Hordeum_vulgare Locus HORVU4Hr1G040280
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU4Hr1G040280
Hordeum_vulgare
HORVU4Hr1G040280
chr4H
U54, U54, U54, U54
3881..3962, 4248..4327, 4460..4540, 4651..4731
6314
ATATCCTACATATTTTTCCTTCTAAATTTTCGGTATAGTTCAAATTTAAATTTGAAATA
GAACTATGAAATGCCCTACTTGAAAAATCCCTAGAACATTCATATAAACTCCGAATGGGG
TAATTCATATTTCTAGAGACTCCAAATATCATGCCCTATTTTTATAGCCACGGTTAACAT
TTTTTCCTTGTCTTGTATAACAGCCCAAATGCACCCCTTGCCTAATTTGTAATATATGTC
CTGATAACCTTCCAACCTTGCCATATGTGCTTGGGTATTAATAAGATTTGCTTCATGAGA
TTTTTCTGCATCATGGCATCATAAACAACATGTCATAATTCTGATTTTGCCTCATGCTTG
CTTGGTGTGTTGATGTGCTATGTGAGAGTGTGGTGATGTGTGCTTCCTAGTGGTGAGTGG
GTCTTAGCCCATTTTGTTTTCAAACTATGCAAACCCATTGTTTCTTCAAACTAGGAAAAA
ACCCTCTTATTCACTTAGTACCAACGTGTGGGTTAAAAGTTGCTCAATTAAATTGTTAAA
AATGTTGCACCTCTCTTAAATATTATGTTTATATTTGTAGAAGTTATTTCTCAACCATTT
TGAGATATTTTTCTGTTACTTCTTGCAAAACATATTGCTATAATAAATAAATGTGGGTTT
TAGTTTGTTGCCCTAAAATTGCCAAGTTCATTCTTATAATTAGTGATTTTTTCTGGGAGT
CCAAAAGTATTTTTATTGTGGCAAAACCCCTCTCTATTTGTGTTCTGTGAATTTTGGATA
GTGGTGTTTTTATAAAAAAAGAAAACCCCCCTTTTAATCTTTTCTGAGAGAGAGAGAACC
CACAGCCCTCCTGGGCCTTTTCCCCGCTGTAGGGCCCACTAGCCACCTCCCGCAGCACAG
CTCCCCGCTAGACGGCAACCTAGGCGCATGCTGTTTCACCCGTAGTTCTTGTTGGGCCGA
AACCCAGCCCAGCCTTCGTGCTTAATACAGCCGCGGCGTAGCTTTCTCACACAAAGCCTC
TTAGCGCGGCTAGGGTTTTGCTCCGCCTAAACGCACGATCCAGATCCCCACACTTCCCTA
GCCCTACCCTACCCTACACCTCCCGGCGGCGGCGTCAGCGGCAGCGACGAGCAGCAGTCA
GCAGCAAGATGAGGCCTATTCTCATGAAGGGGCACGAGCGCCCGCTCACGTTCCTGAAGT
ACAACCGGGACGGCGACCTACTGTTCTCATGCGCCAAGGACCACACCCCCACCGTCTGGT
ACGCGGACAACGGCGACCGCCTCGGCACCTACCGCGGCCACAACGGCGCGGTATGGTCCT
GCGATGTCTCCCGCCACTCCACCCGTCTCATCACGGGGAGCGCCGACCAGACTGCCAAGC
TCTGGGACGTCAAGACGGGGAAGGAACTCTTCACCTTCAGATTCGACGCCCCCGCACGCT
CCGTCGATTTAGCCATCGGCGACCACCTGGCGGTCATCACCACCGACAGCTTCATGGGGA
ATATGCCCACCGCGCAGGTCAAGCGCATCGCCGAGGACCTGCAAGACCGTACGGTTTACT
CCTTTCCGCCTGGAAGTTTCTAGATGTCTAGTTGTCACGTGAATGTGGATTTTAAAGTGT
GCGTTGGTGGTTTGCAGAGACGGAGGAGTCAGCGCTCGTGATATCCGGCATCACCGGGAG
GATTAACAGGGCTGTGTGGGGGCCCGGCAACCGGACCATCATCACCGCTGGTGAAGATGC
CACCATCCGCATCTGGGACTCTGAGGTTAGCACTCCAAGCTTGCACGTAGTCTTGTTGAG
TCCTGCTGGCGATTAGTTCTGGCCTATTAGGATGTCTGGTGCTATTGACCTGTGGCAATT
TGCTTTTGTTAGGATCTTCAACTATTTTTACATGATTGTCATGTAATGGTTGTAATGTAA
AATGTTACTTGATCTCAGGGTTTTATATTTCACACGCTACCCAGATTTCCATGTCATGTG
GTCTGATTCTGTGAGTTTCTTATTGCCAACAATTCCTTGAACTAACACAGCAAACCGCTT
ATATCTGTAAATCTGGCCATATGTGGTGTCTGCTTAGTACTTAGTCTACCTTACTAGAGT
ATTCCCCCCCACTAGAATGCATTTTTGTCTGCGTGGTTTGTTCATTAGAAAGAATGAAGG
AACCAGTATGTTATCTTCTGCAAAGTTTACAGGCCACTATCTATCTCGTCATTGAATTTT
TGTTGTATGCGTCCTGTTTTTAATTTATTCAGTACGTACAATGTTGCTTTTCCCATTTTG
TATGATGTTGTGCATTTATGTTCTATTTTCTCTGGGCTTGTAGACTGGAAAACTTCTGAA
GGAGTCAGACAAGGAGGTTGGACATCAGAAGGCAATTAGCTCACTGTCAAAATCCTTAGA
TTGGTCTCATTTCCTCACAGGTTCCTTGGATAAATCTGCTAAGGTGATACTTCTGGGATT
GCTGGCCTGATAATCTATTCATACGTTATTTTTTATTCATATGTTTTTTTTTTCTGACAT
GTCTGCTATGTGGCAGCTGTGGGATGCAAGAACACTGACCCTGATAAAGACATATGTCAC
AGAAAGACCGGTTAATGCTGTTGATATATCTCCTACTCTTGATCATGTATGCTCCTCTAT
CTGTCACCTTCCTTATCTATGCCATTGTTCTTAAGTTGCTGCAAGCATTTCAATATACAA
GCTCTCTCATAGCACATGGTGTTGTATCTTGAATTCTTAGGTCTTTTTACAAGCTATAAA
AGCATATGTTTTCGCAGGCAACTATGTTGGATTGACTATGAATTTTGTCTGGAATGTGCT
CTTTGCAGTCAGCCCTTTGAGTAATTAATGAAGTTGGATAAGATTACCACATATGTCCTC
TGGACTGAGTGCCACATTTTTTCGTCCTGCCCATCTATTTCCTACCCTTGATTTCTTGTT
CTTGTTAATTAAGGCCCAGATCGTCAAAGTGTAAACCACAATTCCTTTGCAAATCTGATA
TCTCAATTTTTCAGCATCTGTGTTCAGTGCTCATCCCATGCATTCATGATTCTGAACTAA
ATTGGTACATTATAATTGTGTGTTTTGTTATTCTATGGACTCATTTGTACTTGTATTTGT
ATTTTCTAAACATCATATTTTTTGCCATTCTTAGGTGGTTATTGGAGGAGGTCAGGATGC
TATGAATGTTACCATGACAGATCGCCGTGCAGGTAAATTCGAGGCGAAATTTTTCCACAA
GGTGAGCTAGATTCCTTTGCATATATTTACACACAGATGGCTCTTGACTTCCTATGTTTT
AGAGTCAAACGACTAGTCATAAAAAAAAAACGCGAAACGCGACTAGTCATATTTGTGCAG
GGTTACTATTCAAGAGTCGCTACCCCAGAATGACTTCTCAACTCGAAAACCATGCATCCC
ATGGGAAGTTACTCTGTAGAAGTGTTATTATCAACTTCTGTAACAGCATTTTGTTGTTAA
TTCCAGATTTTAGAAGAAGAGATTGGTGGTGTTAAAGGACATTTTGGACCAATCAATGCA
TTAGCATTTAATCCTGATGGGAGGAGGTTAGTTCATACTCTTAACATTGTATTTTGGTTC
TTATATTTGTATTGCCTCTGCACTTGGGTTTGTGATGTGCCTCTGTTCAACACTTGCTAT
GATAATTTGCTCAATAATTTAGCCATATAGATTTTCATGTTGATACAGACTATTTTTAGT
CTGTAGGATGTTGTCAAACATTATGAAAGCAGAGCTTGATTTTGAATATTATATGCATTT
AGTAACCCTGTTTACTATTTCATGTTGATTTATTAGTTCTACATTTTGCCTCCTCACGTT
GGGATGCAATATGCCTCTGTTTCACTTAGTATGCTAAAATCTGCTCAGTGATTAAGCCAT
GTAGGTTCATGGCATATAAGCTATTCTGAGTCTATAGGATGCCATCAAACGTTATGAGAG
CAAATCTTGGTGTTATTTTCTATTCATATTTATTTATCTTCCATGAGAGAAGATCATGGT
TAAGTAATCCTCAATCACCATTTTATTGTCTTCATCCTAAATCTTAAGTCATCCTCTGTT
TCTTAAATTCTACATGGGCATTGAATTTTGGCTGATATGTCGCACATTGTTTGTCTTTGT
TATCTGTTTTTGACATAGTTTGTTTCCTTTGTTCCAAAGCCCTGGCTTCCTACCTTTTAT
CTTGTTGGATAACTGGCTTTTCTGTTGTGTTTTTTCTTCTCAACATGTAGCTCAGTGATT
AGAGCCAATTACATTGGCAATATACGCTATACTGATCATATTTTGATGAAAAGTTTATAT
GAGAGCTACATGAAGTAAAATCCTAATCACATTATACTTGTCATATTTCCAGCCGTGAGG
TCTCCATATATTTTGGTGCCTTTTCTTCACACCTTTTATCTTATTGAATCACTCTCTTTT
GTCATGTTTTGTAATGATGTTGCTTGCTGATTATAGCTAATTACATTGGCAATATATGCT
ATGCTCACTTTGTTTTGATGAAAAGTTGGATATGAGAGCTATATGGTCCACAGAATTTAT
TTTGGCAGATCTGACCTACAATTGCTTGATCATGCTCTCTTGCACATTCCGTTTTATTCT
ACCAGCTGATTCCTCATGTAGATGGTTTGGCAGCTCAGTGATTTCAGACCAATACTTTGG
TTATATACGCTTATTCTGAATATGTTGATGTAAAGTAAATTTGTGAGAGCTGCCAATCCT
TCTTTTTTGTTGATACTTTTATATTTCTTTTGTGATGCCTAATTTATGTTTATCCAAAAA
TGCTTCCAAGAAATATGTTTTTTCAGCTCCCTCTTTGAGCTTCAGTTCTTGACATCTCAT
GTCTTATGACAGTCTTAATGACCGTGTTTTTCCATATGTTGTCCTTAGCTTTTCGAGTGG
CGGTGAGGATGGATATGTCAGGCTACACCATTTTGATCCTGAGTATTTCAACATAAAGAT
GTAAGCCTGTGAATTTCTCAAGGTAACACTTTCTTCACTCAGTGCTCTTGTTCTTGAGCA
GTATCAGTGTATCGTCTTGTTGTTATGAAATGTCTTTGTGCTCCAGGCTTTAATGCTTAT
GCGTTCGTTTCTTATCTTGTTTCAGGCTGCTGTTGAGACGACCCCCTCGTACCTTGGAGA
GAACATAGCTTTTTCTTTTGGCTCAATTTGTGAGAGAACTTGACTTAGCTGGATGGTCTA
CTGTGTAATAGCACCTATTTGTTTACAATCAGCAATGGGGATGCTTAAATTGGCGACATC
GTGTTGCTTTCTCTGCCACTCTTGGTTTTCCTAAACATTCTGCTTTTGATTTGATGTCCA
CTCTGCTTAACATAGTAAATGGATGTGCACTTGGGTGTTTGTTTTTTCACGCCCAAGAAT
TACCAGTTAGGCCTTGTTTTGGTACTAGTGTATTTTAGGGAATTCGTGCGATTATCCCTG
TTAAATCCCTAAATCCTCACATATCCCGAAACACCATTGATTCAGTATATTTGACATGTT
TTATTTCCATATTTCCTCACAAATTTCTAAACTCTAGTGCATTTTTTTTTCAAATATCCA
ATAAACAAAGATGCTGAGCCTATTGACACATTGGCACCTTGGATTGACACGTTGGATTTG
TAGTTCACGTGTATCGCAGAAGGAGAAGAGGCTGTCTGAACACAGTTTTTTTTGAGACAA
CGTGGCAAAGCTTTTATTGATCAATGCTCAAGGGTATAAAAAATAACGAATTAGGGTTGC
CTAACCAAGCATAGCTGCCAAGCTTTGATATTGGGGTTTTTTCACTGACCCATGTGGGGT
AAAAAGAATCACAGAACGAACTCATCCTGAAACATTATCACTTTTTGGCGCTGTTTATAA
CGCCATATACTGTGGTAGGTCTATGTGGTAGGTCTACATAGAAACGTCAGTCTAATGGAG
CGTTGCTAGTCATGTGTGCAACGCCAGTCTTTTGTGGCGTTGCCGGCCATTTGTGCTGAC
ACTGGTGTTTCTCGGCGCAATATATGGGCCTGGCCCATCGCCCACCAACCATCTATTCTC
CTCTTCTTTCCTTCTTCCTTTGGCGAAAAAACTCTCCCTCCACCCCTCCTTTCGATCTCC
CTCCTTCCTCAACTGTTTTGTTGGTTCTTTGGGGCAAATCGAAGAGGCTAGTAAGCTCCT
TCAATCCCTCCAATTAGTTTTTGCAATGACTTTGTATTTGTGTAACTTTTTCCTCATGTG
TTGTAGCGGTAAGGGCGGTAAGGGCCGTGGCGTTCAACCACGGTGGTGTTTCTTTAAAAG
TGAGCACAAACTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1547, 1637..1764, 2323..2625, 3154..3240, 3486..3565, 4908..5001, 5125..5314
1001..1547, 1637..1764, 2323..2469
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved