
AACGCAACGCATATTGTGTAAAACTAAACAAGTCTTTATACGGCTTAAAACAGTCGGGTC
GCATGTGGTACAACCGACTTAGTGAGTTCTTTCTGAAAAGTGGATACTCCAATAATGATG
ATTGCCCATGTGTTTTCATAAAAAGGTCCGCAACCGGATTTTGCATTATTTCAGTGTATG
TTGATGATCTTAACATCATTGGAACCACCGAAGACATTGATGAAGCACGCAATCACTTAA
AGACGGAATTTGAAATGAAGGATTTGGGTAAAACCAAATTTTGCTTAGGATTGCAACTTG
AGCACCTTCCCTCGGGTATTTTGGTTCATCAAACCGCCTATATCCAGAAAATATTGAAGA
AATTCAATATGGACAAATCCTACCCATCCAAAACCCCTTTGGTAGTTTGATCTCTAGACA
TAGAGAAAGATCAATTTAGACCAACGGATGATGGAGAAAAGATATTAGGACCGGAAGTTC
CATATCTTGGTGCCGTTGGAATGCTCATGTATCTTGCAAATTGCACCAGACCTGATATTG
CATTTGTAGTGAATTTACTGGCTAGGCATAGTGCAACGCCCACTAAACACCATTGGACTG
GAGTTAAGAATATCTTTCGATATCTCCAAGACGCAAAGGATCTTGGCCTATTCTTTCAAT
TTCAAAGAAATTTGGACATTGATTTGATTGGGTATACAGATGTTCGCTACTTATCTGACC
TCCATAATGCCAGATCACACACCGGTTTCGTGTTCCTACATGGTGGGGTAGCCATATCAT
GGAAGTCTTCCAAGAAGACCCTAGTGGCTACATCCACCAATCATTCTGAAATAATCGCAT
TATATGAAGCGTCACGTGAATGTGTATGGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCCCATCAATTACAGAAGAAAGGGAAGATAAACATTTTGCAAGTAAATCGT
GCGATAATCTCGCTGACCTATTTACAAAATCACTCCCAGCTTCAACATTTGAAAATGTGT
TCATGGGATAGGTATGCGACGACTTCGGGATTTGCACAGATCAGGGGGAGTTTCTCTCTG
AAAAATAACCCGTTCAAACATTATATTGCACTCGTTTTCCCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAAGAGACAATAACCATTATAT
GTTGTATCATTTTCTCCTTATTTTCTCATTGGGTTTTAAAGGAATTTTAACTTTTGGGGA
ACGTTGCATGGGAAACAAAAAATTTCCTACGCACACGAAGACCTATCATGGTGATGATCA
TCTACGAGAGGGAGATCGGATCCACATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTAGAAAACTGATCTAGAG
GAAGAACTACGAAGTAGAGGTTTAGGGTTGCACGTGGAAAAAGTTGTGTCTCAAAAGCCC
TAAACCTCTAGTATATATAGGAGGAGGGAGGTGTTGGGGAACGTCGCATGGGAAACAAAA
ATTTTCCTACGCGCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
AACGAAACGAGCTGAGAGAAACATCAAACATGGCACTCCTACTGTAACTGGCTGGAAGGA
AAAGTCAGACACTCTGTATGCACCCGGGCAGGCAACCGCTCGGCGGCCGCGCCGTGGCCT
GCTCTGGGTCTCCCGTTCAGAATTCAGATTCCTCCCAAGTTTTGGTTTCAGATTCACAGA
ATCCACACGAGAGGAGGAGCCTCTCGTCTCCCTGGTCCACACACGCAAGGCGCCGTGCGT
GCTACTACCAGCTTGTCAAATGACGCGCGGGGTCACACGAGAATTCCATTTTCTGAATCT
TCCTCGTGCCAAATTTACCATGGAATTCTTGAATCTCCAGCTCCGTGGCCCGTCGCGCCA
ACCGGTCGACGCCGCGTGTCCGCCCGGCGTGGGGGTTTTCCCTGGTGGTGCTAAGCTGAA
AACCGCGCGCCTCCTGGGCCTCAGAAAAATTGGTTGGTGAGCGTCGCGGCCAAGCCAGCG
CCAGCCACGACGACCCGGGCCAGGAGGAAGCAGCAGTTCAACACCACCTCTTCTTCCTCC
GCCGGCCACTTACTTGCTCCTCCCTTGGTTTTTATATACCACATACTGACACGAGCCAAG
GAATTCATTAGCTGCTCCATTGATCGAGGATGACCGGAGTTCAGGTGATGCCGGGGGTGG
GCGCGGTGACCACGGTCGACGTGAGGGCGGAGGGCGGCAAGGCGATGGCAGTGCTCGCGA
GGAGGCGCGTGGGGGTGGGGAGCAGCTCAAGCACGAGCCTGTTCGCCGGGGACTCGAGGA
GGAGGCCTCGCCGGGCGACGTGCTCGGTCAGGCTCAGGCAGTGTGGCCGCGGCAGGGGCG
GCAGGAGCGGCGGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCG
GCCTCGCCATCGTAAGCAACCTCGGGGGCAACTACGATGTTGGCTTTGGCGACGTCGACT
TGGTAATCCATTCATCAACATCTCCTCTTCCATCTACTTTTCGAATTCTTGAACTTCTTA
TTCTCAGCCACATATATGCGAAGCTACCGAAGACACGTTGGGGAATNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTAAGGATATAGTAGTGGTGGATCTTCTCCTCAT
TAGTGAAAAAGTTGGCTATTTCGGATAGTTTGGCAAGATGGGCTATGACCGTCTCAGACT
CATAACCGTCAAAAGGATCAGATTTGACTAGAGAGATTATCTCAGGGTTGACAGAGAATT
CATAATCCTTATCGGTGACAAAGATAGGCGAAGTGGCAAACTTCGGGTCATTTTTCATCC
TAGCTTCACGAGATTTTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTACA
CGCAAGAAAATCCTTAGCTATCTCTCCCTCCATAACGTAACCCTCAGGTATATCAGGCAG
TTCATATCTAGGAGAGCTAGATCTAGCAGGAGCAAAAGCAGGTTCTATCTCAATAGTATC
GGCAGTATCAGAAGCATCACGTGCATTGGCAGTAACTCTAGCAATATGAGCATCACGGAA
CACTCCTAGTGGAACATCAGGCAAAGGAGTATCTCTAGCAGTATCAAGCATAGCATCATC
AGGCAAAATAGCATCTCTAGCATCATCAGGCAAAGCAGTATCAAGCATAGAATCTCTAAC
AGTATCAGGCATAGTATCAAGCATAGCATCTCTAGCAGTATCAGACATAGTATCAAGCAT
AGCATCTCTAGCAGTAGTATCACAAGCATCATCAAGCACAGGCGACATATCAAGATTTCT
AGCAGGAGGTGATGTCGCAAACTTACTCATAACTGAAGGTGAATGAAGTGCAGAGCTAGA
TGGCAATTCCTTACCTACCCTCGTAATTGGAGGGAAAGACTTTGGTTTTTGGATCCTTCA
GATTCTTCATAGTGATCAGCAGATATAAATCCCAAGTGACTCAGAGAATATAGCAATACC
TCCCCGGCAACGGCGCCAGAAAAATGCTGATTGCGCATTCTGTGGCGTTAACTAGACGAA
TGCTTATGACAACAAAACTTCTCCTGCAATGGCACCAGAAGAATGCTGATAGCACTCCCC
AGCAATGAAACTGGAATAATGTTGTTGATGGCCCACCAGTGCGTGGGTTCGTAGCAATTT
TCGAGGGTAGAGTATTCAACCCAAATTTGTAGATCGCCTGAAGGAGGTGAGAGAATACTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATTCAACCACACCTGAAAG
ATTAGTATCTGCAAGCACAGTAGTAATAGCAAAGTAATATGATAACAACGGTGTCAGAAA
CGATCTGTTGACGGTAGACTATTCCTAACGATTGTATCAATGGCGCTTTTGTTGCCGCGT
TGACGGAAGTTGTCAATTCCCGTCAACGGTCTGGCGAATCGACAGTGTAGCAGGTAGTAG
CAGTGTAACGAGCAATAGCAGTGGCAAGGAACAACAGTAGTGACAACAGTAGCAAGTAGA
GCAGAGCAAGACAAGTAACAGCAGTAGCAACAGTAGTAGCAGCAGCAGAGCAAGACAAGT
AACAGCAGTAGCAACAGTAGTAGCAGCAGCAGAGCAAGACAAGTAACAGCAGTAGCAACA
GTAGTAGCAGCAGCAGAGCAAGACAAGTAACAGAAGTAGCAAGAGTAGTAGCAGCAGAGC
AAGACAAGTAATCAGTAGCAAGCAACAGTAGTGGCAGCAGTAGAGCAAGACAAGTAACAG
CAGTAGCAACAGTAGTAGCAGCAGCAGAGCAAGACAAGTAACATCAGTAGCAACAGTAGT
AGCAGCAGCAGAGCAAGACAAGTAACAGCAGTAGCAACAGTAGTAGCAGCAGAGCAAGAC
AAGTAACAACAGTAGTAGGACAAACTCGTAGGCAATGGGTCGGTGATTTGTTTGGATGAC
AATAGTAGTAGCAGCAGCAGAGCAAGACAAGTAACAGCAGTAGCAACAGTAGTAGCAGCA
GAGCAAGACAAGTAACAACAGTAGTAGGACAAACTCGTAGGCAATGGGTCACTCATTTGT
TTGGATGATATTCATCATGCAACAGCTATAACACGGGGAGATAAGTGGCTAGCTCCCGTT
CATCAGTGTGATGTAGGCATGCATTCCGTGTGTCGTCATACGTGCTTAGGGAAAAGAACT
TGCATGACATCTATTGTCCATCCCTCCCGTGGCAGCGGGGTCCAAAAGCAAACTACGAGA
TATTAAGGTTATCCTTTTAATAAAGAATCGGACCAACGCATTAGCACTTAGTGAACACAT
GAACTCCTCAAACTATGGTCATCACCGGGAGTGGTTCCGGTTATTGTCACTCCGGGGTTG
CCGGATCATAACACATAGTAGGTAACTACAACTTGCAAGATCGGATCTAAAACACACATA
TATTGGTGGCAACATAATAATTTCAGATCTGAAATCATGGCACTTGAGCCCTAGTGACAA
GTATTAAGCATGGCAAAGTAGTAGCAACATCAATCTCAGAACACAGTGGATACTAGGGAT
CAATCCCCATCAAAACTAACTCGATTACATGATAGATCTCATCCTACTCATCACCGCCCA
GCGAGCCTATGAATAGATTACTCACGAATGACGAAGAGCTTAGTGGAATTGGAGAGGGAG
GAAGGTTGATGATGACGATGGCGACGATTTCCCCTCTCCGGAGCCCAAGACGGACTCCAG
ATCTGCCCTCCAGATGAAGAACAGGTGGTGGCGGCGCCTCCGTATCGAAAACGCGACGAA
AACTTCTCTTTTTTATTTTTTCTGGGATGATAGACAACTTANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTAGCTGGGACACCAGCTACTCTTCGTCGTCGATGTCTA
CGAAGAACCCTCCATTAGGGTCATTAGCAACCTCTGCAACATTATTAAGCAAACATGAGT
ACGAAGGTACTCAGCAAGACTTTAGGATGGCTAACTACTCATGCAAGGTATCAAGAAGGT
ATTGTGGGGTTTCATGCGGGAAGCCAGCATTTGACTCGTGGCTAGACAACTTGCTTTTTG
AAATTAGTTTTGACAACTTGATTTCTCGCACACGAGTCCACTAACACCACAACAATACAC
TATCGTGGAATCATTCCGTCTCCATACGGAAATGCCGTCCACGACACTCACGCTTATCTT
GACAATTTTATGAGTAGCCATTGAAATTATCTATGAACAACATATGTCTCCAAGTAGTCC
ATATCCGCGGACGCGGCTATTCGAATAGATCATAACCCTGCAGGGTGTACTTCGTCACAC
ACGCTCCCGCCACTTATCGCCATGTGCACGTCATGCACCTCGGCAACCTTCAAGCGGAAG
CCCAGCGAGGGAGTCGGCCACGACCGTTAACCACACTAGTACCTAGTCCAGGTTTATCGC
CTATCTGAGAGTAACCCGTACGGAAGTCCGGCCGAGGTTTCCGCCACGGCCTCAAACGAT
GTGCGCAGGGTTCCCAAGCCCACCATCCGGGTGCCACTTGGTACACCGTGCCACTGCCTA
CCGCATCATGGTCCACCTCTCAGGTCAGCACCATGCACGGCTTCCAGCATTACTATAAAC
ACCAGAAACTACTTGCAACTCCTGGACCGAGTACTACGCGATTAATAGGCCGAGCGGGGT
CATATTTCAGGGCCCAGCATGTGGTAGTATCTAGTCTTGGATTACATACACGGAACTCAG
TTCCTAAGGACGGTTCCAATGAAACAACCCACCATGTACTCCTACATAGCCTTTAACCGG
TACCTTTACCAAATCAAGTTCAACACACGACCTTTGCTCACCGAACACATTCCACATTTC
TGTTCATCTCCCAGATGACTGACCATACACAACTCTAAGCATAGCATGCATAGCAGGATA
AGGCACATCATAGCTCAAGCAACTACCAGGTATGCTAGGTTGCAAGGTTCGGCTATTTAC
CGTGACAAGGTTAAGTCATGCAAAGGAAGTGGGTCCAACTATCGTGGCAAAAGCAGTTGA
AGCATTTGATCCTAATGCATTAAATAGGTGCAGGAGCAAGAACATAGGTGTTATCGGGAT
GATCAAAAGGGGTGCTTGCCTTGTTGCTCAGAGGAGGAACGATATCCGTCAGACGGATAT
TCGGTGGAATCCGGGGGTGCGGAGCCTACCGAAATGAACGGCAACATTCAATAACAATCA
TATGCAATCAAAATGATGCATGAGCATGGCATGAGAATGTATTCTCGGTAAGAAAGGTTA
TCTTGTAGATCAAGCGTTTCGTGGTCCACTTCACGGATAGGATCCGAAAAGCAACGCCTG
AGTTGCGAGACGTGGAAAACATCATGAACCTTGGAAAGATGCGGAGGAAGTTCCAACTGG
TAGGCAACTTCTCCTCGTTTGGCAAGAATGCGAAAAGGTCCAATGTAACGAGGAGCCAAC
TTGCCCTTGATACCGAAACGATGGGTACCCTTCAAAGGTGTAACCCGAAGGTAAGCCTTC
TCGTCAAATTCAAAGGTCACAGCCTTATGATGACGATCATATTGGCTCTTTTGACGAGAC
TGGGCTGTTTTCAACTTTTCACGAATAATGCGAACCTGCTCTTCTGCATCCTGGATCATG
TCCGGGCCAAAGAGTTGCCTCTCTCCGGTTTCTGACCAATTAAGAGGTGTTCGACATCTT
CGTCCATAGAGAACTTCAAAAGGGGCTTTGCCCAAGCTTGATTGATAACTATTGTTATAA
GCGAATTCGGCGAATGGAAGGCACTTCTCCCAATTCATACCGAACGAAATAACACAAGCT
CGGAGCATATCTTCTAAGTTTTGCTTCACTCTTTCTACTTGACCACTTGACTGGGGATGG
AAAGCAGTGCTAAAAGATAGGTGAGTCCCCATGGCATTCTGAAAACTTCCCCAGAAGCGA
GAAGTAAAGATACTTCCACGGTCCGAGTTAATTTCCAGGGGAACACCATGAAGAGACACT
ATTCGAGAGATATATAACTCTGCTAGCTGGCTAGCTGTTATACTCTCACGAACAGGAAGA
AAATGAGCCACTTTGGAAAGACGGTCAATGACCACAAAGATAGCATTGTTTCCTTTCTTG
GTCTTGGGAAATCCGCTAATGAACATCCTAAATATTGGGTTTATTGACCCAGATAAAATA
CATATAGCGACGCTAACTGATAAACCCAAGGAGACGGAGGAAAACCTTCTAAGGTTTCTA
ACAGATCAAAATTTCTGTGACCACATACTGTTTCCATACAACTTCAAGTGAGGGTCTTTA
CTCTGTTGTGTCCATTCACTTATAAGTGTAATTGATAAGTTACTGACACACATATATATA
TACATGTGCAACTTCCATTGGATTTTGTTGGACATTCAAATTGATAAGGGAAGAGTTGAT
GCCTTCGACCCATTATCGAGACCCTTGGAACAGTTCCAAAGCCTGCAGGACATGCTTCAA
GGGTAATTTCAATCATTCTTGCGCTCTATCGGTCTCTTTCGATGATTTTCTGATATATCA
ATTAATGAAAAACTTAGCAAATCATTTTCCTTGTCGGGCAGGGTTTAGAAGCGGTTCAAG
TGCGTGACTCCCTCTATCGAGCATGAGAAGCTGACCTTTAGAGCGACTCATGTAAGTAGT
AGTATGATATACTTCTATTTTCAATACATTTATGATGCTAGATTATTATTTTGATTATAT
ATATTATATTCTCGTAAAGTGCGACCAGCAGCCACGGGGGACGCATCTATGCGAATACTA
TGTTTGCGAGACCATTCGCACGTTTACCTCTGAGCACAAGGATTACAGATACGACGTAAG
AAATGAACATTCACACCTCTATTTTTACCCATCATTCTTTGTTATCATGATTGATATTCA
TATTCATCTCCTCTTCTTATATAGTACACGGCCATGAGGGAGAAGTCCCTACCAGAGCAA
CGCGCGATTGCTGTTGCAGAGGAGCTTGCGACCTTTCTGAGGACAGAAGCTATAGATGAC
AAAGGACGATTTAGTGTAGCTAGGGGCCATTACTGATGTTGGTCCATGTAATCGAATAGA
CGGGCTCTAGTCCCGATAATTCAGATCTCCATATAATTGTATATATATGCTCGCTTGTAA
GATAAGTTAATCTTATATATATACATATGCATAAACATGTATATTTAGAATTATATGAAA
ACTAATTCCCGAACACCAAACGAGGCATCACGTTAATCTCCCGAACACCTAAACCCTAAA
ACCCTAAAATAAACAAAATCTGCAGAAACTCTTTAGTCCCGGTCCGTGTTAAGACCCGGG
ACTAAAGGGCCTGCCCCTGAGGGCGCTCCGAGGCGCCCACGTGGAGCACCTTTGGTCCCG
GCTTGGAACAGGGCCGGGACTAAAGGTTAGGCCTTTAGTCCCGCCCCTTTGGTCCCGGTT
GGTGAACTGGGACTAAAGCCCCTTACGGGCCGGGACTATAGGCTCTGTCCCCACTAGTGG
AGTAAGTCGCTGCCACTTAGTCGCCCCTCTAGTATTAGTCAGACCGAAAGCCTAGACATA
GTCTTTCGCTTTATCCGTTACAAGCCTCTGTTACTGTATATTCTAGCTTAGTTCATCATA
CGTCTTAATTGTAGTTTCCTTAAAGAAAACCTTCAGTTATCACTTTCCTACCAACCGATG
GAATAGAATATATTGATCAGAGTTTAAGCTCAGCGATTGTTGGCATCTGTCGTACTTTTT
GAGGGCTTTAATATCCTTTACGTGTATAAGTTATATTATTGGCATCGGTGGTCTGCATGC
TAGGCCCGGGAATGCATCGAATAATTTAACTTCTTCATATTGTCAAGACTAGACACTCTT
AACCATACACCAATGCAAGGTGGTTTGTATGCACAAGATTTGGAGGAGAAAGCAATAGAG
GTGAGTGCGAGTACTTGAGCAGTCCAAGCGATGTGTGTATTGCAAGGCTACATGTCAACG
GCGGTTAGCGACTTTCTGGTTACTTGGAGCTTAGGATCTCTGATTGGCAAGACAGAAAAG
GTAGACATGAGGTTTACCCGAGCTAAAGGAGTTGCTCGTGTGCTTGTTAGTGTCATTGAC
ATCGCACTGGTGCCGGATGAGGTGGTTTGGATGCACGCGGGGATGAGATATACCCTCCAG
CTTGAGATTGCGAGTCCTCCTTTATTTGAGGAAGGAGTGCCGGATAAGGATGTGGATATG
ACTGATGGGGATGATGAGTCGGGGTCAAAGGAGGCCGATAAGAGCGACCACAAGCCTGCT
AACGCTAAGGAACCAGCGGCTTCACACGTGACGGGGGCGGTTGGAGGTGCTGTTTCTGTT
ACAGCTCCGTTGGCGCAGCTTCGGTTTGGCTCTTTTGGTCCGGCCTCGACTCCGGCCAAG
CTTGGTGGTGGCCGCTTAGTGGCAAGCTTCGAGGGGCAGCGGCGTAAGATCTTGTTTCCT
CGGAAGCTGCCCATCGAGGATGCGCAGGGGCCAGTCTCGCCTACGGTGGGATTGCCGGCT
GTCTCTCTTGACACATATCTTGCAGAAGCACGGAAGGAGGGTTCGCTTTTGGTGCATGAT
CAGAGTCCGACCGATAATGAGATACCTACGGCTGTGGCAGTGGAGGTTTCAGTTCCGGTT
GTGTCAACGGGGACCGAGTGCTCTTTTGATGGGATGATAGTGCATGACGGTGCACATTTC
TCTGTGGATGATGTTATAGCGTTTGGGGGGCTCCCGGATCCGATGACGCAGGACAGGCGG
TCTAGTCAGCGTATTCAGGATCAACCGGACGCGGATGACTTGCAGTTGGGGCGTGCAATG
AGAGCTGCAAAGATGAAGGATGCGGAAATTGCGACAGGTATGGCTTTTAACAAAGACAAT
TCCATCCTTCATTTTTCTCCGCATGATATTATTGATAATGTTGCTGCTGTTGGGGTGTCT
TTGGGTAATACTGGTACACAAATTTCAAAATCTATTAATGACCTTCTAGACTTAGAAGTA
GATAGAGCTCTTGATATTATTCGTAATTTAGCTGCCGTCAAACCTATGAATGACTCTGAT
ATTAATGAGATGGGGGGTCTGAATACTCTATGTGAGAATTTGGACATACTGGCCGATCCA
GAGGTGGGAGAGGACAACACCCTTGAGCAAAGTTCCGAGGAGACACAATATTTTGTAGTT
GACTCCCAAACACCTGGTTATATGGATCGGGGTTTTGTGGAGAAACCAAAACAGCCTTGG
AAACGGAAAGTATATCCGGTTTCTGCGGTTAGAAGGAGTGCTAGATTTAAGACTGCTAAA
TTTTTTTATGATGAAAGATGAGAGGAATATTTTGGAATAGCAGAGGTCTTCGGGACTTGG
CTAAAAACAAGATTTCTAGCTGAGGCAACTTTAGAGCATCACCTTGATTTTATAGCGCTC
ATGGAGACTGGGAGAGATAATTTTACTTCTAAGTTTCTGAGTTCTCTATCAGCGGGAGTA
GAGTTTGACTGGCATTGTGTCCCTCCAAGAGGAAGATCCGGTGGAATTTTACTTGGAGTC
AGATGTGATACCCTTCAAGTTACAGAAGTGGTTTTAGGAGATTTTGCAGTTAAATTCAGT
ATTACGTCTAAAGAGGATGGATTCCAATGGGCCCTCATAGCTGTATATGGGGCTGCTCAG
CCAGAGCTTAAACCTAATTTTCTCGCCGATCTGGTGAGGATCTGCGATGAGAGATTACCG
CTTTTGATTGGGGGTGATTTCAATATTATTAGGAGAGCTGACGAAAAGAGCAATGACAAT
TTTGATGGCAGATGGCCATTTATGTTCAATACTATTATCGAGAGCCTGGACCTTAGGGAG
ATAGAGCTCTCTGGTAGGAAATTCACCTAGGCTAATTCCCTACAAAACCAGACTTTTGAA
AAGTTGGACCGGGTCCTTACCAGTATTGATTGGGAACATAAATTCCCTCTAGTGACGGTG
CGAGCGCTCCGCAGAGCGATTTCTGACCACACACCTTTGTTGCTGGATTCTGGTAGTGCT
ATTCATATGGGAAACAAGTGTAGATTCTCCTTTGAGTCAAGTTGGTTCTCACGGGAGGGT
TTCACAGATATGGTTGCCCGGGAATGGAATAGAGAGTTGGGTGGGATATCCAACGTGGAT
CGATGGCAAAATAAAATTAGGCATCTTAGAAAATACCTTCGAGGTTGGGCTAAGAACGTT
TCGGGGATCAATAAGGATGAGCAGTATAGGCTTATCAAACTTATAGATGATCTTGACCGT
AAGGCCGAGAACATTGTCTTGGATCTCAATGAGCGATCTTTGAAGAATGAAGCTGAACAA
CGCCTACGAGTGCTCCTTAGAGAGGAGGAATCGAAATGGGCTACTAGAGCTAAAGTACGG
GCAATCATTTATGGGGATAATAATACCAATTTTTTTCACCTGATTGCAAATGGCAAGCAT
AGGAAAAAGAAAATTCTCCAGCTCGAGCAAGATGAGGGTACAATAGTGGGTCATGAGAAC
CTAAAATTGTATATTTCAAACTATTATAAAAAGTTATTTGGTGCTTTTGACCATAGTTTC
GTGACTATGGATGAACATCAAATCGCAGATATTCCTCAAGTTGGCGAGGCGGACAATGAG
TTATTATCCGCCCCATTTTCGGAGAAAGAGGTGCTGGAGGCAATTGGGGAGATGAAGAAT
GGTAAAGCTCCTGGGCCAGATGGGTTTCCAGCAGAGTTCTACAAAAAATGTTGGCATATT
ATCAAGAAGGATCGTATGGCAATGTTTCACGATCTTTATGATGGTCACCTACAACTCTTT
CATTTGAATTTTGGTACCATTACGTTGCTACCAAAGAAAGAAGGGACGACTCATATTGAG
CAGTTTCGCCCAATTTGTTTGCTAAATTTTAGTTTCAAGATTTTCACGAAGGTGGGAACG
GATAGACTAACGAAAATGGCACATTCGGTGGTGCAATCTACGGAAACGGCCTTTATGCCT
GGGCGGAATATCCTAGAAGGTGTCGTTGTTCTGCATGAAACGTTGCATGAAATCCATTCG
AAGAAACTTGATGGCGTTATCTTCAAAGTGGATTTTGAAAAGGCATACGATAAAGTTAAA
TGGTCCTTTTTGCAGCAAACCCTGCGCATGAAGGGGTTCGACGAGCTTTGGAGAAAGCAT
GTCGATTGTTTTATAAAAAAAGGGAAGTGTCGGGATTAAGGTAAACGATGATGTAGGTCA
TTTCTTCCAGACACTGAAGGGTCTTAGACAAGGGGACCCGATGTCTCCTATTTTATTCAA
CATCGTTGTTGATATGTTGGCCCTTATGATTAAGCGGGCAACCGAGAAGGATCTGATAGG
GGGTCTTATCCCGCACCTCGTGGATGGGGGTGTCTCTATATTGCAGTATGCAGATGACAC
TATACTTTTTATGGAGCACGATCTGGTCAAAGCTAGAAATTTGAAGGTCATTCTTTGCTT
GTTTGAGCAGCTATCAGGGCTGAAAATTAATTTTAACAAGAGTGAGGTATTCTGTTTTGG
TAGAGCCAAAAATGAACAACACTCTTACAATCAATTGTTCGGTTGTGAAACTGGGAACTT
GCCCTTCACATAATTAGGGATTCCTATCCATCACCGAAAATTATCCAACAAGGAATGGAA
ATGCATTGAGGATCGTTTTGAAAAGAAGTTAAGTTGCTGGAAGGGCAAGTTGCTGTCTTA
TGGAGGATGGTTAGTTCTGGTTAATTCGGTATTAACTAGTATGCCTATGTTTCTCCTATC
CTTCTTCGAAGTCCCTGTGGGGGTGCGAAAAAGATTGGATTTCTTTCGGTCCCGTTTTTT
CTGGCAAAGCGATGAGCTCAAGACAAAGTACAGACTTACTAGATGGGATATTTTGTGTAG
ACCCAAAGATCAAGGGGGATTAGGAATTGAAAATTTAGAGACCAAAAACAAATGTCTACT
AAGCAGATGGTTGTTTAGACTATCTTCGGAAACTGAAGGTTTATGGGTACAAATTATAAA
GAACAAGTACTTACAAAACAAAACGTTATCTCAGGCTACAACACGACCAAGTGATTCTCC
TTTCTGGAAGGGGTTGATGCGGACAAAAAAATGCTTTCTTCAGCAGAACTAGGTTCATCA
TAGGCAATGGTGAATCCACTAGTTTCTGGGAAGACACTTGGTTAGGGGGACGCCTTTAGC
TTTTCAATATCCGCGGCTCTACCATATTGCACAACGTCGACAAGCGTCCGTTGCGTCAAT
TCTTCGTGAGATCCCTCTAAATATTCAATTTCGTAGATCTCTTATCGGCGATAGATGGAC
TAGTTGGTTGCATCTCGTGAGAAGGTTGATGGATATCAACCTCTCTCACAGACCCGATCG
TGTTCATTGGAAGCTGACCACGAATGGGGTATTTACGGTAAAATCTATGTACATGCATCT
CATAGATTCAACACCTATTCCAAAATCAGCGCATATTTGGAAGATCAAAGTTCCTCTTAG
AATTAAAATCTTTATGTGGTTTGTTCACAAGGGGGTTATTCTAACGAAGGATAATCTTGC
CAAGCAAAACTGGAATGGTAATACTAGATGCAACTTTTGTCCGAATAAAGAAAGTATTAA
GCACCTCTTTCTCGATTGTCCTATGGCTAAACTGGTTTGACGCTCGTTGCACATTGCTTT
TAACATCACTCCTCCTAATAGTATAAGCACGTTATTTGGGATGTGGTTACACGGGGTTGA
TGTACATACTGCTAAACTTATTCGCGTGGGTTCCTGTGCACTGTTGTGGGCTGTATGAAA
TTGCAGAAATGACTTAGTGTTTAACAGACAACGCGACTTTCACTTCTTGCAGGTTATCTT
CAGGGTTACCGCAGTGATCCGCACGTGGTCATTACTCACTCCTGTGGAAGCCAGGGAGCA
TATGGTTACTGGATGTGTCCGCTGGGAGATGGTAGCACAGGGTATCTTCAACCGGTTTGG
ATGGTGTCATGTTAATAGGATAGGTGTTTAGTCATCTATATATTTTGTCATCTCCGGCTT
GGGCAAGAAAGATGCCTTGTATCGCTTTATTTTATTTTTGCTGCACACTTCATGTACTTA
TTGAAAACTTGATTTTGTTTTTAATATATGGTTGTATGCATCTATTGATGCAGAGGCCGG
GGCTCAGCCTCCATTTCGAAAAAAAACATGTCCACATGTCTTCGCTTTTGCTTCGGTAGC
CCCCCTCCCAAATAAAAGTTTTAAAAAAATCGATGCAAATCAATGTAGAGATTAGAACAA
ACCTTATGTTGTAAATCTCAAAGCGGTTGCTCCCTTTCCACCAATTCCTCTCATTCTGGA
ATCATGCATGGGTTAGCTATTCAGCCAAAATTAACAAAGGGTGAGGGAGTCCGTGTTGCA
CCCCCATTTTTTCATGTCCATGTGAGACTGGAGGAGCAGGGACAACTTGTGAGCAAGCAC
TAGTCACTCAACAAAAAATGAATTAACCAAAGTTCTGTGCAGTTGAACGACCGTCTTGGT
GTAAATTGAATCTAATCTAACCAACCACAAAAATTGCGTGTACTCCGTAATTAACCAAAT
ACTCTCGCATCTAGAAATATGATAAAATACATATAAACCTAGAGGATACCTCATGCGTTG
TTGCGGGAGTTGGTTGGCAAAAAGTTGACTTGATAACATGAGAACAAAATTTAAAATACG
TACTATTTATTTTATTTGATTGTGATCATCACTATGTGGTCCATGGAACAAATATTTGTT
ACTTGGCGTGTCTTAGGCTTGCTCTAGTGGTTGTGGTCATCGCTATGTGGTCCATGGAGT
TGAGTTGATAACATGAGAACAAAATTTAAAATACATATTATTTATTTATTTGATTGTGTA
TGATTGTAAAATATTTATTGAATATAAGTATGTTAATTAAATGGAAACCATTTTCCCATG
CATGGCTGAATGTTATGGTGGGATTTTTCTCATGCATGATTGCATACAAAGGTAGATCTT
ATCGCATTCATAATTATATGATGAGGTGGCATGTTGTGTATTTCAAGATAAATAGTTGTG
TGTTTCGATATAAATAAATCAGTGGGGATGACTCTCTTTGACGAAATAATATAGGATATA
TGATTCCACACAAAAGTATACTTGAGTGTCAAACTATTTACATTCCATCTTTTTTATCTA
TGATTACTCCTCACTTTATCCAAGGGCACCCCCTAATTGGTGGCACAAAATTCCCTTACA
CATGCATCCCACAAATCTCCATGAACATGTAAAATGATTGGGCGTGGACACGAAAGTGAC
AATGATATCTCATAGCTAGAACATGAATTGTAGGAGCATCTCCACTTGCCCCCCAACACC
CCCCCGAGGGCGCCTTTTTTAGCGCCGACGGTGCAAAATCGCCCGAGTCGCGTCCCCAAT
AGCTTGTTTAGCGTCGGTTTTGGCCAAAATAATAGCTGGCGAATCCGAGTCGAACCCAAC
CCCCCGGGGGGCGCCTGGGAGCGCCAGTCGACGCAAAAAAACCAAGCGGGCCAGCTCTGT
CGGCGACAGCCGGCCTTTCCCTCCGTTTTCTCCCCCTTCCTCCTCCCTTTCCCTCCATTT
TGTGCCTCCTCCCGCCATTCTTCTCCCGCTTTCCCGCCATCCAGCCACCATGCCGCCGAA
GAGCAGCGCTGCCATGAGGGAGGAGAAATCCGACGCACAATGGTCAGCGTTGATGGCGAA
TCAGCACGTCAAGCTTGACCTTCTCAGGACCAACGTCGTCGCAAAGAAGAGGAACACCAA
CCTGGCATTCTTGATGAGGACAGACGCGTCGATGATGGACGAACAGGTGAAGGCGTGGTA
CTTCGTGGAGCGCGATCTAATCTTGAACTAGATGACGGTGCCGGTGCGACTGCAGTGGCA
GCCACGACAACGACGACTCCAACCACGTCGGCGACCCCGACAACACCCACGCCGACGACC
CCGACAGAAACCACGCCGACGACCCCGACTACCCCGGCAGAACTTACGCCGCCGACGAGC
CCGACTACCCCAACAGAACCTACCCCGGCCAGTCCCACGGGAGAGGAGCCACACCGTGCC
GAGACGCGTGTTTGATTCGTTTCATCCTTTCCTTTTTGATCGTCGAACTACTGGGTGTGT
TGATCGCCGAACTATGGCATGCTGATCGCCGACTTGTGGCACGATCGTCAAACTTTGTGG
TGCCGGAAAAAGACAAGTTTGAAACCGTTGGCGTCCCGGGACCCAAACCTGGGGGCACGG
CTGGAAACTCGCTCGCCCCGAGGGCAAGAAAAGCGTCGGCTCAACGCCAAAAAGGCTTTC
GTCAAGGTGCGATGGGGGACAAACGACTGGAGATGCTCTAAGGGATGCATCTTAATGTTC
TACATCTAAACAAGTTTGTAAATGAGGCATTATACTTTTGCATCAGATTTTGAACCAACA
CCGAGAAGCATGACAATCACTTGATAACACAACATTCAATTCCAACAGCTGCATCAGCAT
AGCTAGCTTCGTATTGTTGCTGGTTTCTCTTGGTGAGTAGTATCGACAAGCATCACCAAA
ATTATCAAGCTGATCAATCCATATCTAGCTACCTCTGTATACCAGATGGAGTGATCTGTA
CATGTCATATTAAGTGGATTGTGTTGGTCTTTTGTGGGTCATTTTCGATGACATGTCGGC
AAAAGCAAACCCCAACTTGAGGTCAACAATCTAGCATTATTGCATTTTGCATCCAGGGGC
ATTGTTTTGATCCATGACATAGATAGTTATTTGACGCATGTTAACTGATTTTCTTGTAAG
TATTCATTCACACTACACTATGTCATAGTCTTTGATGTTTTGTTCTTACTTCTATTTGCC
CTATAGTCGCAAATGGATTTGTCAACAAGAGCGTGGATATTTTAAAAGTCAAGACTATTG
TCCCAAGCTCTTGTTGTGGAAAGTACAATAGGCTAGATTCCAAATTACTCACTACAAGGG
ATCTGGTATATTGTGACGAGCTACTATCGTCATGCAATATCCAAAAACGTCATGGAAAAC
CTCGTCGTGTCGTTTTTTGAGCGTCACGAGCATCGTCACGGAATCACCGTCACAGATTCC
TCCTAGTGACGCGGCGCACGAAAGACTGTCACGGAATATGGGACCTTCAGTGACGGTGCA
CATGTTGTACCGTCACTGGCATAACACCTAGGAATCCATCCCGTGGCCCTAAAACATCAT
TGATTAGCGTCACCGAGTGTGGATGACATCATTTATGATGTCATGTTATTTTATTAGAAT
TTATTTCTCTAAGAAATTGAAATTGTTTCTTATTTTTCTGTATTTTTTATTTTCCCATTT
TTAGAAAAATAAATATTTATTTTCGAAATACTTTTGACAATTACATTTTCATTAAAAAAT
ATTTTTTTCCCAAATATTTTCACATAGTTTTGTAGAATTATTTTGTGAGTGTAATATTAA
TTATTATTTTTATTTAATTTTATATCATATTATTTTTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTTTTATTTAATTTTATATCATATTATTTTTGATAACACTTC
CAAATTTACTTTACTATACATTTTGAGTTAAAAATTCATTTCAATACATACAACAATATA
TACTCAACTGCCAAATAACAATATATATTTAACACAACCAAATATCATCGTACATTCAAA
AAAAATGACAATAAGTAACTTGGAATGTTAAACTAACATAATTAAAAAAGACAAATTATG
TATGTTCTAGATATCACCCCCACGTAATGAAAGTAACATAACTAAAGAAAAGCAAACTAT
TTTCTAGATATCACCACCATGTAATGATGGCCTTCAAGAACCATTACGCATGTTACTTAG
TTTTGAGTTGCATATTTCTGTAAGATAAAACTGATAAGGTTGTCTGTTTCCTCTTGCTTC
TTTTCATAGGACTAGTTGATGCCCCGCGTGTTGCTGCGGAAATTTGTTGCAGATTATCGG
AGTAACATGGAAATCTCAAAGAAGAAAATAATTTGAATTAATAAAATGATAGATAGATTT
CATACATAGGCAATGTCTGAAATTTTTATTGTCAGTACAAATATGTAACATGTGATAAAA
ATCTATATCAGTCAAAGCATGAATAGTAACAACTATAGTAGTTTGTAGCACCAACCATAT
TATTACAGGAGCTGTTAGATATTGTTTGTAGGTTTTCCTTCTTCAGTTAGTGTGACATGG
ATATATGACATCCCATTCTTTTCATATTCAACAATGTATCCAAGAGATAAGAATGGGTTT
GTTTTGTGTTGAGGCTTGGACTCGCGTTTGCAAGTTATAAATATTGGGTCTTTTATGCTC
GTCATATTTACAATTGCACTCATGAATTTCTTCTGAGCTTCTCTTATTGAACCAACGGTA
GAACATGGAAAATTATTGTTTGCAGAATTAGGTGGTATCCTGGAGAAGATATGTGTATGT
TGTCAATAAGGGTAAGAAAGATATGTGTATGTTGTAAATAAGGGAAAGAAATAAAATGAA
AATATAGAGCAGACTAATTTCAGTAGGAGCACCTGTTGTCTCGGTTGTCCATTTGAACTG
GTTTGTCCACCCGTAGTTGAAAAGATAAGCAGTAAGCTCAAAATGCGATAGGATGATGTT
ATATAGATGTGTGATTTATAGTGGTAAGTTGGATTGCTGCTTACCAACTGAGGCTAAATA
AAATGCATTTTACTTGCTGCTTATGGAATGAGGCTAAATAAAATGCACATTTATTTTGTT
GCAAGCTGAATTGGAATATCTGCTGAGTAGTCTCTTCAAGCCAAAATAAACTTCTATAAT
AAAACTACCACATATATTATATCAAGCGGTGTTATCTATAGATTAACAATTGGAATATCT
GTTGTGTAGTCTCTTCAAGCCAAAATAAACTTCTGTATTAAAACTGTCACATATCTTATA
TCAAGCGATGTAATATATAGATTAACAATTGGAATATCGGCTGAGTAGTGTCTTTAACAG
CATGCAAGGGGGAAAATATGTGTTTTACAGAGTATACTATTCAACAACATGCGAGGGGCA
AAGTCAGTTTTTCTAGAGAATAAGTGATTTGCTAATCTGGTGTTTCACAACTTGAGGAAA
GTACATATCAAATTCCAAGATACTCTACAATAGCATGCAAAAATAAATTAACCTCACCTT
GGTCACTTTCCCTTCAGTTCATCTAGTAGGCAGAGCTACTATTCTGTGTTCCCATTTTCA
ACAAACTGCATATGTCAGATTTGAGAGATTACGCTCTAGCTAGCTTCGTTAGATTATACC
TGTCAAAAATTCGACCCAAATAAACAACAACATAAAACACTAATAGATGCTCCCATATTT
CAGATAGATGAGGCAAGCAAAATACAAGAACTCGGCACCCAAAGAAAACCAACACAAACA
CTGAAGAGCATCAACTCTAAGCAGATGTAATTAAAATGCATATGAACCAGATTATTTTAG
TAACTACTCTAAGATCATAAATTAAACATGTATGTATTTGATAATCGTACCAAAGCAGCT
ACTAGGGCTCAAGGCGAGTCAGGGTGCAGGCACACAACATTCTGATTTGATTGTAGTGTA
GTATACTGGAACTAAAAGCACTATACTCACCCGTCAATGATCGTAGTATAATCAACCCCA
GCCCCACATGAATGAATCGATCAACACATCACCTTTCAGAATGTGGATCAGTTGGTAACG
GAATAAATACACCTTGTCTACATATCTCATCTTATATCAGTCTTTCACATGGCCTGTCTA
TTAGAGTCCACACCGAGCACGAGCAGATTGTACATTCACGTGTACAACAAAGCGATTGGC
GTGGAACACATGCGGAAAGAATGGTGAGATCGGGGATAGTTAACAAATCACGTACCTCAC
GAGATCGACGAACTTGTGGCCGGTGGCGGCACACTCTCTAGTGCATGCGGCGGCGTTCTC
GTGGGTGAGACCGGCGGCTCCTATCCCGCCGGTGAGAAGGGCGGTAGCGCTCGCGTGTAC
TGGGGCCCGGAGGAGAAGCTCGCGAGTGAGGCGACGGCTGGAATCCCGTAGATGAGGAGG
GGGCGGCTCACGACCTGCGTGGGGCGGGTTTATCGAAGGACCTCCGATCTGTTTGTGGCG
ATAATGGGGGAAGAGGAGAGGGCCACGAGAGGATACGAGGGAAAGGTAAATTGCTACGCG
CGGGAATAGATCGTGGGGGCTGAAATTTTTGGGGTGACCGACAGGTGTGGTAGGACGCCA
AAAAATTCCAAAAATGGAGGGAACATGTTTTTTGGTGGAGGGAAAATATATTTTTTTGGC
GTAAACATATAAATATTTTCAGAAAACAAGTGGCTTCCATAATTATTTCGGTGCGGAAAA
AATTAGGCAATATAATGCTACATGTCAGCCGATGGATGTTTTTGAAAGATCCAATGCGTG
CCGAGCCATATGATTCAATGCGGGGAGCCGTCAGATTCAACTGCGAGCTCTGCAATAAGG
ATAAGTTACGTTCGAACATTTGTAATAGAGTTCATGTTACGGAACTTTTGCAACAAAGGT
ATTGTTGCAGAAAAAAAAATACAGCAGCAACCGTATCGGACCTTTGGCTCATGACAAACC
ATGACCAGCCTATTTGTGTTGTTGCTGCCGCCTCGGGATGAAATGATAAAGAATAGGTGA
ATGTGATCAAGGATTCACACTAGATTCAGATACTGCAACAGACTAGTTGTTGCAAAAAAA
ATGCAACAGACTAGGTGTTGTAATTTTTTTTGCAACAACGACTTAGTTACCCTCAAACCA
TTCGATTAAGATAGATCCAATGGCCACGGAGGCCACCGACGCGCATGTTGTTATCAGTAT
TCGGTGACGTTACGAGTCATTGTCACGAGCATTTTCGTCACAATATATCACATCTCGTGC
AATGTTTTCCCGTGCATGTTCTGTAAATCAAAAACATGTCATCTTTTTATTTTCTTTACA
GGACACATCAAAAAGCATGTCGCGACAATAGATATGAGGGTATTCTAGCATTTCGTCCAA
GCGTGAATGCTTAATGTAGTATTTTTTTAGTGTAACGAATGCTTATTTTTCATGGTATAC
TTTTTCTTGTTTTTTTTTCTTTGAGGGAAACAAAATTTTCTTAGTATGTTCTAACATGAA
TTGCAACTGATGCATCATCATCTTATACATCCAAACAAGTTTGAAAATGAGGCATTGTAC
TTTTGCACCAGATTATGAACCAGGACCGAGAAGCATGACAATCACTTGGTAACACGACAT
TCAACTCCAACGATTGCATTAGTCTTAGCTAGCTTCGTATTGTTGTTGGTTCTCTTGGTG
AGTAGTATCGACAAGCAGCACCAAAATGATCAGGTTGATGATATGTAGCTACCTCTGTAT
ACCAAATGGAGTCTGATTTGTACATCTCATATGTACTAGACTGTGTTGGTGTCTTGCAGG
TCATTTTCGGTGTCATCTCGACAAAAAAACTTGAGGTCAAAATCTAGCATTATTGCATTT
TGCATCGGTGAGCATTGGCTTGATCCATGCTATAGATAGTCATTTGATGCATGCCAACTG
ATTTTGTTGTAGGTATTCATTCACGCTACACTATGTGAAATTCTTTGATGTTGTGTTGTT
ACTTCTGTTTGCTCTATGGACGCAAATGGAATTTGTCAACAAGAGCGTGGTTATTTTTAA
AAGTCAAGACTATTGTCCCGAGCTCCTGTTGTGGAAAGTACAATAGGCTAGATTCCAAAT
TACTGAATGAGTTTTCTTTGTGTCCAATTCACCCACCTTATGTACGATGAATTTTTTGCC
ACCTACCTTACTTATTGCTTTATGTTAGCCAATGGTTCAAATATCCTTATATGTATACTA
CTTTGGGTTCTTTGCTTGACATTGTCACTCTATATATGCCTCTCGTGCAACACCATCTGC
CTTTCTCATATCGCATCATGAGACTGCCTTGCTGCTACTTTAACACCAGTAGGCATGCGA
GGCATTGGGATGATTACACCAACAATGATATGCTGTCATGGGCACATTCCCAGCGCCAAA
CCCCATTTAGGTTGGTCTTGCCCATAAACCGACGCAAGGTGTGTTGCGAGCTTGCGTAAA
CGGACACCTGAATTCCCCATTTGAGCGCGTGAAGGTTCTACGCTCGAGTCCATGCTATGT
AACTAGTGCACGAGAGGACTTGTCACGCCTATCGTATAAGTTGGCGCAACCACAATGACA
GAAATCTGCACTTGTGCTTCAGTTGCACCACGAGCTCGTTTAGTGCGTGCACGATGCGAG
CATGGTTATGGGCGTGACGGGAAAATGGACTGCTCACAGAATTCCAACAAGACTTTTGCA
CTGAAGGCACATGTAGTAACATCCAAGCGATGTTTTCCGGCACATGTTTCCCACATAAAT
AAAAATCTTTTTTTTCCTTTACGGGACACGTCAAAAAGCATGCGTCAAGAGATACGTGGA
TATTCAATCATTTTGTCAAACAATCTTTTTTTTTAGAACAATTTGTCTTCAAACATACAA
ATTCGGCCCAAATGGGGCCACTGGAGCAGACAAACCCTCAATTCGGCCCAAATAGGCCCG
AACTCACCAAAGCCCACACCGGGCGAAACCCTTGCCCCCCCCCCCCCCCCCCCCCTCTCC
CGAGTCTATATAACTCAAACCCTAGCCCCAACCAACTCAGCGAACCCCTTGCCCCCCCCC
CCCCCCCCCCCCTCTCCCGAGTCTATATAACTCAAACCCTAGCCCCAACCAACTCATCCA
CCTCCACCTCCCCTGTCTCAGCCTCCGCCGCCCCTACTTCTCCAGGGGGCGCAGCCGCCG
TGGTCTCGACGAAGAACTCGGTAACGACCCTGTTCCTCCTCAGGACCTGCAGCCGTAAGC
GGCCGCACCGCCTTGCCCTGGTTCTTGTTCTGCTTCTAGGGTTGTCCGAGTTATGTGCTA
GTGGATGACCTGTAGATTTGTTTTAGCGTTGCTCGTAGATTTGTCCCTCGCGCATCGCAA
AAACTGATTACCGGCGGATCTCATGGCCGCCGCGTATGAGACGATGCCACAGCGACCCGC
CCCGCCGTCGCCGTCCTACATGGCCTCACCCACCTCCGTGGTGGGCCAGTAGGCGACGGC
GGTGTACATTGCACGGCCCCCTTACGACTCCGTAGGCTACATTACAGTACGGTTCTTTAG
ATTTGCAATGGATTTAGCCTGCTGTGGTCGAGTAGGTGATGGTGTTGTCGTACACTGCCG
AGTTGACTTGCGATTCTGTAGATTTATCAGGGGTTTGTTCTGATTAGGCGAGGTCTCTGT
TCTGATTAGGCGTTGGTGTTTGGTTAGTACCTTCAGACATCACACTAGCTACATGACGAG
GTCTCTGTTCTGATTAGGCGCTGGTGTTTGGTTACTACCTTCAGACATAAGCAACTATTA
CTAGGGCTATGATTATGCAGATGTCGCACGAGCGTGTGTATGTAGCAGCTTTTAGGCGAT
GGTATTTCGTTCTTACTTTTGTTTCTTGGAGGATTATTGATGATGCAGATGATGAGACAC
AAGTTTTATGGGTAATTTGCGTCTGAGGCATTTCAGTGATGTCACACCCTTTTCACCTTG
GAGATCTGATGCGTATCTGATAATACCCTCTTCGTTTGGTTTTGTTTGTTTCTGATTCGT
TTGGGGTGAGATGAGGATATAATTACATTGTTGATGGATGGTATGATGTCCAATGAATCA
TGTATTAGCTCTATCTGATCATACCCCACACTGATTTATCTAAGGTAGAAAACTTTGCCA
GTCTGTCTAGTTTCTCTTGTTGAATTTGCTGTTTCATGTCTTTAAAAAATGAACGTTGTT
GATGCAGATGAGGAGACACGAGTTTATGGGTAATTTGCGTCTGAGGCATTTCAGTGATGT
CACACTCTTTTCACCTTGGAGATCTGATGCATCCGCTCTACTCATTTCTTCTTTTGTTTT
GTGTTTTCAAGTCTGAGAGATGAGATGATGAATGAGATTAATTTCCCTATTGGTTTGATT
AGCTGACATGATGGCCTACATACTGAACCGAATCTGATCATCCTGCCTTCTGTGATATGG
AGAGAAAGCATTTATAGTTGATAGATATGTTTGTGTTTGTTGCAGAATGATAAAAGCAGT
GTTAGATCAATTTAGATAGAATGGGTTGATGCAGATGATGAGACATGAGTTTATGGGTAA
TTTGCATCTGAGTCATTTCTGTGATGTCACACTCTTTTTCACCTTGGAGATCTGATGCAT
CTGCCCTCACTATTGTGTTTCTACTTGCTAGTATATTTTTCTTTAAAAGAATCATTTTTG
CCTTTAGTAAGCGAGAGATGATATGATGAATGAGATTAATTTCCCTATTGGTTTGATTGG
CTGATATGATGGCCTAAAATACTGAACCGAATCTGATCATCTTGCTTTCAACTCTCAATG
ATAAAGTCCAATCTGTTTTTTTCTTGCCTTGCTTTAACATTGTTTCATCAATTTGATCTA
ATCATTTTCTAATTTAATCGGTGGAGGTGAGATGATGAATGATTAATTTCCCTATTGGTT
TGATTGGCCAACATGATGGCCTAAATACTGAACCGAGTCTGATCACCATCCCTGGTTTGA
TAAAAAAAATGTGATTTTAGCTTCTAGTTTTGAAAGGTTGCAGCTCTGCCTGTATATTGG
TTTTAAAATTGAGTTTGATTGGTTTCGAAACAACCGGCAATGTTGATGCAGATGAGGAGA
CACAAGTTTTATGGGTAATTTGCGTCTGAGGCATTCTATGATGTCACAGCTTTTTCACCT
TGGAGATCTGATGCATCCCTGAATTCTGTTGGATTTTGCCCTATGTGCAACCTGAAATTC
CAGTTTACCATCTGTGATTCTATTGTTTTCTTTTTGCTTTTTATCTAGTGTAATTGAAGT
CCTTGTGGTTCATCTGATTTAGAGTAGAAACATGTGGTGGTGCAATGATTATAAAACATT
CCTCGTACTGATGGGAGATCCACGTGAACGACTCCTATACACCCATAGAATCTGAGCATT
ACCAAACCACTATTCTACTGGATTTGTTGGATACTTGTTTTCTGTGTTTATTTGTTCTGC
GGTTTGTTTTGCATTTTCATTAGATAGTATTGTGTTGAATTATTTGAAAATTTGTCAATT
TCAGAGGAAATGTTTGGGTGACTTTACTTGTCTTAACTTCTCTTTTCGTAATTCAATGTT
TTAAATCTTGTGCTGCTGGTTTCATTTGTGCAGTGATTATAAAACATTCCTCGTACTGAT
GGGAGAACCACATGAATGACTCCTAATACACCCATAGAATCTGAGCACCAGTAAACTCGG
CCTTGGTCAACTATTATTTCTCAAACCATTTTGTTTTGAGGACGGTTAAGGTTAATATTT
GATCTTGACCAGTCTGTTTTTTTTTGAAGATGTTTTGCTTTTGTAAGTGGCGTGTTCATT
GGTGGCCAATGATTAAAGTAATTTAATAGACAAGCATATGTCTGAATTTTCTTTATGTGG
AATCATCTAATCTTCTCTATGAGGCTAATGATCTTGCTCATTTATGTATCTGCAGTTACA
TTTATTGTGTTTTATGTCTTCATGGTGCTGGTGATGATTAGTGTGAACCTTTCTCAATGA
AATCACAAATGATTACATAACCTACTGCCTTCCTTCTGAGGCATCATGATTCCTGGTGTT
CTATTTCTGTTTTTCTTTTCTTTTGTTTTTATTTTCATTGAATTGTTGTTTGCCCGAGGT
CAACTGATGATTACAAGTGCATAGTTCATATGATAAAATCATGATTACATGAACGAAAAT
AGTCTTTCGCTCCTATCTGATGACCCTTAAACCTAACCCTTTTTGCAGCAGAATCAAACA
ATTTCGTTCATCTTTCCTAACACTTTTTATTTGAAAATCAAAACAATTAATTTACTATGA
TTTTCCTTCGAGGACGGTGAAGATTGATATTTGGTCTCGTTCGTCGTAACTGGCATTTAT
TTGCCTTGCCGACCATCCTGCTATATCACCACCCATATTCTGAGTCCTCTTATTACTTTG
TATATTGGAAACTGACATGTTAATTCTTTTTCAGGATCTGTCCTTTGTTTGAACTAAAGT
ATTTGAATCACCTTCTATTGGACTAATAAATATCTTATTTGTTTATTTGCCGGGATGTGA
GCAGTGATGAGACAATTCTATAAATATGATCTTCCAGGTGTGATTATCAAACGCTACGTT
CTTCCTGAGCTCATATCCCGTTTGCCATTTAAATTCTGTTAGATTGCAATAGGAATTTTT
TTATCATGCATACAATAAGTACATTGATGGTTGTAATGATTTTCCAATCCAGTTTTGAGG
ATGATGATTTCATATTTGTCGCCCCAGTCTTATGGTCTGCATTGTTGGATCTGTGCTGAT
TGACATTTCTGAATCTGACTCTGTGGAAGTTGATATCATATTGTGAAGTCCTCTTATCCC
TCCTATACATTCACAGATTTGTTTCAGTCCTGTCTTCCAGTTGGTTCTGTTTTCAATATA
TACTTCTTTTCCTGTGATGGCAGTGACGATTTGCAAATATTCAAGCTCAACAGACCAAAT
CACAGGTTTTCTCTCAGGAGTTGATATGTATGCCGATTATCCCGCTGAACCGAGCCATCT
CCCACTTGATTTTTTTGGTCTGCCATTCCTTGTTCTTCTCTTTTTGTGTTTGATTTTGTT
TGTTGTATTTGGTGATGTAGTTGCGATGAGGATAACAAGCTCCCTCTTCTGAAAGCATTG
ACGAAATTGCTGGCAGAATCGAACCTATTAAATATTGCCACCACTGAGCAACTTTATATC
TCTTTTTGCTGTCATTTTATATCTCCTTTTGCTGTTATTGATCGTTTGCGTCTTTACCTT
CCAGTTTTAATATTTGTGTGGGTTGTGCCGAGGTATTGATGCGTGATCTAACACTTATCC
TAGGGTTGGCTCTCCGATGATGTTAAATTTTGTAGTTATTAATTTTGTCAAATTAGGTCA
TTAATGCAGTTGAAGCCAATGATGATTAGCTTTTATGTTGGAATTACCGTCAGATAGCCA
ATGACGATATATTTTGCGGCTTTCTGAAGTTTTATACTGCTAGTCTCTTGGAAATGGTCT
TGGCTTAAATCCTCATTTGCACCCTATTTGGTTCAGCTGTCTGGTCTGCTGGTTTCTTTA
CTCTGTTTTTTTCAACTATTTGCATGTCTTGATAGTCCATTTGATCCGATGGATTGGGGA
AATGTTATGTGGCAGTGATGATAAATTTAAGGCTTGTTTCTCAAAACATTCGCAGTTGCC
GCCTAAGAGCTTTCGCCCTGCCAGGCTAGAGAGCTAATGCTGCTAATTCCTTCCTTGGAT
GTCTGAGCCTCGTTCACATCTCCTCCCCATTTCATATTTATATCAATTTTAGTTTATTGT
TTTTGCTGCTTGTTTAATTGCATTGGCTTGTTTTTCAAACATTTTGCTTTCTCTGGTTTT
TGCTCTGCCATGTTTCATTCTCTCAAGCTGAATTTATATGCTAATTATTGATGGGAAGGC
GATAATGGAAGGGTTGAAGGCTTGGAAGTCCCCTTGACAAAGTTTTACAAACCAACCGGC
CTCTATGGAGTCGTTGATGACCATCCGTCTGCGGCTTTGGTTGCATGTGGGGTGTAGTTA
TAATCTACTGTGTATGAGGTCCCTTATATTTTTGGGTGTATGAAGTCTGCTTAATCATCC
AACCTACCATATTGTAATTAGGGAATCTACTTTTCCCAACGTCTGGCGGCTCTGTCCACA
ACCCGCTCGTCGTGGAACCTGTGCCGCGTCTGTAGAGTGTCAGGCGATATATATTCTCTG
TAAACAGTAATGAAGGATTGCGATATATATTAGTGAGGACAACCGCCAGGACCGGTTCCT
GGCCCGTTGTCGTCGCTGGACATGGCTAGAGCTCAGCTGGTTGCGCTGCCCGGGGCGGTA
GTTATCGCGTCTCTGGACACACGACGGGTCGCCAGCATGCCATGGCTGCTCGCCGGCTCG
GCTGTGCAGATGCTTCATGCGGACCCGCCTCCGCCGGCGCATTGGCTGCCTTCGCACATG
CTTACCCCTGTTGCCGAGGACGCTGGCCTAAGTCACCGCCCGCCCTGTTTCTTACCTGTG
CCGATGTGTGCGGAGGTGACCACGGTGGAGGCGCTCGCCTTCGTCGACCGGTGCCTCCGG
CGTCATGCACTAGCAGCCGTGCCGTCGGCCGCCTCTTCAAGCGGGTCGTCGCTGCCATCA
ACCGTCGGCTCGGGTGCCGTGCTGGCTTGTGGGCTCCGGCGAGCCTTGTCCTCGGCACGA
CGTCTCCTCTTCTTCTGAGTGTGCTGCGCTGGTGATCACCGGAGAAGCCAGGGAGGCAGC
AGCCCACGATCCCGCCGGCGGGCTTCCTCTTGTCTTGCACATGTGGTGGGTATGGCTTCG
TGCGGTGGTGGGGATGGCCAGGAGGTGGGGAGGGAGGGGTGCTGGTCCGATGGATCTTTT
ATTCAAACCGATCCCACCTCCTCTCTTATATGGGGTGCTGCAGTGTGCTGCCGAGGCACC
GCACGTGTTGCTTCGGCGGGCCGCTGTTCTATTTATTTTTCTTTTTTCTTATTTTTCTGT
TTACTAGTTAGTATTAATTATTGTATATAGTATAGTTTTAGATTATGTTTAGTACTGTTT
TACTCTAGTTTAAGATTTGTGTAATTATAAGTGTGTTTATATTATGCAATGGATTGATGA
TATGCATAAAGTACCGGATTTCATTTAGGAAGAATAACGTGTTTCATGTGTTTACAACAT
ACTTTTTGAACATATTTCTTATTGCGATTGAGATCAGCTTCTCTCGTCTTATTTCTCCCT
CGTCTTATTTGGAATCACAAAGTAGTTGTGATCTACTATATATGTGCTGACTATCCTCTC
TTACTGTGAGTTCTATGCTTTGTCTATCTTGATAATTAATTACCTTCAACGTGTATTCCT
TATATCTAAATTGTAGCATACACATGTAATGGCCATGTAGCTTATTACTGTGAGATCTTA
CTGTGAGTTCTATGTTCACACAATTTAGATTGGGAATTTTTCAAGTTTACACTTAGTATT
AAAATTTTGCGTTCTTATTACTCAACCATGATGGTTTAGTGATTATCACTGGTTTCCCAT
ATAGGGTATTCGTCATAAGGCACCATATTCATCCAGATCTCAAGTATGAGTATTTACAGG
AGGAATCTCCTAGTACTCTGTTTTTGGCCCTCAAAACTGTTAGAGATCAAAAATCTACTC
TCTTCCATTGATGCTTCTGCATATATAGGTACAGGGATAACGCCTCGTTTTGGAGAGACG
TGTGTACATTAACCGGCGTAGCGGTTGCTGAAATAGCATCCGTCGGCGGTTAATACAGGC
AGGGATTTTCCTTAATTAAATATCTTAATTAATCTTAACACCCCTCCTAATCCATGCTTG
TATAGGTAGCATCATCATCTTGAAATAGTCTCCTCTAAAAACCCTGTGGGAAAAACATGA
GTATATTGATTGATATGTTGCCAAAACTCCTTCAAACACAATGAGAAAAATAAGAAGAAA
ATGATGCAACATATAATGGTTATTATCCATTTTTAACTCAAAATACGTGAACACCCATAG
AGTTCAAATGACAATAAATATGTCGTATATACTTTCTTAAAACCCCGGTGGGGAAAACAG
AAAGTATGACATGATATCATGTTGATATTACCTCATTAAAAATCTTTATGAGAATCTGTA
AAGTAAACTCATGAAGGAAAAAAGAGTATAATGGAACTGAAAAACCAGGACAAGATGTTT
GATGCCTTGGAGATATCAAAAGATATTCTTCAGTACCAACCAATTGTGTTTGATGGATCC
AATGGCATTATGGAACGTTCAGTCCCAATATCTTATTTCCACCATCTCTTGGTCTAAATA
GATCTGTCTCTAAGTCTAGAGAATGAACTACCATGAGGGTTATGGATGGATAAGATTTGT
CCACAATGAATTTCTCTAATATATTATGGATATAGACAACATAGTATACCATAATGTATG
AATGAAGGTGCTCAAGTTGTAGTAACGAGCGGTATTTTGGTTTACCCAAATCCTTCATTT
TATACTCCGTCATTTGGATGATTACATGTGTCGTTATTACAAACACACAAACATGGATAA
TCATCATTGCAGGAGTAATCCTTTTGTATAAGGATCTCACTATGTCAGTTGTACCATATG
TACCGACAACAATAATTTTACACAATGTATGTTGCATTTTGCATTTCGATTCAGAAGTGA
GATTTCATTGGGAATCAATCATATATGTCTGAATCTAGTGATCCTCATGGATATGTGATC
ACTACATCTATCAACTGCACAGATAGATGATTTTGTACTGCCAATAATAGAAATTATCAG
AAAGAGATTCCACCTCTGGAGAATAGTTGGGTATCTGCGTGAACCCTTGTGCTACAATAC
TTGCTCTATGTTTCACCACCTTGTTGTTCTCAATTCTATTTCGAGAAGAAAACTGGTGTA
GGTATTACTTATGAATACCTTTCCATTATTGAGCAAGATTATTTCTACCTAGATTATATC
CTTTGTTTGAGTTCAGTCCCAGTGTTGTTCACACTATGCCATGGCCATGGTCTTGGACCT
CAATCATGCGAAAGGTTTTGCAATCTAGTTGAGAAATGTATGTCGACAATTGTAGACTTC
CGGTTATATGATTCTCCAGAATCCATATATAAATATATAGTTGATGGAAATATCGTTACC
CATGGTGACTGATTGCGATTTCCCAATGCGATTGAGTCGGGTATTCCGATGTCCCGGTCA
TTGTGTGCATTATGACCTGGGTTGATGCAAGTTTCCCATCTACTGGGTATATACTACCCA
TTAAGTGTTTGTCAACGTGAAGTTGACTTGCATTTACTGATTCATAGGCCTTGATATCCT
TGCTTGCGAGAAGCTGAATCCTGATATACTTATGCCATACACATCCCCCCGTTGCATCGA
ACGAGGAGTGGAGTGGTTTTTGTTGGTACCTCCACTCTTTCAGGCGTACTTTTGTAGGAT
TGTAGGATTTGTGACACCTTTATAAGTAAATGAATCTGGCAGGTTATTTGCAATGTGTTG
CAAACATTCTGAACGCATGGTTCAGACCTTTGAGTACGTGGATTTGAGGCAGAAATGTGT
TGAACATTCCACTAATTTCCTGGCATTATCTATGGTACTTGAATTCTCCCTCTAATGCGT
GGAAATATTCCTCATGAATCAGCATACTGGCCTTGAATAACTCTCCATGCAAGGGGCTTG
AGGTATTGACGGAAATACAGTTATTCCTCACATAGATCCCAACTATATATTGAGGGGCCA
ATGATGTATGCCGGGTGGTGATGTCGGTATGCAACCGAATTATCGCAGATGGGAAATACT
TGGTAGATTTCCACGTATCAAAGATAGAGGGGAGTAATGTTATGAAGTTCTGTCATGAGC
GTGTAAAACTGCATGACTCCAACGTCAAGTTGGTAAGTTGCAATTTCAAAATAAAGATCA
TGTAATGAGCTTAATTCTTTGGATATAGGATTCTACCAAACCATTTTGAGTCTAGACATT
AGGAAAAATTGCTAAATTTCAATCCAAGGGCCATAGAGAAGGGACTCAAGGAGAATTCTG
CAATATTATCCATTCAATTTGCGTGAAATCAATGTCAGGATAATGAGCAAATGGTTTTGT
GTGAGTAAAGCACACACTCAAGACCATCATGTAGATATGTCTTTTAGAACCATGGAATGT
CTGAATAGTCTAGTCAATGGATGGGAAGAGTCACTTACCTCAACTTGATGCATTCAAGGA
GTCTAAGTGGTTCAGCATAGACTTTAAGGTGCGCAAGCCTTAAAATTAGCTTCCTCGTGT
CACATGTAGTGCACATAAAATCCAAATATTGCTAGAATCTAGCATCATCATAATCATAAA
CCAATGGAATTGCTGATAGTTTCGGTTTCAGCCCAATGTGTGGATGACCAACGCGAGTAT
GCCAAGTTTGTCATGTACAAGACATTATGGAAAACTATTTTGGGCGCAACATGTGCTACG
AGTTTTGTAGTATGTGTAGTACAATCCAGATGATACATAAAGAATGTGCTTTCCATATCC
GCTGCATATGGTAAAGAGAAGTTATTTCTCTTTGTTTTCATCATAAGTTTCGCTATGGAA
ACTATTTTGACGAACACCTCTATAGTTTAGTAGGGTACGAGTTAAACCAGGAGCAATAAA
TCATCCTGACATTACTCGAGTACCCAGAGGGATATTAAATATGAGTTAAACCAGGAGCAA
CAAGTACCTCATCGCGTCTAGCGATTTTTAAATATCTCATTTCTCTCAAAGAGAGTGGAA
AAATTGGGCTTCCCTAAGTATAGAGTTTGTGATGCATATGTCCACAAGGCACATATCATC
TTTCATTGGATCGACTCCCGTAAAAATCTATATATAGATATGAAGATTCTCAATATGATA
ATCACTGTCAAATATATATATGTATAATACATATAAATGTATTTGTACCAAATGTTGATA
CAATATATTGTGATATACAATATATGATGACAACAATACTTATGTTGTTAATACAACATC
GTAAATGGACATAAATAAATATTGACCACTCAAGAGATTGAGAGACTACTCATAGTCTCC
AAACATGACGGTTAAACATGTCGTTCTCTATGTCCATAGGATTCCGTCATCAGTGGTGAT
GTCGGGTTGAAGGTTGAAGTGGGCTTCAAACCTTTGCCCTCGAGTTTATTGTATCCCAGG
AATTGCTAATACAAAATAACCAGATGCTGAGATCTGAATCTAATGCCTTATGATATATAA
GACACCATTTTTCTGTTAGCGATGTGATCTGACCAGAGATGAATCCTGGATTACACACTT
TATCACACGAGAGACAAGAAAGATCATGATGTCGATGGCCCAGATAAGGCAGTGGTGGCC
ATTGAGGGCGAGTGCCTCAAATTCTATAGCCATATTATACCGCTATGGGTAAACCAGAGA
TAATCAATTTACGGTCAGTAAATTAAAGACCATCATGGTTGATGTTGCAATGAACTTAGC
AAAATTAATGGGTATTTCAAGAAGTTATCTTGAAACCATTAGTGTGAATCTCAAATTGCT
AGGTATGACACCTTGAAGATAATCTCCAAAAAGGAGTAGATCTCACAACACTAGGGAGTA
TAATCTGATAAAATCAGTAGATACTCACTTGTAATGCCTTATGTCATAACTTAGTAAAAT
GTGTGGGAGAGCACTTTGTAAAGCAATCATAATGTCGAAACGACAAAATGTAGGCTTTAT
CAGTAGTCATCGATAATCTGCGTAGGCAGTAGATCCATATGACTACATTGTGATCTCAAT
ACATCAATTTAAAGAAAACACTTTGAATATTACATCTGTATCTGCAAGAAATTTAAAATC
TCAATTGCAAATAGACGTATTAATCTCGACATGTAGCGAACATGGAGATACATACATTCT
GAAATACATCGTACTCAACGGAAATACACTATTATTGTAATGAATAGTAATGATGTTGTA
AACTTGATGTTCAAGTGAAAAACTTGAATTGTATAGACCTCAAATTAAATGAGAAGATTT
TATATCAAACTGCAAGATAATTTAGCAAAGTGAATTAATATTTTCTGAGAAAAAAAAATT
AATCTCAATTGCAATGAGATTGTTTTGCGAGAGAAGAAAATTCTCAATTCAAATCAGTAC
TTTAGATGTACTGAATTTATCTCTGCAAGAGATAAAAATCTTAGGTGCAAACATTATGTT
TCCGTACTAAATATCTGCATTGTACAAACAACCTGTCCATTAGTTTGTAATTTACGGAGA
CTTAAATGTGAAATACAAATAAGTCAAGGATTATTCTGCATACTGAAATAAGTCAAAAAA
AAATGTGAGAACAAATAGGAGCGTCCAATCCGTAAATACGCAAAACAACGAGGTCTAAAT
ACAAAACTGGGAAGAGATAAGGTTTCCAATCTCTTGGTGTTGTGTGTGGATACGAATCGA
TTGATTGATTCTATCCATCACAAGGGCACCGAGCAGATTCTATCCTTGATGGTGTCGCGC
AGAGGGGCAGCTTCAGGCGCGGGTGGGTGAGGGCGAGCGGAGCCGGCCACGGCCTCGCGC
GGCGTATGCGACCGGGGTCGGCTACTGCTTGGCGCTGCCACGGCCAGGCGTCGACGCGGG
CGAAGCGCAGCGAACGGCCGGGCACGGGGCTTGGTGCGGCGCGGGCGAGGCTGACCACGG
CTTGGCGCTGCAGTCATCCTCACCGGCACTCGATTCTCCTTCGGTTCTCGTCTATTTTGC
TCTCGGTAGACACTAGGTGCTGATAACGTGTTAGAGATCAAAAATCTACTCTCTTCCATG
GATGCTTCTGCATATATAGGTACAGGGAAGACGCCTCGTTTTGGAGAGGGGTCTGTACAT
GAACCGGCGCAGCTGTTGCTGAAATAGCATCCGTCGACGGTTAATATAAACAGGGATTTC
CCCTAATTAAATATCTTAATTATTCTTAACAAAAACGAGGTATGAACAGCAGAAGACAAT
AGTCCTGCCAGAGGTACTCCATGATTGGACTCATCTCCGCCTTCAGGATTTCAAGTCCAT
TACTGAGTACAATCATGTTGTTCATAAGATATGTTCCCAACTGCGCTTCTGTGGTAAGGA
ACCTACCGAGGGGGAAAAGATAGAAAAAACTCTGTCTACCATGCTCCCTTCAGACAGGAT
CCTCCAACAACAGTACCGTGCTCGCAACTACACTGTCTATTCTGAGCTTATTCACATCCT
ACTTCAGGCTAAAAAGTATGATGAGCTATTCGCTAAGAATAGCTCTCAGCGCCCAGTTAG
GGCACAACCTTTACCTGATGTTCATCTGAATGTCGCGAATAGACAAAAGTTTAATGGTAC
CTTTCGAGGTAAACATTCCAATCATGAGCACAGGCACAAGTGCAACGGGAATAGAAAATT
CAGAAACATGGGCAAGGGAAAAGGCACTACAAAGCAAGTTTGATAAATCTAAACTTTGCA
ACAAGTGTGGATGCTACTCGCATTCTACTGAAAAGTGCTCAATGCCCAAGCATGTGGTCA
TGCTGTACCAGCAACCTCTGGGACGCAAAGCACCTCAAGGGAAAAGGTTTGAAGCCGACT
TCAATCTCCATCCGCATGGCGAAAATGGAGCTGGTGCTTCGCACGATGTTCTTCCTGGAC
CTAGCAACGCCATGATTCCTTATCCCGTTGAGGACCCAGCTGAAATGGAGGCTATGTTGA
TTGAGTACACCTCAAACAGCATGTTCGACGACTTTGACTAGTCCCTCGACCTCCTTAGTG
ATCTACTTACTTATGTCCATTTGTGATGATTGTAATAAGAACATAAGTTTGTTGTTGTCT
TTATATTATATTGTATCAACACATTTGATATAATAAGATTGTATTCTATGTATTAACATA
ATGTTTTCTTATTGAAAATTCTTTCGTTTTATATAGTTTTTCTACGGGGACAATACAATG
GAAGATGAATTATGCCTTGTGGACAGTGGTACCACAAACTCCATACCGAGGGAGATAAAA
TATTTCCAAACTCTAAAAAAGATGAATGGAGATATTCTAACTATCGCTGGACGCGATACA
GTGATTGTTGGTACAGGACGTGCCATATTCACCCTCCCAAGTGGTACACAAGTGATGATA
GAGGGTGCTTTATTGTATCCTGACTCATCACGCACCCTGATCAGTTATCGAGATATCCGT
AAGAATGATTTTCATATTGAAACCCATGAAGACAACAAAGAGGAGTATTTACTCTTTACC
AAAGATCACGGATATGGCAAAAAGGTACATGACAAAATTCCTTCTCTATCGTCTGGTTTG
TACTATACGTACGTACATCAAAACCGTGGAACATGTTGCATACAAAGTAATTTTTTAGAA
TGTTGACACATTCCAAACCTCGCATGATCGCCTGGGCCATCCCGGAATCGGGACGATGAG
AAAAATTACTAGCAATTCCATTGGTCATAATTTGCTTGAGTCAAAATTTCCTCAATCTTC
TGATTTTGTGTGCACATCTTGTGCCACGGGAAAGCTAATTTTGAGGCCATCGCATCTCAA
AATACAAGCTGAACCACTTCAGTTCCTTGAACGTATTCAAGGCGACATTTGTGGTCCCAT
TCAACCATTATCTGGACCTTTCAAGTATTTCATGGTTCTGATTGACACATCTACACGATG
GTCACATGTGTGTCTTTTATCCACACGGAAGCATGCATTTGCCAAGATAATGAGGCAAGT
CATTAAGTTGCAAGCCCATTATCCTGAAGGTCGAATTAAGACAATTCGAATGGACAACGC
TGCAGAATTCTCCTCACGTGCTTTCAATGATTATTGCATGGCCTTGGGGATTGAAGTTCA
TCACTCTGTTCCATATGTTCATACACAAAATGGTTTGACTGAAGCGTTGATTAAGAGGAT
TAAACTCATTGCAATACTTTGTTGACGAATTGCAACTTGCCAACCTCTTGTTGGGGTCAC
GCTGTTTTAGACACTGCTGACTTGATACAATTGAGGCCAAGTGCATATCAGAGTTCTTCC
CCTCTGGAATTGGTATGTGGAAATCCTCCAAGCATTTCCCATCTGCGTAAGTTCGGATGT
GCTACATACATCCCAATCTCACCACCACAGCTGACATCTACGGGCCCACACAAAAGGTTG
GGGATCTTTGTGGGGTACAAATCGCCGTCGATTATCAAGTACCTAGAACCCCTAACTCGG
GATCTGTTCAGAGCCCGTCACGCTGATTGCATATTTAATGAGGAACATTTTCCGGCATTC
GGGGGAGATTTCAAGTACGAGAAAGAATGCCCGGAGATTGATTGGAATGCTCATGCCATT
TCATCCTCTGATCCACGTACCCATGAGACCGAACTTCAAGTTCGGAAGATCATTAATTTG
CAACATCTTGCAAATAATCTGCCAGATTCATTTACTGATATGAAAGGTGTTACAAAATCC
TTAAATCCGGCCAGAAACGTGCCACAAAGAGTGGAGGTACCAATAAAAACCCCTCAACTC
CATGTTCCTAAAATGAGGGGGAGTAGTATGGCCTGTGACCTGGAGCTAGCTTCTATCAAG
CAACAAAGGAAATCGAGGAGAAAATCCTCGAAGTGAGTAAATGCAGGTCAACTCAACGTT
GACAAACACCTGATGGGTAGTTCATGTTGGGGAACGTTGCATGGGAAACAATTTTTTTCC
TACGCACACGAAGACCTATCATGGTGATGTTCATCTACGAGAGTTAGATCGGATCCACAT
ACCCTTGTAGACCGCTAAGTGGGAAGCGTTAAGAAACGCGATTGATGTAGTGGTAGAGCT
TCGTGATTCAAATCACCGTCGTCCCACGATCCGTTCCGATCTAGCGCCGAACGGACGACA
CCTCCGCGTTCAGCACACGTACAGGTCGATGACGATCTTCGCCTTCTTAATCCAGCAAGA
GAGACGGGGAAGTAGATGAGTTCTCTGGCAGCGCGACGACGCACCGGTGATGGTGATGAT
CTATTCCTGCACGGCTCCGCCCGAGCTCTGCAGAAATCTAATCTAGAGGAAGAATTACAT
GGTATAGGTTTGAGTTGCACGTGGCAAAAGTTGGGTCTCAAAAGCACTAAAACTACCAAT
ATATATAGGAGGAGGGGAGGGGCTAGCCTTGGAGCTCAAGGGAGCCCCAAGGGCGCCGGC
CGAGAGGAGGAGGTGGACTCCCACCCCAATTCGGTTTGGGGGGGGGGAGTCCACTCCTTC
CTTCCCACCTCCTCTTTCCTTTTTTTTTTCTTTCCTTTGGTTTTTTCTCCTTGTGGCGCC
ATAGCCCACTTGGGCTGGCCTCACCAGCCCACTAAGGGCTGGTGCGCCACCATAGTGCTA
TTGGGCTCACTCCTGGGTGGGTGGGCCCCTCCCGGTGAATACCCGGAACCCATTCGTCAC
CCCCGGTACACTGCCGGTAATGCCTGAAATCTTTCCGTTGACCAAATGAAACCATCCTAT
ATATCAATCTTCGTTTCCGGACCATTCCGGAAACCCTCGTGAAGTTTGTGATCTCATCCG
GGATTCCGAACAACCTTTGGTCACCAACACATATAACCCAACTATATTAAAAATCATCGA
ACCTTAAGTGTGCAGACCCTGCGGGTTCAAGAACTATGCAGACATGACCCGAGACACTCC
TCGGCCAATATCCAATAGCGGGACCTGGATGTCCATATTGGACCCTACATATTCTACGAA
GATCTTATCGGTTGAACCTCTGTGCCAAGGATTCATATAATCCCGTATAACATTCCCTTT
CTCATTCGGTATGTTACTTGCCCGAGATTTGATCGTCGGTATCTCTATACCTATTTCAAT
CTCGTTACCGGCAAGTCTCTTTACTCGTTCCGTAATACAAGATCTCGTGACTCACACTTG
AGTCACATTGCTTGCAAGGCTTATATGTGATGTTGTATTACCGAGTGGGCCCCGAGATAC
GTCTCCGTCACACGAAGTGACAAATCCCAGTCTTGATCCATGCTAACTCAACGGGCACCT
TTGGAGATACTTGTAGAGCATCTTTATAGTCACCCAGTAACGTTGTGACGTTTGATACAC
ACAAGGTATTCCTCCGGTGTCAGTGAAGTCACCCAGTTACGTTGTGACGTTTGATACACA
CAAGGTATTCCTCCGGTGTCAGTGAGTTACATGATCTCATGGTCATAGGAATGAATACTT
GACACGCAGAAAACAATAGCAACAAAATGACATGATCACATGCTACGTTCATAGTTTGGG
TCTTGTCCATCACATCATTCTCCTAATGATGTGATCCAGTTATCAAGTGACAACACTTGC
ATATGGTCAGAAAACCTTAACCATCCTTGATCAACTGGCTAGCCAACTAGAGGCTTACTA
GGGACATTGTTTTGTTTATGTATCCACACATGTATCTATGCTTTCATTCAATACAATTAT
AGCATGGATAATAAACGATTATCTTGAAACAGGAAATATAATATGTTGGGGAACGTTGCA
TGGGAAAATAAAATTTTCCTACGCACACGAAGACCTATCATGGTGATGTTCATCTGCGAG
AGGGTGATTTGATCCACATACCCTTGTAGATCGCTCAGCGGGAAGCGTTAAGAAGCACGG
TTGATGTAGTGGTACAACTTCGTGATTCAAATCACCGTCGTCCCACGATCCGTTCCGATC
TAGCGCCGAACGGACGGCACCTCCGCGTTCAGCACACGTACAGCTCGATGACGATCTCGA
CCTTCTTGATCCAGCAAGAGAGACGGAGAAGTAGATGAGTTCTCCGGCAGCGTGACGGCG
CGCCGGTGTTGGTGATGATCTATTCCTGCAGGGCTCCGCCCGAGCTCCACAGAAATCTAA
TCTAGAGGAAGAACTACGTGGTGTAGGTTTGAGTTGCACGTGGCAAAAGTTGTTTCTCAA
AAGCCCTAAACTTCTAGTAAATATAGGAGGAGGGGAGAGGAAGCCTTGGGCAGCCTTGGC
GCCGCAAGGAAACCCTCCTTGGGTTGGCCGAAGTGGGAGGGAGGAGTCCTTCTCCAATCC
CACTTGGATTAGGACTCCTTCCTTATTTTCCCACCCCTTTTGGTTTTTCCACTTTTTCCT
CACGGGCTTTCCTTGGATGACTTTGTCAGCCCATTATACCTTATTGTACATCCAATAAAC
CCACGTGGACCCCTTGGGGCGTGGTGCGCCCACCCAGTGGGCCCCCGGAACCCATTCGTC
ACTCCCCGTACACTGCCGGTAATGCCCAAAAACTTTCCGGAATCCAAACACCAACTTCCT
ATATATCAATCTTCATTTCTGGACCATTCCGGAAACCCTCGTGACGTCCGTGATCTCATC
CGGTACTCCGAACAACCTTCAGTCACCAACACATGTAACTCAACTATACTATAACATCAT
CGAACCTTAAATGTGCTGACCGTGCGGGTTCGAGAACTATACAGACATGACCCGAGACAC
TTCTCGGTCAATATCCAATAGTGGGACCTAGATGCCCATATTGGATCCTACATATTCTAC
GAAGATCTTATCAGTTGAACCTCTGTGCCAAGGATTCATAGAATCCCGTATAACATTCCC
TTTGTCCTTCGGTATGTTACTTGCCCGAGATTTGATCGTCGGTATCTCCATACCTATTTC
AATCTCGTTACCGGCAAGTCTCTTTACTCGCTCTGTAATACAAGATCCCGTGACTCACAC
TTGAGTCACATTGCTTGCAAGGCTTGTGTGTGATGTTGTATTACCGAGTGGGCCCCGAGA
TACCTCTCCGTCACGCGGAGTGATAAATCCCAGTCTTGATCCATGCTAACTGAACGGACA
CCTTCGGAGATACCTCTAGAGCACCTTCATAGTCACCCATTTACGTTGTGACGTTTGATA
CACACAAGGTATTCCTCCGATGTCAGTGAGTTACATGATCTCATGGTCATAGGAATGAAT
ACTTGACACGTAGAAAACAATAGCAATAAAATGACACGATCACATGCTACGTTCATAGTT
TGGGTCTTGTCCATCACATGATTCTCCTAATGATGTGATCCCGTTATCAAGTGATAAAAC
TTGTCTATGGTCAGGAAACCTTGACCATATTTGATCAATGAGCTAGTCAACTAGAGGCTT
ACTAGAGACAATGTTTTGTCTATGTATCCAGACATGTATTTGTGTTTCCAATCAATACAA
TTATAGCATGGATAATAAACGTTTATGATGAACAAAGAGATATAATAATAACTAATTTAT
CATTGCCTCTAGGGCATATTTCCAACAGTCTCCCACTTGCACTAGAGTCAATAATCTAGT
TCACATCACCATGTGATTTTAACGAATCCAACACCCATACAGTTCTCGGATTTGATCACA
TCTTGCTCGTGAGAGAGGTTTTAGTCAACGGTTCTAAATATTTCAGAGCCGTGTGTGCTT
TACAAATCTTTATGTCATTTATAGATGCTGCTACTCCGTGCTATTCAGAAATACTCCAAA
TATCTACTCTACTATACGAATCCGTTTTACTACTGAGAGTTATTCAGATTAGTGTCAAAG
CTTGCATCGACATAACCCTTTACGACGAACTCTTTAATCACCTCCATAATCAAGAAAAAA
TTCCTTAGTCCACTAGCTACTAAGGATAACTTTGACCGTTGTTTTAGTGATTCAATCCTG
GATCACCTTTTGTACCCCTTGACACAGCATGGCAAGGCACACATCAGGTGCGGTACTGAT
AACCCACAAGTATAGGGGATCGCAACAGTTTTCGTGGGTAGAGTATTCAACCCAAATTTG
TTGATTCGACACAAGGGGAAGCCAAAGAATATTCTCGAGCATTAGCAGTAGAGTTGTCAA
TTCAACCACACCTGAAATACTTAGTATCTGCAGCAAAGTATCAGTAGCAAAGTGGTGTGA
TAGCAACAGTAGCAAAGGTAATAGTAGCAGCAGTAACAGCAGTAGCGACAGAGTAACTAT
AGCAGCGGTGACAACAGTAGCGGCAAAGTAACATAGCAAGGACCAGTAGGAAAAACTCGT
AGGCATTGGATCAGTGATGGATAATTATGCCGGATGACATTCATCATGCAACAGTTATAA
CATGGGGAGATATGTAAGTAGCTCCAGTTCATTGATGTAATGTAGGCATGTATTCCGTAT
GTAGTCATACATGCTTATGAAAAGAACTTGCATGACATCTATTGTCCATCCCTCCCATGG
CAGCGGGGTCCTAATGGAAACTACTAGATATTAAGGTTCTCCTTTTAATAGAGAACCAGA
ACAATGCATTAGCACTTAGTGAATACATGAACTCCTCATACTATGGTCATCTCCGGGAGT
GGTTCCGGCTATTGTCACTCCGGGGTTGCCGGGTCATAACACATAGTAGGTGACTACAAC
TTGCAAGATAGGATCAAGAACACACATATATTGATGAGAACATAATAGGTTCATATCTGA
AATCATGGCACTCGGGCCCTAGTGACAAGCATTAAGCATGGCAAAGTAGTAGCAACATCA
ATCTCAGAACATAGTGGATACTAGGGATCAATCCCCATCAAAATTAACTCGATTACATGA
TAGATCTCATCCAACCCATCACCGTCCAGCAAGCCTACGATGAGATTACTCACGAACGGT
GAAGAGCATCATGGAATTGGCGATGAAGGAAGGTTGGTGATGACGATGGCGACGATCTCC
CCTCTCCGGAGCCCAGAACGGACTCCAGATCTGCCCTCCAGAGGAAGAGCAGGTGGTGGC
GGTGCCTCCGTATCGTAAAACGCGATGAACTCTTCTCCTTGATTTTTTTCCGGACGAAAG
GGACTAAATAGAGTTGGAGTTGGAGGCGGCGGAGCCCTGAGGGCCCCACAAGCCTGCTAG
GTGCAGCCGGGGGGGGGGGGTTGGTGGGCTTGTGGGCTCCTCGCTCCACGTCTCCGGTTG
ATTCTTGCGCCAGTATTTTTTATATATTTCACAAAAATTCCTCGTAATTTCGAGGTCATT
CCGAGAACTTTTATTTCTGCTCAAAAACAACACCATGGCAATTCTGCTGAAAACAGCGTT
AGTCCGGGTTAGTTCCATTCAAATCATGCAAATTAGAGTCCAAAACAAGGGCAAAAGAGT
TTGGAAAAGTAGATACGATGGAGACGTATCAACTCCCCCAAGCTTAAAGCCTTGCTTGTC
CTCAAGCAATTCACTTGACAAACTGAAAGAGACAAAAGAAAAACTTTTACGAACTCTGTT
TGATCTTGTTGTTGTAATTATGTCTAACTCATATTCAGATTTCGAGCAAGATCATGAGCA
AACCACATAAGCAATGACATTTAGGTCTCAAGAGGAACTCATATCAATGGCATAATCAAC
TAGCGATCAATAATAATAAGTTTCAAACGTCAACACTTCAATCAAAACAATCATGAAGCA
ATATGAACAGATGGTATCTCGCTAGCTCTTTCTGAGACCGCAAAACATAAATGTAGAGCA
CCTTCAAAGACCAAGGGTTGACTGAACATTGTAATTCATGGCAAAGAAGATCCAGTCACA
GTCATACTCATTAACAATTAAAAGCAAAGCATAGAAATGACAGAGGTTCTCTCTAATTGG
TGCTTTTATAAGAAGTGGATGACTCAACAGAAACATAAATAGATAGGCCGTTCGCAGAGG
GAAGCATTGATTTGCAGAGGTGCCGGAGCTCAAGCTTTGTAGACAGAGATAAATAATTTC
GGGTGGCATGCTTTCATTGTCAACGCAATGACCAATAGTTTTCACCATCTTCCATTCTAC
ACATACTATAGGCGGTTCCCAAATAGAAAAGAAAAGTTTTGACTCCCACACCACCGATCA
ATCACACTCCACGGCTAGCCGAATACTCGGGTGCCATCCATACCAACAACAATCCAGGGG
GAGTTATGTTTGCAATTATCTTTTCGATTTGAGCATGGAACTGGGCATTCCAATTACCGT
CCCCTTTCCCGTGAATGATAGTGAATAAACACATATCGAGGATAACACGCCTAGCATGGA
AGATACTGATCGCCCCTTGTCACCACATGAGTGGTTTGGGCATACAAACCAGATTATTTC
TTAAAGATGTAGAGGGTGGCACATATAAATTTACTTGGAACGACAGGTAGATACCGCATA
TAGGTAGGTATGGTGGACTCATATGGAACAACTTTGGGTTTAAGGAAGTGGATGCACAAG
CAGTATTCCTGCTTAGTACAAGTGAAGGCTAGCAAAAGACTGGGAAGCGACCAACTAGAG
AGCGACAACAGTCATCAAAATGCATTGAGATTAACCAACATTGAGTGCAAGCATGAGTAG
GAGATAAATCACCATGAAATTGAATATCATAGAAGCTATGTTGATTTTGTTTCAACTATA
TGCGTAAACATGCGTGATGCGCCAAGTCAAGCCAGTTGAATCATTCAAAGGAGGATACCA
TCCTATCATACTACATCATAATCATCTCAAAATTCATGATGGCATCCAAGACAAACCATT
ATAAGCTCCTAGCTAATTAAGCATGGCATCAGAAACTATGATCTCTAAGTTGTCATTGCA
AACATGTTTCTCTCACAACAAAGCTGAATTAGGAACGATGAGCTAGTCATATTTACATAA
ACAAAATAGATCGAGTTCATACCAGCTTTTACAGGTTCAGTCACTTCATCATATATCGTC
ATTATTGCCTTTCACTTGCACGACCAAATGATGTGAACAATAATAAGAGAGTTCGTGCAT
TGGACTACGCTGGAATCTGCAATCAAACACAAAGGAGAAGACAAAGAAATATGGCTCTTT
GACAGATAAACAGATATGCATGCGAGAGCCACTAAACATTGTAACCATGGTCTTCTACCT
TGACCCAAAGAAAAAGAAAACTATTTACACGGGAAAGCTCCCAACAAGAAAAAGAAAAAA
ATGGAATCTTTTTGGGTTTTCTCAAACTAGACAAACACACGAGAAGAAAGCGAGAAAAAA
AAATAAACTAGCATGGATGATACAGTGGCAAAGTGTGAACACCGACTATCAAAGTGAAAG
TGTGAGCATGAATATAAAGTCGGTGAGAAACACGTACTCCCCCAAGCTTAGGCTTTTGGC
CTAAGTTGGTCTACTCCCATGGCTGGTCCGGCGATATCCAAAATCATAATGGGGGTTGTA
CGGAGCGCGGCAGCTACCGCCTGAATAGCTGCCTCACGGAGGCGAGCAACCTTTGCCTCC
CTCTCATACTCCTCTGCCTCTCCTCTGGTTATGTAATATCTCTGTTTTACCTAAAAGTCA
AAGAACGCAAGAGCAGGAAGGGTAATATGGAAAACACGCTGTCGGTTAAATATTAACCGG
TATAGGAGGGATTCATTATCCCTCTCAAGGAACTGATTGCGTGTCAAAGCGGCGTGATCA
AGGAAAGCTGTATGGAGCGGGGGATCTCCTTCGCGGATGGGTACTCCAAGAAAATTTGCT
ATGCGAGTGGCATAGATCCCACCAAAGAAATCCCCTTCATTAGCATTATTATTCAACCTC
CTTGCTATTATAACTCCCATGTTGGAACTTCTATCACCCGTTACTACGCTCTTAAGAATG
TTAAGGTCAGGTGCGCAGAGGTGACAATGCTCGATCTTGACGTTAATGTATCTACCTATG
AAGAGGGCAAAGTAATGCAAGACAGGAAAATGAATGCTCCCCATGGTAGCCTGCGTAATA
TATCTAGTTTCTCCGATAGTTATACTAGAGATAAAATCTCTAACCGAAGACTTAGGAGGA
TCATTGAGACTACCCCAATCGGGTATCTTGCAAATTCTATTGAAATTCTCTAAATCCATG
GTATACGATTTGTCATACAGATCAAACAGTATGGATGTGTCACGGCCAGCTGAAAATTTG
AATCTACGAACAAAAGAGGCAGTTAGAGTAGTACACTGTTCACATTTATCGGAGATGAAT
TCTTTGAGCCGGGCGTTGTGAACAAATATATCAAACTCGTCTTTGAAACCTGCATCAATC
ATGAATTCATCAGAAGACCATTCACATGGTTGTACCTATGCGTTCCTCGGTTGGTAAGGA
TCGGGCTCCCGAATCGCGAGACGAGGACCCTTCTTGCTTGAGGAACCACCATGATAGTTT
CTCCTGAACATCTTTCTTTTTCTGAAATCTTTGGTGACTCAAAGGAAAGGTAAACAAGGC
TCAACGAAACTCATAGCAACTACCCCTACAAGTGCCTAGAGGCCATATCATGCATCAAAA
CTACTTGGGACCAGCTAAAATTAGCATGCAAAGCTCAAGAACAGGGTCACCAAGGCAGCA
AAAATACGCAACGAATAAGGCACTAGAGCAAAACTAATTGGACCAATGGAGGAGTCACAT
ACCAAGGAACAATTTCCTCAAAACAGTTTGTTGAATGGGGCTTTGCACAAGGAGATCGAA
AATCGCACCAAGAAGAGCAAGAACACGGGTTTGAGCTGTAGAATGAATTTTTTCTGGAGG
TAGGAGAAGGAGATGGGAGCTGGAATAAGTGGAGGGGGGACACGTGGGCCGCACAAGCCT
GGTAGGCGCGGCCAGGGGGGGTGCCCGCGCCTCCTGGGCTTGTGGCCCACTGGTGCATCC
CCCTAACTAGCTCTCCGTCTCAGAATTTTTCAAAAATTCCAGAAAAAATCATACTTGATT
TTCAGGGCATTCGGAGAACTTTTATTTTCGGCACACTTTTCTACGGGACGCAAAAAGCAG
AAAACAGGAAAAACTAAAGCTAAATCTATCATTTTTCTTCTAAGCAACCGAAGGTAAAGG
TTTGGAACAGAGGGCTGTGACTCTCAGATTCATCCATCTCATGGTCATCAAAAGAAATCC
GTCAATGAGGTTGATCAAGTCTCGTTGACAAACTTTTTTCGAATCGCGTAAAAACGGAGA
ATTTTCGAATAGTCACTAGGTTACCTCAATGGGGATGTGCATATCCCAACAAGCAAATCA
TACTTCATCTCAACAGTAGGTATAGGGCATTCAAAGCTCCCAATAAGAATCGATGAAGTT
TTTTCAATAGCATTGATGCAATGTACTCGATATTGTTTCTTCGGAAAGTGCACCGTATGC
TCATTACCATTGACATGGAAAGTGACATTGCCTTTGTTGCAATCAATAACAGCCCCTGCT
GTGTTTAAAAAGGGTCTTCCAAGGATGACCACCATGGCATCATCCTCGGGAATATCTAGA
ATAACAAAGTCCGTTAAGATAGTAACGTTAGTAACCACAACAGTCACATCCTCGCAAATG
CCAATAGGGAAAGCAGTTGATTTGTCGGCCATTTGCAGAGAGATTTCAGTGGGTGTCAAC
TTTTCCAATTCAAGTCTACGATAAAGAGAAAGAGGCATAACACTAACAACGACTCCAAGA
TCGCATAAAGCAGTTCTAACGTAGTTGCCTTTAATGGAGCAAGGTATAGTGGGCACTCCA
GGATCACCTAGTTTCTTAGGAGTTCCACCCTTGAAGGTGTAATTAGCGAGCATGGTGGAA
ATCTCAACCTCAGGTATCATCCTCTTATTAGTCACAATATCTTTCATATACTTGGCATAC
AAAGACATTTTGAGCATATCTGTCAAACACATTTGCAGAAAGACATGTCTAATCATTTCA
ACAAAGCGCTCAAAATCCTCATCATCCTTTTTCTTGGATGGTTTGGGAGGAAAGGGCATG
GGTTTCTGCACCCATGGTTCCCTTTCTTTACCATGCTTCCTAGCAATGAAGTCATTCTTA
TCGTATCTCCTATTCTTAGGTAGTGGGATATCAAGATCAACTAGTTCAATCTCCACATCC
TTATCATTGCTAGGTTGAGAATCATCATGAACATCACTATCGATATTATCATTAGGTTAA
TGTTCATCACCAGATTGTGTTTCGGCATCAGAAACAGAGACATTGTTTGCATTCTCGGGT
GTAACAACAACAGGGTTGCTAGCGTGCAAATTCCTATCATCTTTCTTTTTCTTTCTAGGA
TGACTAGGTGCATTAGTGCTAACTCCTTGAGAATCTTGTTCAATTCTCTTAGGATGACCC
TCAGGATACAAAGGTTCCTGGGTCATTCTACCACCTCTAGTGACGACTCTGACAGAATTG
TCATTCAACTCATTGAGCAAGTCATTTTGAGCCTTAAATACTTGTTCTACTTGAGTAGTA
ACCATAGAGGCATGTTTACTCAAAAGCTTAAGATCATTGACATTTCTATCCACACAAACA
CTTAAATGACTAAGCACACGAGCAACTTTTCCAATTGTATGCTAACATAATCATTAAAAC
TTTGTTGTTTGGCAACAAAGTTAACAAATTCATCCAGGCATAAGCTAGCAGGTTTATCAA
AAGGAATATCACTCTCATTGAATCTACGAAGAGAATTTACCTCTGCTACCTGTGTCGGGT
TATCAAGACCATGGATCTCTTCGATAGGTGGTAGATTTTTGACATCTTCAGATTTAATGC
CTTTCTCTTTCATAGATTTCTTAGCTTCTTGCATATCTTCAGGACTGAGGAATAGAATAC
CTCTTTTCTTCGGAGTTGGCTTCAGAGGTGGTTCGGGAATAGTCCAAGCATTCTCATTGC
ACAAGATATTATTCAATAGAATCTCACCTTGTTCCACAGTTCGTTCCCTGAAAACACAAC
CGACACAATTATCTAGGTGGTCCCTAGAAGTATCAGTTAGTAGATTATAGAAGATATCAA
GTATTTCATTCTTCTCAAGAGGGTGATCAGGCAAAGCATTCAGTAGCTGGACGAGCCTCC
CCCAAGCTTGTGGGAGACTCTCTTCTTCAACTTGCACAAAGTTATATATCTCCTGCAAGG
CAGCTTGCTTCTTATGGGCAGGAAAATATTTCTCAGAGAAGTAGTAGATCATATCCTGGG
GACTACGCACACAACTAGGAGCAAGAGAAGTGAACCAAGTCTTAGCATCATCCTTTAGCA
AGAAAGGGAACAACTTAAGGATATAGTAGTGGCGGATCTTTTCCTCACTCGTGAATAGGG
TGGCTATATCGTGCAACTTAGTAAGATGTGCTACAACCGTTTCAGACTCATAACCATGAA
AAGGATCAGATTCGACCAAAGTGATTAACTCAGGGTCGACAGAGAATTCATAATCCTTAT
CGGTCACAAAGATAGGCGAAGCAGCAAACTTCGGGTCATATTTCATCCTAGCGTTCAAAG
ATTTTTCTTTCCACTTGCGCAGTAATTCTCAAGATCATAGCTATCCTTACAAGCAAGAAA
GTCCTCAGCTATCTCTCCCTCCATAACATAACCCTTAGGCATATCAGGCAATTCATATCT
AGGAGAGCTAGTTCTAACATGTGAAATAGCAGGTTCTACTTCAATAATCTCAGCAGTTTC
AGAAGTATCATCACATCTAGGAGCAACTCTAGAAATTTGTGCATCTAGGAATGCACCTAG
TGGCAAAGCAGTATCAAGCAAAGCATCACAAGCATCATGGATAGCAGAAGTAGCATCATC
AAGCACAAGCGACACATCAAAATTTCTAGCAGGAGGTGATGTCGCAAACTTACTCATAAC
TAAAGGTGAATCAAGTGCAGAGCTAGATGACAGTTCCTTACCTGTCCTCGTAGTTGAGGG
CAAGACTTTAGTTTTTGGATCTCTCGGATTCCTCATAGTGATCAACAGACGTAAATCCCA
AGTGACTCAGAGAATAGAGCTATGCCTCCCTGACAACGGCGCCAGAAAATAGTCTTGATA
ACACACAAGTATAGGGGACCGCAACAATTTTCGAGGGTAGAGTATTCAACCCAAATTTGG
TGATTCGACACAAGGGGAAGCCAAAGAATATTCTCGAGTATTAGCAGTTGAGTTGTCAAT
TTAACCACACCTGAAAGACTTAGTATCTACAGCAAAGTATCAGTAGCAAAGTGGTGTGAT
AGCAATAGTAGCGTTAGTAATAGTAGCAGCAGTGACAGCGGTAGCGACAGAGTAACAGTA
GCAACAGTGACAGCAGTAGCGGCAAAGTAATGTAGCAAGGACCAGTAGGAAAAACTCGTA
GGCATTGGATCGGTGATGGATAATTATGCCGGATGACATTCATCATGCAACAGTTATAAC
ATGGGGAGATATGTAACTAGCTCGTCAATGTAATGTAGGCATGTATTCCATATGTAGTCA
TACGTGCTTATGAAAAGAACTTGCATGACATCTCTTGTCCATCCCTCCCGTGGCAGCGGG
GTCCTAATGGAAACTACGGGATATTAAGGTTCTCCTTTTAATAGAGAACCGGAACAAAGC
ATTAGCACATAGTGAATACATGAACTCCTCATACTATGGTCATCTCCGGGAGTGGTTCCG
GCTATTGTCACTCCGGGGTTGCCGGGTCATAACACATAGTAGGTGACTACAACTTGCAAG
ATAGGATTAATAACACACATATATTGACGAGAACATAATAGGTTCAGATGTGAAATCATG
GCATTCGGGCCCAAGTGACAAGCATTAAGAATAGCCAAGTACTAGCAACATCAATCTAGA
ACATAGTGGATACTAGGGATCAATCCTCGTCAAAAACTAACTCGATTACATGATAGATAT
CATCCAACCCATCACCGTCCAGCAAGCCTACGATGAGATTACTCACGAACGGTGAAGAGC
ATCATGGAATTGGCGATGAAGGAAGGTTGGTGATGACGATGGCGACGATCTCCCCTCTCC
GGAGCCCAGAACGGACTCCAGATCTGCCCTCCAGAGGAAGAGCAGGTGGTGGCGGTGCCT
CCGTATCGTAAAACGCGATGAACTCTTCTCCTTGATTTTTTTCCGGACGAAAGGGACTAA
ATAGAGTTGGAGTTGGAGGCGGCGGAGCCCTGAGGGCCCCACAAGCCTGCTAGGTGCAGC
CGGGGGGGGGGGGGGGGGGGGTTTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGGGGGGGGGGGGGGGGCTGGTGGGCTTGTGGGCTCCTCGCTCCACATCTCCGATTGAT
TCTTGCGCCAGTATTTTTTATATATTCCACAAAAAATCCTCGTAAATTTCCAGGTCATTC
CGAGAAATTTTATTTCTACGGAAAAACAACACCATGGCAATTCTGCTGAAAACAACGTTA
GTCCGGGTTAGTTCCATTCAAATCATTCAAATTAGAGTCCAAAACAAGGGCAAAAGAGTT
TGGAAAAGTAGATACGATGGAGACGTATCAGGTACACAACTTGCCATACTTTAGAGCCTA
CGCTAAGGCATAGGGGACGACCTTCGTCCTTTCTCTTTCTTCTACCGTGGTCGGGCTTTG
AGTCTTACTCAAATTCACACCTTACAACACAGCCAAGAACTCCTTCTTTGCTGATCTATT
TTGAACTCCTTCAAACACTTGTCAAGGCATGCATTTCATTGAAAGTTCTATTAAGCGTTT
TGATCTATCTCTATAGATCTTGATGCTCAATGTTCAAGTAGCTCTATCCAGGTTTTCCTT
TGAAAAACTCCTTTCAAACAACCCTTTATGCTTCACAGAAATTCTACATTACTTTCGATC
TACAATATGTCAACCACATATACTTATCAGAAATTCTATAGTGCTCCTACTCACTTCTTT
GTAAATACAAGTTTCTCATAAACCTTGTACAAACCCAAAATCTTTGATCATCTCATCAAA
GCGTATATTCCAACTCCGAGATGCTTGCATCAGTCCATAGAAGGATTGCTGGAGCTTTCA
TACTTGTTAGCATCCTTAGGATTGACAAAACCTTCTGGTTGTATCACATACAACCGTTCC
TCAAGGAAACAATGTTTTGACATCCTATGTGCAATATTTCACAAACAATGCATCAATTGC
TAACATAATTCTAACAGATTTTTAGCATCGCTACGAGTGAGAAAGTCTCATCATAGTCAA
CTCTTTGAACTTGTCGGTAACATCTTTGTGATAAGTCGAGCTTTTCTTAATGGTGACTTT
TAACCATCATCGTTTGTCTTCCTTTTAAAGATCCATCTTTACTTAACAGTCCTACGTCCA
TCAAGTAGTTCTTCCAAAGTCTACACTTTGTTTTCATACATGGATCCTCTCTCGGATTTC
ATGGACTCCAGCTATTTGTCGGAATCCGGGCCCACCATCGTTTCTCCATAGCTCGTAGGT
TCATTGTTGTTCAACAACATGACTTCGAAGACAAGGTTACCGTACCACTCTGTAGTAGTA
TGCGGCCTTGTCGACCTACCAGGTTTGTAGTAACTTGATCCGAAGCTCAATGATCACCAT
CATCAGTTTCCACTTCAATTGGTGTAGGCGCCACAAGAACAACTTCCTGCGCCGTGCTAC
ACACTGGTTGAAGTGACGGTTCACTAATCTCATCAAGTTCCACCACCCTCAACTAAATTC
TTTCGAGAGAAACCTTTCCTCAAGAAAGGACCCATTTCTAGAAACAAACACTTCGCTTCC
GGATCTGAGATAGGAGATGTACCCAACTATTTTGGATATCCTATGAAGATGCATTTATCC
GCTTTGGGTTCGAGCTTATCAGAGTGAAACTTTTTCACATATGCATTGAAGCCCCAAACT
TTTAAGAAACGGCAGCATAGGGTTCTCCAAACCATAGTCTATACTGTGTCATCTCAACGG
AAATACGCGGTGCCCTATTTAAAGTGAATGCGGTTGTCGCTAATGCATAACCCATAAACG
ATAGTGGTAATTCGATAAGAGACATCATAGTATGCACCATATCAAATAGGGCGCGGCTAG
GACGTTCGGACACACCATCACACTATGGTGTTCTAGGTGGCATGAATTGCAAAACAATTT
CCAAATTTTCTTAACCATGTACCAAAACTCGCAACTCAGACATTCATCTCTATGATCATA
TCTGTAACACCCTGATTTTTCAAACCTTTTCTTTTTAAAATATTTTTGAAGATCACTTGC
AATTTGGTGGATTTTCAAATTCTCAAAGCAAGTTGGATTATGAAATCTCCGATTTCTTGT
CTCAAACAACCGAAAACCATTTGCTTCTTACTAAAACCTTTCTGAGATTTATTTGCAATA
TTTTATTCTACTAAATAATTATCTTTTTCTATTTTGGGAATTATGCCATCACTATGGGTT
GTGAAGCAACCTATAGCTTGGATGAGCTTTAAGACCCAAAACTTTTGCAACATCTTCTCA
ATGCCATATGATTTTAAAATATTCAAAAATGTTTCTTTGTCCAATGGATAATTATGGCCA
GAATAATTATTTATTATCTGACCAGAATTATCCCTTTGTGAAGCAACCCTATGATTCCTA
TTTTGCAAAATTCCAAATAAATTGCTGTAGTTACTAGGGATCATATATGGTTCCAATATG
TAAAAACATCCCATGGTCCAGTACAAATTTTGAGCAAAAACACTCTGCTAAGTTTATGCT
AAAACAGAACCTTTGTGAAGGAAGTGCTAGCTAGGAGTGCACAATGGAGCTACAATTTTT
TGGGCATGTGTGCACTACCAAATGATACTTCCCCACCAAATGACACTGGTAGCAAAGCTT
GCAATTGAGTGCTAGGAGATCATTTGTGTTCTGGACCATAAAGGTGGTTTACAAAGGAAC
TATATTCATTTGATCTTCAAACCTTGCCAATTTTTGCCAGTTTAGAGTCTTTTCTATGCT
GATTCTCCTAGACATCCTATCTTGCTCTTATCCCAACCCTGTTGAGGTCTAGAACCTCCC
AAAGTCTGCTGGCAGAACCTGTTGTTGATGTTCCTAGTCGCAGCAGAGCTTGTGTGTTTA
GGCAAGTAGTGGATGGTGACTGATGGAAGGCTGGTCGATGTAATAGACAAGGATTCAAGG
CTTGCATGGCATCAGGGTGGCCGCAACCGGGGTGATCACGGTGCCGGCATGCCACAGAGC
ACGCTCTGCGCAACTCCAGTGACAGCCGAGCCGCCCCGAGCCGTCAAACCATGCCCCCCT
TGTCCTAAGCGCCGACGAGGTCCCTGGTAGCCGCGTGGCACCTCCCGAACCCTCTGGTTC
GCCGGAGAAGGCCGTCGTCGCTCCCGGCCAAGCTCCGCCACGAGCAACACAGTGGGCTTC
AGCCACTGTGGTCGTCCGCACGCCATTAATGGCTCCAGACCCGTCCCGTCGCTCCCTTGA
CCTCCTCCATCACCTCACCACCGCGCCACGAGAGCCAGCTCACTTTCCTTGCTCCAGTGG
CAAGCCCGAGCCTCGCCACTTCAGGAGAGCTCGACAGCGCTCGTCGCTGGCCTATATAAG
GCGCTGCTCGAACCCCTCCTAGCTCTCACCCCTCTCCTCCACCTCTGGATTAGCCCTACA
GACCCGCAGCAAGAGCCGGGAGCTCGTCTCCCTCAGCTCCATCGAAAAGCTCCGTCGCCA
AATCCCCTCTGTCGCCAGCCTCCTCCGCCCGTGCCCAATCGAATCCAAGGCCACCAGTGT
GTTCCTTGGGTCCCTCTGGTGCTCCTTGAGCCGTCGGTGAGTTGAATCCCTGCCGGAACC
GTCGCCAGCGATGACCACGGTAGCCTCCACCCGCCGGAGAAGACGGGGCGACACCGTCTG
TCCACCTCCGGAGGAGCTACGGGTACAGGGAGGACCGCCGTCGAGCGCCCGATCCATTCC
CGTCATCTCCCAGCCTCGCCGCCGTCTCTATCGCTGGTGAGCGTCGCCGGTGAGCCGCCC
TCCTCTGTCCCCCCTCCTCCCTCTCTGTTTAAAAGGGGCAGGCCCCACCTGCCAGGGTCT
GCGGCCTGCGGCCGAAGCGTTAAGTGAGGCGCCCCTCCACTTTACACCTTCCACGTGGCC
CCTCCCAGGATTTCTATTTCTTTTATTTATTTCAGATTTAAACAGAAACTTTGACCATTT
AAATATTTTTATTTACAAGTCCAAATCACTTGATTCTTTTTGCATTGGGTTGGTATTGAA
ATTCTTTACAATTTGGTATTTTTCCCACACTCATAGAATTTCTAGTTAATAAAAAGGTAT
TTAATGCTTTTCCTTTTCTTTTGCTATTTCAAACATATTTTTAGAGGGAAACTTTGAAGA
CAAGGAGTGTTTGAACAACCCCACCGATCAAGGCAAGCCATCATATCCATGTGATGTAGT
TTTGCATAGCATAGCTCACATATTCATGCATTATACTTGCTTAACTTACTAAGAAATAAT
CATTCAATATACCATCATATAGAGATATATGCTTATGATTATGAATCACTATGGTTACTA
TGATATAGAGATATATGCTCTCTAATTGGTGCTTTTATAAGAAGAGGATGACTCAACAGA
AACATAAATAGATAGGCCCTTCGCAGAGGGAAGCATTGATTTGCAGAGGTGCCAGAGCTC
AAGCTTTGAAGACAGAGATAAATAATTTCGGGTGGCATGCTTTCATTGTCAACGCAATGA
CCAAGAGTTTTTACCCTCTTCCATGCTACACATACTGTAGGCGGTTCCCAAACAGAAAAC
AAAACTCATCCCCGTCCCCGCATCGCCTACCCTAGGCAACACGGGGGGCGACCGCGCCGC
TGGTCTTAGGCCTCCTCTCCTCACATACTTTTTCCTGCCGCCGCCTGAGGTCGCGCCGAC
GAAGCCTAGCCTGTGGTGGCGGCGGTGGGGTATTCTCCCTCGCGTGATGGTGGCGAGATA
TCCTGGTGGCGACGGTGGGGTATTCTCCCTCGCATCATCGTGGCGAGATATCCTAGCGGC
GGCGGTGAATGCTACGACAGGCATCCAGCGGCAAGGAGCGGCGGGATCCCGATGACGCGC
GTGTCGACAGCGACAGCGGAGGCGCGAACTGCCCGTGGCATAGTCGCCCCTGTGGTGCCG
ACGGGGATCGTGGGTCTCGCCTTGCCCAGATGTGCTTGGGCGGGCCAGCGGTTCTTGTGT
GCATCTAAACGCGAGTGTGGTGGGCCTGACGACGCCAGATGTAGGCATCATGGTGGCGCG
ACGGTCGGCCAGGCAACAGCGTCCGTCCGGTCCCCGGCTAAGATGGCTGCGGTCTATGCA
TGAGATGGTTGATGGAGGCCCTTCGAATAGATCTGGGTGAAAACTTGCTATCGGCTACTA
CCAAGGCCGGCGGTGGCAGTCCTGTCTGCGTCGTTCCTTTCTTGAAGGCATCACCGTGGA
GAAGTTCATGGCCACTCTGTGCTACCTTGGAGGAAAACCCTAGATCAATAGATCAGATGG
CGCCGATGTTCTAGTGTCGTTTTCCCCCTTGGGGGCGTTATTCTTGGAGGTGTACATGGA
CTCAAGGGATGAGAGGACTGCTTCTTCGATGGAGTGGTGCTTCATCTTACACATTGATGG
CGATGGATCTCGACAGCATGGCGCAGTGGAGACTGGACGCCCGATGCGCGAAGATGGACT
AGCGCAACAGGAGGACGCTGTCTGGCGTCATGGTGACGTCAATGGCAGAGAGGCCTGACA
AGGTCGGTGCAGTAGTTTCTGCTCTAAAGATGGATTGGTGGAAGATGACAGCGACGACAC
ATGAAAGTGCGTCGTACCGGTTTGTGTCCAAACCCAGCATGCGGCTTGCTTGGGGTCTTC
GGCCTTAATGTTAGGCATTTGTGCGAAGTCTGTATGGTATTAGACTCGGACTATATCGGC
ACCACTTCATCAAGTAGATAGGAGTAGCGGAAGTTGTTGCTAAGATGATGGCTTCAGACA
ACCTCATGTACTACTTTGTATAATCTTTGTGAGTATATAAAAGGGACGCATGCAGGAGGT
AATCTTCCTTTTCTAAAGAAATGTATTTCCATTTTCTAGACGGTTTATTTTTTGGCTGAA
GTGAAAACTTCCATTTGATGCTACGGAAGTTGTGTGGCGAGCCGAACACTACATTCAGCG
TTATGGTACCGGAATAGCAGGCCTCGACGCCCGAGATCACTCCTTTAAAGGTAGTGTTGC
TGGGCTTGATCCTTGACGGATCTATACCCATCTTTTTCACCGTGTGTAGGTTTCGAGTCT
TACTCAATACTCACACCTTATAACACAGCCAAAAACTCCTTCTTTGCCGATCTATTTTAA
ACTCCTTTAAAATTTTATCACGGTATGTATTCATTTAAAAATATTATTAAGCGTTTTTAA
TCTATCTTTATAGATCTTGAATTTCCGTTGTCGGTACAGAGCCATATGCCCATACCTATG
CTATAAGGCTACCGTAGAACGTTTTGACGAAGATGACATATGTTAGCTCGTCATTATTGA
GTGAAAAAAATGTGTTTCTCGCGCCAAAAATGTGTTTCCTGTGTTTTGTTTCCTTTCTCC
TTCATAGCCGTTTTGGCCCACGTTTTCTACATTCTTTTTAAAGGAGGTACATGTTAGGTC
GGCATCACTGCGTGAAGAATGCGTTTCCTGCGGCCAAAAGCAATTATCGGCCACACAATT
GGATGAAATTTCTGGTCCTAAATGTACTGTCATTTTTTTAGTTTTAATTTCCTGTTCAAT
CAATACTGTTATTTCACAATCACGTTAACAGTATCACTGTTACAGCGGCTTTATAGTTGA
CCATGACATACATCGTTGTCGGCTGCAGCGCTTCAGCGGACTAATGAAGCTTTTATTAGC
TGGTGTCAACGAAGTTAAGTGAATTGTGCTGAAGTCTATCTATCTATTCTATCTATTTTC
TATTCTATACTATTATATACTAAAAATAATATAAGGTGAACCAGGAGCAAGAGAAATACT
ATGTTAGAAAATTCCACATTGACATTAACTAGAAGATATCAGTAGTCGATTGGTATATAT
CTTAAAATTAAGATTCCATGATAGTTCGATCTACGTAACATATACAATATGGTGGGCCTC
AAAGGATTTACGTGACACATGTCCATGCACATATGTTTAGGGAAATACATTTGCCAAGGA
AACAATGTATAACTAAAAAAACTGTACAAGCCCACTTTTATCCAGCGGTACTGCTAATGT
TTTGTGTATAAGGTTTTTTTTAGTAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCCGACGTCGCTGCTCCGGCGCCCTTGCCCTGCCCCGCCGCCGCCACGA
TAGGTACTCCCTCCACCCCTGTTATTTTTTTTCCATTTCATACATTTATACCAAGTATGA
GAAGAGCAGAAACCTATATAAGCATGAATTATATATAAGCCTAACTCATTTTATTTAGAA
ACTAGAAGATACCCCACGCGTTGCGACATGAATCCTTGAGAACTTATATGAAAATTCTAA
GTTGAAAAACAAAGGAAAGTTATCTACAAAAAAGTAAAATAAAGGGGAATTTAAGATGCA
TAGTGCAATAGTTGCAATATGAAATGTATTTTGTTTTTATTAATTCTAAATGTATTATGT
TATATCTAGGAACAATTGGATGATCAAACAGAGGTACCAATCCACATAGATAACATTTTA
ATCATGATAAAATTTATTATTATTTGCGATGATTATATCGAGCAAACAAAATCAATAGAA
TAAGGCCCTGTTTGTTAAAAAGTCCTTGGACTTTTTTTAGTCCCAACTAAAAAGTCTTTG
TAAACAAACACCCTCTAAGCCAAAGTGTAGATAAAACACATCATAAATAGGAAGTGAAGC
GAGGAGACGGAGAGTCGATGACCCTTCCAATTGTGATGAAGTTCACATGGGAAGGAAATA
TAGTTAGTCCAGATCAAATTGTTGTTATAGGATATGATATAGGGGTTGTGTTGTGTAATA
AAAATTGAGATGTATGCATGTATCAGTGCATTATTTATCTCCAAAAAAAACGACATGTAC
AATGAAAGATAGTTGTAGGTTTTTATGAAAATAATCGAGAGGTAAGAACAGTTTCACTTT
GCAAGAACATAATCGACAATTCCTCATTTTATTTTGGTGTAAAAGAAGGACTATAGTCTA
TGACCCCAAAGAAAAATAACAAACAGTAGGCACATCACTAAAGAAATGAATATTACAAAG
GGTACAACTGAAGATGGTTTGTCCAGAGGATAAGAACAATCGCACCATGTCTTTTCTTTT
TCCTGGCCCTTTCTTATCCCGCTATAAAAAAGATTGAGGCACAACATATGATTCCAACTC
AAAAGAAAACACACTGAGCACATCAGTAAATAATTGAAACTACCAATGGCAACCAAAGTG
AGTTGATATTCAACTCCAAGATCTAATCCACCTTTAAATACAAAGCCTACCTGTAATAGA
AGTCGTATGCATATTTCTTACAATTCCAACAAAATCCACATTGACGAATATGCCATCATG
AAGTTATCATTGAGAACCTTTGTGTCCTTTACACTTAGTTATTTCACCATCGACTTTAGA
TGACTCCTGCAACTTCATCGACTTTAGATGACTCCTGTAATTGTAGTCCCAGTTTTCATT
CATGACCGGCAATGCTCTTATGAAAATTAAGTTCTTTCCCGTTTATCATCATCACATTAT
TATAAAATCATCACCATTGTGGCCTCTTCCTTAATTCTGCATGAAAGTAAATAACTCATA
TCAGGTGGTACACATATTAGTTACTTGAACTCACCATCCCAACCTTGTAGAGTGTGTGTG
GAACTTGAATAATCCTTTCGACATACTTCTATTCACGCATAATTACATATATAGTAGATG
TCTTAGAATTTCCGCATATGCTTATAACTATGGACCTAGAAACAAAGTAAGGGAAAGGCT
TGGTTGCATGCAGTGCATGAAAAGTTCTCCGGGCTGTGTGCCAACAACTGGTTCTCCAGT
TGAAACATTCTTACCAAAAAGGGTTCCCCCGCTTTATATTATAAAACAATCATCACGAAA
TAGAATAAGAGACCGAACAAACACGCGCCATCATCACCCACATCGCACACACCTAGGGCT
AGATACAAAGGTGCCGGGCACCGACATCTCCCCTACCGATAACCAAGCAAACTAGAGATG
AGCGAGGTGGATCGCTTGGAGCCGATGGAGACCTCCACCATGAGCATTGACAATAGAGAG
GTGAAACGGACAAACCATGAAACTAACCCTCCAAAGCGGTGCCTCACGTAAGGGTGCGAC
CATGGATAGTCTTCATCGCCCGATCGTGAAGATCAGGTTTTCACCCGGAGCAATACGACA
AGAGTGGGAACTCCGCGACGGGGCCTTCAGGAAGGATACAACGTCAACCGCCGTCACCAC
TGTCGGGAAGTCAAATGACTAGGCAAGGGGTGTACCCCGGCGCTCACCCCCTCCGTTGCA
CCCTAGCTACGTCAACCACCCGCAACCACGCCACCCGCACGACCATGGTTGCACGCCCGC
ACCTGAGACACATGCTCCGCCCCAAACGCCATGCCTCCCGCAGCTAGAGCCGCCGCCCTG
CAACCAGACAACCCCGAGATCTACACAAAGGCCCCGACTTTAGACCAACCAGCGGCCCTC
GTCCGATATAACCACCTGCATGCGCTCCACTGGAAGACCTGCGCCAATCCGTCCGCTGCC
AAGGAAATGGTGAGAAAGGGGAGTGGACGAATCCAGACCGATACACCCTCGTGTCGGCGA
TAGGTGACGTGACTGCATCGAGGCCACCCATCCCTCCAACCGAGCTCCCCGCCGAACACG
AGGGAAGGGGGAGAAGGAGAAGCAGACGCATCCGGACCTAGTCTATAGGCTGGTTATGTG
TGATTTAGTTGAGCCTCGGTACCCAGTCGATCAATGAATGGGCAGAGTTGCACAAACCTA
TCATGCAATCAACCATCTAGATCCAAAACTTCCGCTGCTTTCTACCCCTCCCTCCGACAA
TGACCTCCTCCTCTTCTCACTTTTCCTCCAGCAGCTTCGACGAGGATGAGGACTCGGTCT
GCCTATTGCAACTCAGACCCTCGCTACCCCCAAACAATTCTGATTTGTTTTATCCATGAA
GTAATTTGGAGGTCCGATTTTTTATTCTCTGTTAATAATATCATGGGTGTCATTTCTTTG
CTAAATTTCACATGTGAATAGAACAACCGATCTTGTTTGGTAACCTTGAGTTTTAGAACT
GTTTGACTTATTTACATTTTTATTTTATTTTACTGCTTATAGCTGGTGCATGGAACCATA
TTCACCATTGCATTTTCGAGATCCAACCATCTAAAGACTTAAGATTACATGACTTAACAT
GGTGTCTCTCCGAGTGCCTCCAGTTACTAGATATATAAGATAGCAATGCATGGAGAATCT
TTTTGGGTGGCCTGCCAAAAGGGAACAATGTACTATGAAAGAGATACATGTCTTAGAATT
TTCAAACCTCTACCTAACTTCTTGAATATTGTTTTTAAATTAATGAGCACATTTGTGTCA
CACTACTGAAAGTGACAGTTACAATATCACGTGAATCTTGCATTCAGTGTTCCTGTGTGT
CTCCAGTATTATACACGTGTGCCATTTAGGGGCCTCTCCTGTTCTATCTATAAAGCCAAC
CAGTTCACAAGGCATGCATCACTAACCTTAGCATTATCATAGACAAGTGATCAGCTGAGC
TCCATCGTACTCCAGCAATGGCAGCCTCTGTGGAGATTCGCCGCTGCCCACACTCGCAGC
CTGTGATGAACGACAACCAGGGCAGCCACCGGTTTCACCACCCCACTGTCTGGGGGGACT
TCTTCCTTGGTTTCAGGCCATTCACTCCGACGCAGGTGAACTAAATTTAATTAGCACACA
CCAGTATTGTACTTTCCTGTTGGAGGCTGGCATCAAATGAACTAGCACTACTTCCATTGC
ACAACTCTAAATAGATGTACGATATGCATAAGTTAAACAACTTAAGTTTTAACGTACAAT
ATAACACACATCATGCAAAATGGACTGTGAAAGAGTAACCTCGGACACTGTGCAGGTCTA
AATGTCTAAGACAACATGCATTGGAACACCAAGTAAGTACTAATGTTACATGCTCTTGCA
GTGTCTTCTCATGAAAAACAAGGCTGAAGTAATGAAAGAAGAACTGAGGACAACGATAGT
AGATTCGCGTTCTGTTGATCTGCCTCAGAAGCTTGAGCTTGTCGATACTTTACAGCAGCT
TGGTTTGGATTATCACTATGGGAAGGAGATCAATGATTTGCTGTGTGGGATTCATGATGC
CGGCGATGACGCCAGCGATCTTCACACAGTGGCCCTTCGGTTTTATTTGCTCAGGAAACA
GGGATTCAATGTTTCACCAGGTATTACAAACATAACTAAAATCTCAAAGAGGTGGACAGG
TGTGATTTTCTATAAATATTTGTCCTAATAGAACTATGTACTATACATGACAATGCCGCA
GATGTATTCTTAAAGTTCATAGATGCCAAATGAAATATTACCTGCAACGACACAAGAAGC
CTTTTGGCCATGTACAACGCTGCCCATATTCGAACCCATGGTGAAGAAACACTCAGCAGT
GCGATGGCTTACACAACAGACCATCTCCAGCGTGCGGTGGAGCAACAAACAATTCCACCA
TCAATATTGCTCGATCAGGTGCGGCGCGCGCTGGAAACACCTCTTTTCAGGAGGCCTCAA
AGAGTTGAAGTGCGACACTTCATCTCAGTTTATGAGAGAATGAGTACAAGGAATGAGGCC
ATTTTGGAGCTTGCAAAGCTGGATTTCAGTATTCTGCAAGCTCTGTACTGTCAGGAGCTG
AGGGCTCTTACTTTGTAAGTGACTCTCTATGATGAAATCTGTTAGTATGTCGGTAAAATT
TCACCTACTTTCCCTTGGTGGAATTTATATTTCATCACTAAACTCTAAGTCCAGACACTA
CGCGATGCCCCTTAACTCTTGAAACGCGTTTCATATATACCATCCCTCGTACCATTACAA
TCTGAGCTCATGGTTTATTTGCAGGTGGTGGAAAGAACTTCAACTCCAAGACCATTTGAG
CTTCGCACGAGACCGGATGGTGGAGATGCACTTTTGGATGCTAGGAGTTCTATTTGAGCC
ACAATATTCATACGGACGAATCGTGCTCACTAAGTTCTTTATATTTATATCGATATTTGA
TGACATTTACGACAGTTATAGCACCTTAGAAGAAAGCAAACTCCTCACCATGGCAATGGA
AAGGTCTCTATATAGATGTGTGGGATAGGGTGGTTTTAATAACCAATTAATGTGTTGCTT
GATACTAATTCTGGAACAACTATCCATTCTTGTTAGGTGGGATGAACAAGCTGCTGAACA
GCTCCCAGGTTACATGAAGTTCTTCTACAACAAAGTACTCGCTACCATGAAGGTTATTGA
AAAAGACTTGGATAGTCAAGGAAACAAGCATGCAAACTATGTAAAAAATCTAGTAAGTCG
ATGTCTCATGAACATGTTCAATTAAACAAAAATATATCGTTAGATACTTGCATAAGATCA
TTATGTATGGAACGCAACTAGCACTATGGTTCGGATCCCCTGAATCGCATTTAGCAATTG
ATGCAGGGCCATTTGCATGGGTGTACAAGTAGATAAAAGTGATGAAATCATCATGGCTCT
ACATAAATTTAAAGTACAAAATATTTTAACCCATCAACAGTGTAGTCAATGTATGGTGCA
TGGGTGTACAAGTAGATAAAAGTGATGAAATCATCATGGCTCTACATAAATTTAAAGTAC
AAAATATTTTAACCCATCAACAGTGTAGTCAATGTATGGTGCATGGGTGTACAAGTAGAT
AAAAGTGATGAAATCATCATGGCTCTACATAAATTTAAAGTACAAAATATTTTAACCCAT
CAACAGTGTAGTCAATGTATGGTGCATGGGTGTACAAGTAGATAAAAGTGATGAAATAAT
CGAGGCTCTGCAGAAATTTGAAGTTTAAAATATTTTAACTCATAAACAGTGTAGTCGTTG
CATGGTTCATCTTAATTGTTGAATTCGTTTCAAAAAACCTACAAAACTAATATTACAATA
TTGGTTGATAGAAGTTATCACCTAGCTTATGTTTTCTTTATGTTCGCTCGTAAGACAAAT
CTGCTACATGAAAGAAATATGTGTATGGATATCGACAATTAACTTTCCCATGGAAAATAA
ATATACCATTGTACTTGTGCAGCTAATCGATGCTACGAAATGCTACTACAACGAGGCAAA
ATGGCGTGAGGAGAGCGAAACATCAGTTACTGTTGAGGATCACCTGCGATTCTCGGTGCC
TAGCTCTTGTTGCATGCATATTGTATGCCTTGCCCTCGTTGTCATAGGGGCAAGCGTTGA
TGCCATCGAATGGACCATGACCTATCCCAAAATCATGCGAGCTTCTTGCATCATTGGCCG
TGTCATCAACGATGTGGCTTCACACGAGGTTATATACTTAAAACTGAAAATATATGCCAT
GTTTGATTTTATTTGCAGTTTTTCGTTCATGGATAAGTTTGGCATCCTTTTAGTTTCTAG
CTTGTCTCTTATATTTGGTGATGAATATTATGCAAAAACATAATAAATTCTAGTTGTGTG
CAAGAGGATATCTATGCAGATTAAAAGACAGCTAAGTACATTGATGTAATGCCTCCATTC
TGAAATAGTATCTAAGACTCTAAACACCTACTCCCTCCTTTCTGGTTTATAGGGCTCATC
TCAAAAATTTCAGATTTCCATTATACTAGGCATATTTTGAGTCTAATTGAGTTAAAGTGC
TTTGAGTCTCACACCATATTTAATTCATAGAGATAAGAGAAAGGAAATTGGTGGCTATGC
ATGCATCTTTTTCTATATGCACCATGCAAGTCCAATGAAAGGAAGGATGCTACATTTATT
GCCTTGGAAATTGAATATGTGAGAAATATTTCATTGGCTAGTTAGAAGTAGTGCCATCCA
CTCACAGTTCACCCTGGTTAATGAGATTTCAGATTTGAGCCCTATAAACCAGAAAGGAGG
GAGTATATGCATATATTGTTGTAAATTATAAACTTACAGAACTTAAATGTATTAAATCTA
GTGATATTATTGTAGTTGAAAAAGCTCGAATAATTTCGTATATACAAACAATTCCCTTAT
AGATATTTGAAAAAATATTTTCTAAAACACCATCTATGTTGGAGGCGGGATAATAGTTAA
CAGGTCATACAAACTACTTGCCATAAAATATTGGTTAACTAATAGAAAAGTTATTTAACT
AGAAAAGGATAACTGGTCTCTGCATCAATTGATGCATTGATGTATATAGCCATATTAATA
GAAGGTATTATCACTTTGTTAATATGACAATTTTTCCTCTCTCGTAAATCAGCGAGAACA
AGAACAGAGCTCTGGTGAGAGGCCTGTGATATCAACGGTGGAAGCGTGCATGGAGGAGAA
CAACTACACTGCAAAGGAAGATGCATACAGAAAGCTCAGGGAGCTCATAGAGGAGTCATG
GATGGACATCATTGAGGAGATGCTCAAGTCAGCCGCCACACGGCCGGCAGCGCCGCTCCT
AGAGGCCGTGGTGAATTCAACACGGATGTTGGACTTCTTGTACAAGGATCAAGACGCGTA
CACCGATCCACGAGCACTCAAAGTGGTAGTAGATTCTATATATGCAAATCCTATATAGAG
AAAAGCATTTCATTTTGTATAAGCACATAATCATGCTATGAGAAACCATATAACTCAGCA
CTCATGTATCATGCAATGTATCCGTGATAAAACTGTGAGAAAAAAATGTACTTGGGCTAC
CCCTTTGGTGAAAGAATTATTGTACTCCAATTGTGTCTTACACAAAGTTTTCACGTGCAA
ACAATCAGATTCATTTATGCTTTAGAGTAAGTACAATAGTAGAGCCGGTTGCCGGCTGTA
AGCTCATGCCATGTCACCTATAGCCTATCTTATAGCTAACATGTACAATAGTTGGTTAAA
AGAGTGTACTATTTATTTATTATATGACCCATCTTTAAGGAAAATATGCATCTGCTGCTC
ACAACGGTTTTAGCAACTGCATTTTAGGCAAACTATTTTCTTTTTTAGGCAATCAATTCT
GCCCAAAGTGAATACAGCGCTTGGTGTGGACTTCCATATCATTGTCGATACAGAACCATC
TATGCGAGGCCACATGAAGAATCCTTTGTGCCCCCCACTATGAAACCGATAGGCGCAGCT
CTGCTACTAACTTCATGAAAAATATGTTTTGTGCGGCCAAAAGTTTCAAAAAACGAAACC
GCTATCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAGGATCTG
GCCCTACGTCGGCTCTGTAGTATAGTCAGGCCATGTGCCTCCTAGTTGCTCTGTCTGTAC
CCAGACAGCTTATAACTCTTCCGCTGGCTTGTATTGTGTGACTGATATTATGGGTCGTGA
GACCCTTAATGTGTAATAATATGTGTGTGGCTCTTCTGAGCCTCTTAAATAAAGCTTGTA
TGTTTATGGTTATGTTGTGATGCCATTGATGTATCTATACATATCGGTATGCCATGCGTA
CGTGTGTCTTACTTGATATGTATGGGGTTCGAATACCTAGTCGTGAACTTTAGTAGCACC
CCTTACAAGGAAATGCCCCTTTGTGATCCAACGAGCCTTGGTAGTTCGCTACTGCTCTGG
ACACATTGGTTGACCGGCATGTGTCCTTCTTAGCTGCTGTGTCTGTCCCCTTTGGGGAAA
TGTCACGCGATGTAATGGAGTCCTTGTAGCTTGCTACGACTCGTCTACGTTCGTTGATGA
CCGACACCTGCTTTGTTGGGTCATGTATGCCTGTCCTTGTGCGGGACTGCCACTTTGGTT
TATGACTAGACATGTCAATCCGGGTTCTTTGACATTGGAATGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1310, 1404..1539, 2084..2297, 183833..184142, 184236..184371, 185122..185367, 186292..186903
183976..184142, 184236..184371, 185122..185367, 186292..186597
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved