Hordeum_vulgare Locus HORVU4Hr1G062670
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU4Hr1G062670
Hordeum_vulgare
HORVU4Hr1G062670
chr4H
snoZ103
6215..6310
8139
TTCCTGATCTTGCTCACTTTGGCATGTGCCCCCTTGGACGGCTTTTAGTGCCGCGAGGG
AAATGAGCTCCTCGGCCACGAGCAACATCCCGGGCCTCCGTGGCTGCACGCAGCACATCG
CGTCCCGGGCCTACAATAATATTTTTCCTGGATACGTTGAACTTCAACCTTTATTTAAGC
TTTGTTGTTCTTGCAATTAGTAGTTGTGCATAGTGATAGTATGCACCGTCTTCCCCTGTC
CACCCCGCAATCAAACTCATATGATAAGAGTAGGTATTTTCTACCTGTAGCATCATGGAG
GTATTAACTACCTGATGTAGTTGTAGAACAACATCATGTTTGGATTTGCCAAATGTTTGG
GCCTAATGATATTTTATATTAGGGGACATGTTTATTACTTTTTTCCTAGGTGTGTGTGCA
ATGTTGGATTGATGATTGAAGCATAGTAGCGGTTTCTCTTCTTCTTTATAGGTCTATTTG
CAATGAATGTACATAACTATTGTTTCTACCTCTTTCATATTTGACATACATGATAATAAC
AGTAGGCTATTTAATTATATGTGAAGCCAGAAGCTATCTTTGTTGCTAGTGTCTTAAATA
AATAGAAAATCTGTAATAATGATCTGAAATGTCATGCAGGTGATCATTGGTGTTTCCGTT
GTTGTTCCGGTTGGAGGTGTTGCTATTGCATCCGGCGACGCGGGGGGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGTGGGCGCCGATGCAGC
GGAGTTCGGGTGGCGAGCGGAGGAGCTCGGCCGGGTGCGGCGCCCGAACGTGGTGGCGGT
GCGGGCATACTTCCAAGCCAAGGAGGAGCGGGTGCTGGTGTACGCCTACTACCCCAACGG
CAGCCTCTTCTCCCACATCCAGGGTCAGTACACTCGTCTTCAGTCTTCTTCCTTGTTGTG
ACATCCTCGACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCTC
CTCCCACCATCGCGTTCCCCTCACCGTCCCGGTTCCGTTCCGGCAAACGGGACCCCGATC
CGTCGACGGTAGTGACCGGTAGGAGGATTTGAAGAAGGTGTTTTCCTATGTTGAGTTAGC
AGAGAGTTGTTTTCTCTGTTGTCTGTTGGCAGAGAGAGATGTGAGTGTGAGAGTTAAATA
AAATAAAAACAAATGTTGTATTCCGTATGTATGTATGTATGTATTTGATACCCGTATTTA
TGTATGTATTTACGTATATAGGTATGTGGAGAAATACGACATTTGTATGGTTATGTATTT
GTGATTAAAAATGTGTTTTTGGCCTAAGGTCACTTACCGGTGGGGCCAACGCACCCGCTG
TCTATGACATGGAGGCCCCACGCGATAGTTAATATAAATAATAAAAATATATGTTTTTAT
TAAATAAATAAATAAATAGATATAATAATTAATTAATGAGTTAATGAATTAGTTAAATAA
ATATATAAGTTAATCTGTTAATTAGAATAATTAAGTAACCTAATGAGAGGATGCCACGTG
GGTCCCCCACTAAATTAATCTGATTAATTAATATTTAATCTTAATTAAAACTTGTGCCTA
TGACGTTCGGGACCCGCTGGTCAGTTGACCAGTCAACTGTTGATGTCAGCATGACATCAT
GCTGATGTCATAATAGCCTTTTATTAAATTATTCAAATATGTTTTTAATTCCTAATTATT
GAATAACACTTTAAAAATTAATATTAAATAATCCGTAAGTCACATCGAACTATTTTCAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACCCGTCTAT
GACGGATGTTGCTGCGTTAGCTCATATCTAGCCTGCATCTTGCCATGTCATACTTTGTGT
TGCATCGGTGCTATTATTTATTGTTTCTTCCCCCTCTTCTTACCGGTAGACCCGGAGACT
GATGCTGCTGCCGGGTACATCTACGACCCTGCTGATCAGTCCTTTGCCGCAGAGCAGCAA
GGCAAGCAAACCCCCCTTGATCATTCCTATATCGCCTATGTCTTTCTTCCTACTGCTTGC
ATTAGTATTTTTGCTACTGTTGTAGTTAGCTCCTATCTGATGCATAGCCTGTTTTTGATG
AACTGCTACTTTCAGTCCTATACTTTAATCTGCTTAGTATAGGTGGAGCAGTCATCCCCT
CTGACCCCATAGTTCAGTTGCCCCGCTTGTTTTCAAATCTCGATCTCTGATCAACGAGCC
AGACCCGACACAACACATACACCCCCTTCGTTGTACGACGCTACAGAGATACTATCGGGT
ACCGAGGGTGACACCCCGCTAAGTACTCCTGATGATATCTCTGTAGTATAGCTAGTCGGT
CGTGGTTATCGAGGGTGATTCCTCTTTCACCATTCCCGATGACGCCCCTGTCGTGCAACC
CCTCAAGTGTGGGACCCCTGAGGGTGATTCCTCTAAGCCCACCTTGACGGGTACATCGTT
CGGAATCCAACGAGGGTGATACCTCGGATCCCCCCCGATGTTACAACCACACAGTTACTC
GACCATGTTACTGGGATCATTGGTGATTAGCTGTAAGACGGGTGGATTCCCGTGAGGCTG
TGTTGTTGGCCTATTTAAAATGTTAATGGATTTGGTTATTTGACCTGGGTTGGTCGGAGA
CCTTTTCGCACTAACCGGCTACGCGGGAAGAATTATGGGTACTCGGCGTCGCGGTATCAG
CCGAAGATTTTCAGATGCCAGCAATGTAGCGGCGCGCGCCCGAGTGGTCCCGAGATGCAT
CGCGCTTGTGATTAAGGGATGCTAGGACTGACGGCGGCCGCCCACGCCACGTGCAGGAGC
GTGAAGGGGAACTGGGCCCACGAACCCTTTGTGCTTAGGAGTTAGACCGGCGGGCTGGCC
TCTCTGATTGTCTTAGGTGGGGCTTGTGATTAAATAATCCGTAAGTCAGATCAAACTATT
TTCAACATGAAAGTTGATCAACAGAACGAGACGAACCCGGATACACGGCCCGTTCGTCTG
TCACTCGTCCCTAGCATAGCAAACATGGAACATTTCCATCGTTTCGAGTATAACCGGTAG
TAGCCCGAGACCCGGAAAATATCGTCAGATATTCTTCCGACCCGTGTATGACGGATGTTG
CTGGGTTAGCTCATATCTAGCCTGCATCTTGCCATTTCATAATTTGTGTTGCATCGGTGC
TATTATTTATTGTTTCTTCCCCCTCTTCTTACCGGTAGACCCCGAGACTGACGCTGCTGC
CGGCTACATCTACGACCCTGCCGATCAGTCCTTTGCCGCAGAGCAGCAAGGCAAGAAAAC
CCCCCTTGATCATTCCTATATCGCCTATGTCTTTCTTCCTACTCAGGAGATGGAGGTCCC
CGCCACCGACGACTGCTACCCCGACGGTGCCTACTACTACGTGGAGGCCACTGATGATCT
GGAGTAGTTAGGAGGTTCCCAGGCAGGAGTCCTCGCCTCGTTCGATCGTTGTATCTTTTG
TGCTAGCCTTCTCTAAAGCACCCCATGTTTTATGTCTGTACTCAGATATTTGTTGCTTTC
GCTGACTCGTGTGTTTATCGAGCTTTCGTATTCTAGCCCTCGAGGCCCCTGGCGTGTAAT
ATGAAGCTGATGTTATTTTTATTTGTGTCTAGAGTTGTGTTGTGATATCTTCCCGTGAGT
CCTTGGGTTTGATCGTACGCATTTGCGTGTATGATTAGCGTACGATTAAATCGAGGGCGT
CACACTTGTAATCCATTCTCGCCATTTCCATGCTCGGTTAATAAATGCCATGGGATGTAT
GAAAAAACAGCTGCTTCTGCAAAATAGAATCATATTATTTAATCTTGTATGTCATTTATT
CTTTAGACTACAGTCCATAGCATGTATTATCAAGTTAGTTTTTCTTAGTTTCATCATAGG
CAAAATATGCAACGAATTTAGGACTCTAGGTTACATTTTCCCTTCCTAAGAACTGAGAGT
GAACATGCCACAGATATGTGAAATAGTTTTATGCCGTGTCTTTGTCTGTTTTGACATATT
GAGTGTTTCTATTCATCTATGGGAGAACCAAAAATAAGGAGCCGCCTTCAGTGGACCTTT
CACGGAGTAAATCACGGCATCAAGAGGCTTCACAAGGCACATATTCTGATGATGAGACCA
TAGGATCTCTACTTAGGTAAGCTCATTCAGCTTCATATACATAAAAACTGATCACTGAAT
GTTCATGATGCGAGTTGTTAAAACTCATTGATTTATATGCTATGATTTTCTTCCCTGAAC
ACATTTTACTAGGACTAACTACTTTTGTTTTCTCTTATATTGTTTCTTAATTATGCACTT
AGGCCTAGTGAAAACTGAAAACAGTCAATAACCAGTGAGAGTATCTTACTATATCATCTC
CAATAATAATTACTATAGTACTTGATGATGCCTTCTTTTTTGACACGCTATGTTTTTCTT
CCCTCAAAACATTGGACTGGGATTAATTACTTCTATTTTTAATCAGTAGAGGGAAGAAGA
AAAGGTTATCGACATCAGATATTACAGAGAATAAACAAGAACACCTAGATTCCCCGAAGA
ACATTGCTCTGGGCGTTGGGACTATCGGTTCAAATGTCATGTAAGCTCCTATAAGTTGTA
TACCTCGCATACTTGGAATAGCTTAATATCCGAGGGTGTATGTTTTCTCTTATATTGTTT
CCATATTATGCACTTATGCTTAGTGAAAACTAACAACAGTCAATAACCAGTGAGAGTACC
TTACTATATCATGTCCAATAATAATTACTATAGTATTTGATGATGCCTTCTTTTTTGACA
CGCTGAGTGTTCCCCTTCATCTTTATGTATGCTCTGCTAAGTTTTTATCAGCTTTAAGGT
TGAGTACTGGGGTGCGCTTCTTGGTAGCGTAATTTAGCGCTGTACGTTGCCTAGAGATAC
TTTGGGTTAAGATTCTAGCACGAACCATTCTTTGAGATGGTTTTTGCATTCAACTTGTCC
ATACACATCTTAGCACTGAACTGAATTTTGTTTGGATAGTGGTATTTGGGATGCCATGAG
GTATCTGATGCTTGGTTTGCTTTCTTGGCCTTGTTTCTCGTTAGATTGGCAGACATTGAG
AAGGAAACGGGTTTTTGCGATACTGGGTGCTCTCATGATACAGTATATTATTAAACTGTG
CATATTCGGCATCTCAAGTCATGTTTTTGTATCTCTACTTATTCTGAATGTCTAGTAAGC
AGCACGTTCTGTCATGGATGCTGTATAGTTGTCTTGTCTTAAATAAATAGAAACTCCTAC
ACCATTTTTTGTTTGCTGTGAGAAGTGATGATATCGTATCCATTCCACGTTTCGGCACTT
ACTGCGATGATCAATTGCTTTTCTCCTTGGATTATATGGACCTGAGGATACTTTCCCCAA
ATTATCGACTATGACTATACAATGCGCAAATGTAATCCCATCAGGATTCCAAGGCAGAAA
TCTGATCCATCTTTTATGTTTTACTATTGTCTTCTGGTTAATATTTTGAGTGCTAGTGAG
GTTTCCTTTCTCCAATATGGCTAAAGAATTACCCTAGTTGACACCAGAAATCAACTCAGC
ATCAAGCTCTATCTAAATCAATAATGCTCTTTGGTAGTCCCTTTTTCATGTTTTCATTTG
ATTCGATCTAAAACTTCTGAAGGTAATAAATTAGAGTCTCTGGTGCACTTATTGACAGCG
TAATTTAGTGATGTATGTTGCCGAAAGGATTTTTTGGTCTAATATTTTTACACCCTGGTT
TGCACTTGGTTATCACAGAAATGTGGAGTAGCTTGTTTTGTATTATCTTACATGTCTGCT
AATTATTGTGTCATTGACTCCAATAAAGAGAAAGTACCATAAATATATTGAGTTTGTTTG
TCTGCATTTCCTTTGTCCAGAATTTCCTGGAACAATCTTAGATAGTTTGAAGTTTAATTT
CAGTTTCTGTGACCTGTTTAGGTTGGACTTATTATACTCCAGAATTTATATCTCAGGATT
TTTAACACCATCTTCAGGATGAACACAAATCTTTTTCTTTCTAATATTTTTTATATTTGT
TTCCTTTTGATTGATTCATGTGCAGTGTAATGTTCTTGTAGGTTGACAAGTTGTGGCATC
TCGAGCATGCCTCGTAGGAGAGCGGAATGAAGTCCACTATACTGTTGGGACAGTAGCAGA
TGTGCCATTGTTTTATTGTGTAATTTTGTTCGTTCTTGCTATATTCCTGTGTAAGAAAAT
GTATTCATGAGATGATTTATTGTGTTATGTAAACCTGGGATATGTATTTTGTGATGTTAT
ATGATGGATGATTTTTATTCGACTTGGAGTTTTTTTGATTTAAATATGAAAATGTGTTGG
ATTTAATACTAGACAAATAATTGGGTTGAAAAGGCCCAACAAATAGAAATGAATCCAAAT
TCTGGAACAAAAAGTTGCTGAATTCAAAAATGAGAAAGGGCCAAAACTGAAACTGGACCA
AATGTATTTGGGCACTGAAAGGCCAGGGCCCAAATTATAATGATATAAAAAAAATTGAAA
AAAATACTAGAAGTGGTTATAAATAGGCTAAGGCCCAAAAAGAAGCCCAATAAGAAAAAG
CCCAAAAAAATAAAACCAGCCCATATGATCAATTGAAATGGGTTGGGCCGATTTCAACCA
TGACGTTTTGATTTCGTCGTAATTTTGCCACGTAGGACTGCCACTTAGGACTGGGTTTGA
TTGCCAACGATGATTTAGGATCGTCGTAAAGGTTGCGACAATACATGAATCGTCGTAAAA
GTTATGACGATTTTAATCAAAACGTCGTTGTTGTTCATTTGTGACGCTCCGTTTTCGACG
CTTGGTTTTTCGTCGTGAGATCGTCGTAAATTAAAAACCGTGACGATGTAGCGACGAAAA
ATAGCGTCGTGTATTAGCATATTCCTTGTAGTGAGAATCATATTTAGAATTCAGAGAAGA
CTCAAATATTTATCATGAATAATCTAAACATAAACCCACAATTCATCGGTTCTCAACAAA
TGGATCGCATAAAAGAGTTACATCGGATAGATTAAAGCAAAGATGCGATGATCATTGTAT
TGAAGATCAAGAGAGAGAGAGAGACAGGTATCCACCTAGGTACTAATAACTATGGACACG
TAGGTCTGTGGTGAACTACTTACACATCACCATGGGAGCAGGGAGGATGATACAGAGGTC
CTCCATGATCGATCCCCTCAGGTAGGGCACCGAAAAAGTGCTCCAAATGGGCACACGGCA
GAACAGAGACTTGCGGCATCAAAAAACGTGTTTCGGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1162, 2749..4995, 5329..5439, 6941..7139
1003..1162, 2749..2981
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved