Hordeum_vulgare Locus HORVU3Hr1G080940
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU3Hr1G080940
Hordeum_vulgare
HORVU3Hr1G080940
chr3H
snoZ119, snoZ122, snoZ122
23605..23705, 23762..23851, 23891..23977
58525
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGGATA
CATAGACAAAACACTGTCCCTAGCAAGCCTCTAGTTGGCTAGCCAGTTGATCAAAGATAG
TTAGTGTCTTCTGATTATAAACAAGGTGTTGTTGCTTGGTAACTGGATCACGTCATTAGG
AGAATCACGTGATGGACTAGACCCAAACTAATAGACGTAGCATGTTGATCGTGTCATTTT
GTTGCTATTGTTTTCTGCGTGTCAAGTATTTGTTCCTATGACCATGAGATCATATAACTC
ACTGACACCGGAGGAATACTTTGTGTGTATCAAACGTCGCAACGTAACTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGACGGAGAGGTATCTCGGGGCCCACTCAGTAATACAACATCACAC
ACAAGCCTTGCAAGCAATGTGACTTAGTGTAAGTTGCGGGATCTTGTATTACGGAACGAG
TAAAGAGACTTGCCGGTAAACGAGATTGAAATAGGTATACGGATACTGACGATCGAATCT
CGGGCAAGTAACATACCGAAGGACAAAGGGAATGACATACGGGATTATATGAATCCTTGG
CACTGAGGTTCAAACAATAAGATCTTCGTAGAATATGTAGGATCCAATATGGGCATCCAG
GTCCCGCTATTGGATATTGATCGAGGAGTCTCTCGGGTCATGTCTACATAGTTCTCGAAC
CCGCAGGGTCTGCACACTTAAGGTTCGACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGGATCTGTTCTGGCCCATCCGCCCAAACCTAGAGGCCTCTCGGCCCTCT
TGTTCTTCCCCGCCGGCTACAAATCGCGCAAAATTTCCCCTGAATTTTCCACAACCACAA
CGCCAACTTTAACCAGAGGAAGAAATTCTCTTGCGAGAGTTCGTGTCTAGTAGAAGAGTG
GAGGAGATGAAGCCGGCGGTTGAAGGCGACGAGCGTGCGGCGGAGATCGCCCGCATCAAG
GCCGCCGCGGCCGCCGCCAAAAAGGCGGCGGAAGAGGTGGTGGATGTGGACGATGAAGGT
GAGGATGACGAGGAGGAGGCGGTTGACGGCGACGACGACGACGACGACGTCGACGACGAT
GGGGAAGAGGACGATGATGAGGGGGTTGAGGGTGAGGAGAAGGGGTCGGCGCCGCAGCAG
GTGGTCGACATCTCCGACGAGGACGACGACGGCGGCGATGAAGAGGACGGTGGTGACGAT
GACGATGACGATGACGACGACGACGACGATGACGAGGAGGACGACGATGAAGTGGATGAG
GAGGAGGACCCCGAGGTATAAATTTCTCATCGTCTCGTATTTTTTTAACATCTCAAATTT
ATCAGTAATTTCGGTTACGTTTAGTCTATGAACATATGGTTCCGTTATGTTAGAGAAATT
CCAGATCTGTCTTCAGATCTTGTCGATTTATGCTTTTCTTAAGTTGCCGTATTTCTCGTA
GCTGGCGATAAATGTGTTCAGATCTGGAAAAAAAGCGAGCCAGACGGGTTGCATCTGGTT
AGGTAGATAGATTTAGGAACTGTGAATTTTTTCTTTTGCTCAACCTGCAGCTTTTTCTGT
TGTGTTTGTTTAGATCTTGTCAATTGTACTCTGCTATACCGTTTATTTTTTATCTGTTCA
GCCTGTTGTGGTAATCGATATTCAGTAGGCATACCGACCTGCCTTCCGTTGTTGTGTGGT
GTCTAGTGTAGGCCGTCAGACTGGTAGCACGTCCCTTTTCGAGAATAGTTGAGGACAAAG
TATATGCTTCCTTTTTTCCTTTAATATAAAGAAAAAAAACCTTGTGCAACTGATAAAAGA
GAAACCGGGCCATGTTATGCTGTCCATGAATTATTTTACTATACTAAATCTGGCTCGTGG
TATTGCTAAGATATCCTGTGGTCTATGAGTTATCTTGCTATACTAAATTTGCCTTGTGGT
GTTCCTAAGATGGTCCTCAGGAAATCTCGCTATTTCACACTCAGATCCAAAGACACCTAG
ATATTCAAATTGTCTGGTGTAGATCTGTCAGATTTGATAGTAGGCTTCTTTCTGGCCCTG
TTTATGTGTGCTTGGAGATGATGATCATCAGAGGCTGTTTCTGAGGACGAGCCTATAGCT
CTCCCTATGTTGCCAAATAACTGATTTGCCTATCTGATCCAAAGCACTAGTGAAATACTT
TCTATTTTCTTCTCATTATTTTCTCATGGAGATGATGAATATCAGAGGCTGTTTCTGAGG
ACGAGCCCAGTGCTCTCCCTATGTTGCCAAATAACTGATTTGCCTATCTGATCCAAAGCA
CTAGAGAAATATTTTCTATTTTCTTATTTTTATTTGGCCATGGGAGATGATGAATATCAG
AGGCTGTTTCTGAGGATGAGCCTAGAGCTCTCCGTATGTTGCAAAATTACTGATTTGCCT
ATCTGATCCAAAGGACTAGTCAAACACTTTCAATTTTCTCTCTTCATTTATTTTGTGAAA
TAGATGATGAATATCTGATGCTGCTTCCGGGTATGAGCCTTGAGCTCTCCCTATGTTGCA
AAATTTCTGATCTGGCCCATAATACTTCTGTTTTCTCTTATTTATTTTGTAAAGGAGATG
ATGAACATCAGAGGCTGTTTCTGAGGATGGGCCTAGAGCTCTCCCTATGTTGCACAATAA
CTGATTTGCCTATCTGATCCAAAGCACTAGTGGTAGATTTTTTTTTCTTGGTTTGTAGTC
AGATGAGGGTTTTATTTTCGTTTGGGGAAATGATGATTAATTCATCACAGATGCCCTTAA
TGGGCTTTCTTAAAGAATGGTGACAAATTGCACGTCAGTCTGATCCCCTAATAGTTTTGT
AAACTAAATTGTTAGTGGTATCCACTCTTATTTGGAAAGTGATGATTGTTTCATCTCAGA
TGTCCTTTATGGATTATTCAGAATGATGAGAAATTGCACGTCAGTCTGATTCCAAACTGT
TGTTAAACTTTGATTTTGTTGAACTTCGACTTGAATCCATCTGTCACTAGCTTATTTTAT
GTTGATAGTTGTCCCCAAATAATTGGTTTTCGTTTCTCATCTGTTGTGACTTGAATCTAT
CTGTCACTAACTGTAATATGCAACTAGCATAGTTGTGAGTAGTCAGACTAATTGACACTT
GTACTATTTGTTGTTTGGCAGGAGGAGTTAGGAACTAAATATCTCGTGCAGCCACTTGGC
CGTGCTGAAGATGAAGAGCATTCCAGTGACTTTGAGCCAGAAGAAAATGGTGATGGTGCT
GATGATGAGGAGATTGAGGATGATGATGCTGAAGAAGATGGTGAGGATTCTGTTAAGGCA
CAATCCTCTTCAAAGAGAAAGAGGTCTGGCGGGGAGGATGAAGATAATGATGACGACGAT
GGTGATGATGAGAAGCCTCCCTCAAAGCGATAGTCAATTTGTTCTGGCTGATCTGAGATC
GTTTCTGCTGAGGGCGAAGAAGGAAAATAATCCTCTTCAAGAGGATTGTTGGTAAATGCT
GTAGTTTTAGGACATCTGTGGTAGGTGTAGCAGCTCGAACTTGAGTCTACCCATGTTAGT
TGTTAGTGCATACTGCTGATGTTGATTAGCAGCCTCTGGAAACTTCTGTATGAGCATGAG
ATATGGGGCTTGTTATATGCTTGTGTAGCTTCTGATTAAAACCTGTGGAATGTGGATGCG
CTTTGTTCCGAATCTTGTATTCATGATATTTCTCTTCAACTGGTTATTGCCAGCTAGCTG
TTATTACTCTACTGTTATGTCTGCTCTGACCTACTTTCTCTGTTCGAAAATACTTGTCAT
GTGTCTAGATGTGCTTTAGTTTTTGGACAGAGAATACTTGTCATGTGCCTAGATGTGCTT
TAGTTTTTGCTACCTATATGTGTTTTAGTTTTTGCGACAAACTTATGGTTCTGTCAAGTT
TGATCTACTCTGATCTTTCTTCACATTATCAACATGCTTTAACTGTTGGGAACCACTAGC
AACCAGACTAGTCTATCACCCTTTGATTGAATTGTTTTGAACCCTGGATTAAGCCAGGGA
AGCACTGTCGATTAAGCTAGGGAAGCATGAATGCATCAACGTATTCTAAAATCAAAAATT
GCTTCCCAGAAATTATGATAATAACTCTATTTTTCTGTTTTTTTGGTAAGTCGTGATTTG
CTTCTACCAAATAAATATATAAATTAGTGCTTCCTTGAAATTACGGAAAATAAATATTTC
TGTAGATGCTTCATATGTAGGGCATGTATGGCATGGAAAGTCCTATTTTGTTGATGGAAG
TATAGTGCAATATGTTAAGGAAATAGAATATTTGATACTATGATTGATTTATTTGTTTCA
GCGAAGCATTATTCAAGTTGCGCTACAATTTTTTAGATGCTTTGGAGACATTTTTTTGTG
TAACAAAAACTATATTCATGTTCGATGGAAACATTTGCTTGGCAATGAAACTTCTATGGA
TCAATGACATGAATGTACACGGTGCAAATTCATTTGATATGAAAATTTACAAGTCTTTTT
TTTGTAACAACACAAATTTTACTTCTACATGGATGCATGAGTGTNNNNNNNNNNNNNNNN
NNNNNNNNTAGTAGAAATATACTTAAAAAAACCAGATAATTTCTTCCACTGTATCACGCT
TCCAAGGATGTTTGTTTCCATGCAGATTTATTTACCATTGAAACACATCATTGGTTTAAA
ACAAAGTGAACTATTGCTTCCATAGAAACTATAATGTGCATCGAGAAAAATCAGAATGTG
CTTCCATAAAACATAATGTGGCAGCTAGGCACAGTTCAAACATCGTCAGCTAGACGCAAA
CCATGCTTCCTTTCAATGTTAGCCGTGCTTGTTGTGATGGTAATCATGCTCCCAATGTTG
GACATACAACCATGCTTCCTTGCAATGTTAGTCATGCTTCTTTGCGATGACAACCGTGCT
TCATTCCTATGGTGGACGTGTCTCCTTCTGTCACACCATTGTTAATTAGCTGCATCAAGA
AGGTTTGGCATGGATGGAGTGGTGGTGCAGCTGCACCATTAGCCATCGACCTCTTGACAA
CAAACTCGGCCAGCTGAATATATCAAATTAAACCAAGGTAAAATGAGGATGTGAGGTACC
ATTTTGTGCACCGGCCGGACGTGCTCCCATCATTATCGAGAAGGGATGGCACTCTAGGTA
CATGAAGCAATCTCGTGTCTCTTGGTGATTTCTCAATGTTTGTTCAACATTCCTACTGGG
ATGGGCATCACGTACGGCAACCTGCTCATTAAGCACATAAAAGGATAAGAATCAATCACA
ACATAATCCAATGAAAGTGACGTGACCAGCAAAATCAGCGTATGCACGTGTTAAAAAAAT
TCTACCGTGATTGAAGATTTTGTGGTCTTACATCATCTTTAATTCCACAAACAAATGAAA
TCAAAACAAACTAACACAGATCTTAACCCTGGTGTGCCTCCCAACTACTTGAATTCCGCA
AATACGGGATGGAGGAGCATAATCTCGGCAAGATGGCTACCTGGGTTAGGAGAGAAAAAG
ATGAACATTGGAGATCGGCTGGTATGTGGGCTCGTTAGTGATACGGTGGAGAACAACATG
CACACTCGTCTAGGCAGAACGTCGAGAAGTACGAAGGGGCAGAGATCCAACCTGTGGCAT
GGATGCGTGATGCCTCTGGCATAAAGTACAGGGGCGAGACAGTGGATGTTGACCCCGATC
GAGAGGAGGGTCGGAGGTATGACAGAGAAACGACGGTACTGATTGATTCAGGAGAAAGAT
AACGGGGTGAGTGATCACGGGGAAGGTGCTGCCTGAAAAACGGGAGGGGCAATAAAAGAG
GATTTTGTTGTGGTCTCTTGGACGTGAGATGAAGGATGAATCAACGGCTTACACGTGGTC
TGATGATGTCCTTGTACCAGACTATAGATAGGAAGTGTTTCCCTTGACCGTCTGCTATTC
ACTGGGGCTTCTGGAGGATTGCTGAATGTGTCCAAACCATCTTAGATGATGTTAGAAAAG
CTTATCTTTAATTGGCGCTACCCCAACTCTATCTCGTATATTATCATTGCGGATTCGTTC
CTTCATTATGTGGCTATACATCCATCTCAACATACGCATCTTCGCCACACCTAGTTGTTG
CACATGTTGCCTGTTTGTCGGCCAACACTCGGCGCCATACAACATTACAGGTCAAACCGC
CGTCCTATAGAACTTGCCTTTTAGCTTTTGTAGCACCCTCTTGTCACACAGAATGCCAGA
AGCTTGGCACCACTTTATCCATTCGGATTTAACTCGATGGTTCATATCTTCATCCATATC
CCCATCCTTCTGTAACATTGACCCCAAATAATAAAAGGTGTCCTTCTGAAGTAGCACATG
CCCGTCAAGGCTAACCCCCTCCTCCTCGTGCTTAGTAGTACTGTCGTCCTCGTCTACATG
CCTGAAGTTCTTTGCCTCACTCACGACTATCGGAACCATAGGCTGCATCAACTCGACGTT
TTTGCCGCCGTTGGACAACGTCGGACTTCACCACCTCCCTACAATAAGTCACCGGAGTCA
CCCATAGCCGTCCGATCTTGATCCAGCGGCGTAAAATAGATGACTTAAAACACTCAAGCA
TTTTCTTTTACAAATAGGTCATCCGCCCGATTAGGACTAACACGCACAACCTTTGGCCAA
TCTTATCGCGCCACATAGCCCGTAGACAATCCGTAGCTTATTTTTTCTTTTCCAGAAATA
GTTCTATTTTTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGATG
AAATCAGAATTGGACCTATCACAAGAGCTCGTGCAAAGATAATAGAACAACAGGTGAATT
CTCTCTTAGTTGAAGATGTTATTTATTTTAATGAGAGCTTTCTACTGCCTAAGTCTTTGT
GTGTTTGCATACTCAAGTGCATGGGAGAAGAAGGCATAGCACGAGGGAGCGAGGAGTTGC
AGCAAGAGGAGCATGACGTGGAGTACAAGCAAGAGGGCGCGAGGGAGGAGAGGCAGTGAG
GATCCCCACGTCGAGTAACACTAGGCGCACCAACACCATGTTGCAGCGCCATACCTCAAG
TACATGGCCTGCGTGCCAAGGGGCTGAACCCAAGTTGGGTCAATTTGTATCAAGTTGAGT
TGAACCACGTTTTGAGTCGAACCAATTTAGGTTGCACCAAGTCAGGAGGACCAGGCTGGG
CGCACTAGACCTAGCGCCCCCCCCCCTTGGGCGCATCACCCAGCCCCTCTTATATAGAGG
GCTGCTCTCAGATTAGTTAGATAGACCACGTTTAAGATAAACCCTAGTTCATGAGACTGC
TATAGGCATTCATCTTGAATTCATTTCTCCAATTCGTATCGATCTGGAGATTATATACTA
CAAGTCAAGTGTGATCTGCTGTTCCATTGGGAATTAGTATATTGCAATTCTAGTCGTTTC
GTGGTCGACGGCTACGTTGCGCAAGTGTGTGAAGTCGTGAATATCCGAAGGGTAGAGAGC
TGTTGCATTGGCATCAGGGATCTAGCGAGGAGAGATCATCGGCGACACCAAGTTATCTAT
CCACCATCATCATCTACGTTACCGCTCACTGAGAAGATCGGGCCACCCCATATCAGATAT
GGACCCAAAGGTCTATGGTGAAATACTCACGCATCATCGGAGAGGTCATGGTGTTGATGC
AGAAGCCCTCCATATCCGAATCCCCCCTCCGGCAGGGCACCAGAACGTGCCCCAGATGGG
ATCTTGCGGAGACAGAAGCTTGCGGCAGCGGAAAAGTATTTTCGTGGATCTCCCGATTTT
TTTGGGATTTTAGGGAATATATAGGCAAAAAACCTAGGGCAGAGGAGGCCTAGGGAGCCC
ACAAGCGTGGGAGGCGCAAACCCCCCTGGACGCGGCTAGGGGGCTTGTGGCGTCCCTGGT
GGCCCTCTGCCTTGGTTCTCAAGTCTCCCGATCGTCTTCTGTTTCGGAAAAAATCTTTTT
GGAGGTTTCTTTCCGTTTGGACTCCGTTTAAAATCCTCCTCTAAAAAGGGTCAAAAACAC
AGAAAAAACAGGAACTGACACTTGGCACTGAGTTAATAAGTTAGTCCCAAAAAAGATATA
AAAGGCATACAAAACATCCAAAGTTTGACAAGATAATAGCCTGAAACCATCAAAAATTAT
AGATACGTTGGAGACGTATCCAGCATCCCCCAGCTTAACTCCTGCTCGTCCTTGAGTAGG
GAAGTGATAAAGACTGAATTTTTGATGTGGAATGCTACCTAGCATAGTTGTCCTTTGTAA
CTTCTTTCATGTGACATGAATGTTCAGATCCGTAAGATTCAAAACAATATTTTGCTATTG
ACATGAAAACAATAATACTTCAAGCAAATTAGCAAGGTAATCATGAACTTTCAAAATAAC
AAGGCCAAAGAAAGTTATCCCTACAAAATCATATAGTCTGGCTATGCTCCATCATCCCCA
CACAACTAATTTAAATTATGCACAACCCCGGTATTGGTCAAGTAATTGTTTTCGCACTCT
TACTTTCTCAAACCTTTTTCAACTATCACGCAATACATGAGCGTGAGCCATGGATGTAGC
ACTATAGGTGGAATAGAGTGTGGTGATGGTTGTGAGACAAAAAGGAGGAGATGGTCACAT
TGACTCGGCGTATCAAAGTTTTATGGAGATGCCCATTAATAGATATCAATGTGAATGAGT
AGGGATTGCCATACAAAGGATGCACTAGATCTATAAGTATGTGAAAGCTCAAAAGGAGAA
CTAGTGGGTATGCATCCAACTTGCTTGCTCACCAAGACCTAGGGAAATTTGAGGAAGCCC
GTCATTGGAATATACAAGCCAAGTTATATAATAAAGATTCCCACTAGCATATGGTGGTGA
TGAAACGAGAGGCTCTCAATCATGAAGAACATGATGCTATTATGAAGCACAAGTGTGGAA
AAAGATAGTAGCATTGTCCCTTCTCTCTTTTTCTCTTTTTTTTATTTGGTGTATTTGGCC
TCTCTTTTTGTTGGGCTCTTTGGCCTATCTTTTTTTATTTCCTCACATGGGACAGTGCTC
TAATAATGATGATCATCACACTTTTATTTACTCACAGCTCAAAGCTCAAAACGATGATGA
CTGTATAGGAAATGCCTCCGGTAGTGTACCGGGATGTGCAACGATCTAGCTTGGCGTATG
ACGTTGAAACATCTCGCTAGCTATCTTACGATCATGCAATGGAAATATGAGAGTGACGGC
ACAAGTCATGAGATGGAACGATGGGAGTTGCATGGCAATATATCTTGGAATGGCTATGAA
AATGCCATAGTAGGTAGGATGGTGGCTGTTTTGAGGAAGGCATATGGTGGGTTTGTGCAT
CGGCGAATATTGCGCGGTACTAGAGAGGCTAGCAATGGTGGATGGTGAAAGTGCATCTAT
ACCATGGACTCAAATTAGTCATGAAGAACTCACATACTTGTTGCGAAAGTTTTTATTAGT
AATCGAAACAAAGTGCTAAACGCATACTCCTAGGGGAAGGGTTGGTAGGTGTTAACCATC
GCGCGATCCCGACCTCAACAAAAAGGATGACAATCAATAGATCAATTATGCTCCTACTTC
CTAACATAGCGGTTCACCATACGTGCATGTTACGAGAATCACTAACTTCAACACAAGTAT
TTCTAGATTCACAACACCCTACTAACATAACTCTTAATATTACCAAATCCACGTCTCAAA
ACTAATTGAGAGGAATCAAACTTCTCTTTCTACTCAATGCACATGAAGATGGAGGTTTTT
GTATCATATTTGGGTACCTATCACCTTTGGGAATACTTTCATAGGACAAGCCAACTACCA
AGTCCCGCACCGCCGTGCTCTAAAAGATCTAAGTGAAGCACATAAAGCAAAATTATCTAG
CTCAAAAGATATAAGTGAAGCACGATGAGCATTCTAGCAAAATCACGCTGAGTGTATGTC
TCTCTCAAAAGGTGTGCAGCAAGGATAACTGTGACACAAAAAAATAAAAGACTCCTACGA
TACAAGACGCTCCAAGCAAAACACATATCATGTGGTGAATACAAATATAGCTCCAAGTAA
TGTTACCGATGGATTGAAGACGAAAGAGGGGATGCCTTCCCGGGGCATCCCTAAGCTTAG
GCTTTTTGGTATCCTTGAATTTGGCTTGGGATGCCTTGGGGATCCCCAAGCTTGAGCTCT
TTTCACTCTTTATCCCTTTGTCCATGAGAACATCACCCAAAACTTGAAAACTTCACAACA
CAAAACTTAAACAGAAACTCGTGATATCATTAGCACAAGAAAACAAACTACCACCTCTTT
AGGTACTGTAGCAAACTTGAATTATATTAATATTGGTGTTAAATTAATGTATTCTCACTT
TTCTATGGCTAGTACCCCCCCCCCCTGATACTATCCATAGTTTCATCAAAACAAGCAACC
AACCCAACAAAAACGGAATCTATCAAAAACAGACCAGTCTGTAGCAATCTGTATACTTCG
TATACTTCTGGTACCTCAATTTTTTTTAACAATTATGACTGCATGGGCAAAATACATATA
TTCCAGCAGCAAAAATAATCAACTCAAAGAATCTTTCTGAATAAAAATGAAAAATAATCT
CGTGAGCGAAAAGTTTCTGTCTTTTTCCAGCAGGATCAAACAACCATCACCAAGACTAGT
CATAAATGTTTTGCTTGGCTCAAACACAAAAAGAAACACAAAAGACACTATCATAACATA
ATTATGATGGTGTGGACGCAACAAAATAGAAATAAAAAGATAAATTCGTTGGGTTGCCTC
CCAACAAGCGCTATTGTTTAACGCCCTTAGCTAGGCATAAAGCGATAGAATCACGTATCG
TCGTCTTTGGTGCTCAAACCATAACTAGCCCTCATCATGGATTCATAAGGCAGTCTTATT
TTCTTTCTAGGAAAGTGTTCCATGCGCTTCTTTAAAGGAAATTGAAATCTAATATTCCCC
TCCTTCATATCAATGATAGCACCGATAGTCCTTAGGAAAGGTCTACCAAGAATGATAGGG
CATGTAGGATTGCAATCAATGTCAAGCACAATGAAATCCACGGGTACATAGTTCCTAATT
GCAATAATAAGAACATCATTGATCCTTCCCATGGGTTTCTTGACAGTAGAATCCGCAAGA
TGCAAATTAAGAGAACACTCCTCAATCTCATTAAAACCCAGAACATCACATAAAGACTTT
GGAATCACGGAAACACTAGCACCCAAATCACACAAAGCATTGCATTCATAGTTTTTGATT
TTGATTTTGATAGTAGGTTCCCACTCATCATGAAGCTTTCTAGGGATAGAAACTTCCAAT
TCAAGTTTCTCTTCAAGAGATTTTATCATAGATTCGACGATATGATCGGTAAAGGCCTTT
TTTTGGCTATAAGTGTGTGGAGAGTTTAGCATGGATTGCATCAAGGAAATGCATTCAATC
AAGGAGCAACTATCATAATTGAATTCCTTGAAATCCAAAGTAGTAATTTCATTACTACTC
AAGGTTTTAATATCTTCTACTCCACTTTCAATGCTTTTAGCATCAAGATAGATGGACTCC
GAATCATTGGGGCGTTTTTCAACCAAAGTGGATTCATATCTAGCCCCATCATCATTAGGT
TTGACACCAGAAAACAAATATTCAATGGGAGTCACACCAAGCACTTTAAGATCTTCGTGA
TTCTAATCATGAGAACACGCCTTTTAAGCCATTCATGTCTAGCATGAATTTGGGCGGTTC
TTTCTTTGCTCTCACTCATGGAAACACGCATAGCTTTCAAAGTTTCATCCATATTGATCT
TGGGAGGAGCACATCTTACTTTCAAAACATCAATATCACTAGACATTCTATCAACGCTCC
TAGCCAAATCGTCAATTTTGAGTAGTTTTTCCTCTACGGACGCATTGAAAATCTTTTGTG
AGTTGATAAACTCTTTGATATTACTCTCTAGATCAGAGGGTAATCTATTGTAATTTCCAT
GAGTATTGGTGTAGGAGTTTGCAAAGTTATTAGAGGGGTTACTAGGAAAAGGCCTAGGAA
CATAGTTTCCTCTAAAAGCATTGTTGTTGCCAAAATTATTCCTACCAATAAAATTAACGT
CCAAGCTAGCGTTGCTACTCTCAATCAAGGAAGACAAGGGCATGTCATTAGGATCTAAAG
GAGCACTTCTACTAGAAACCAAATTAATTAACTCATCCATCTTAGCACTTAACAAGTTAA
TTTCTTCTATAGTGTGTACCTTCTTACTAGTAGGTGACCTTTCAGTGTGCCACTCAGAGT
AGTTCATCATGATATTGTCTAGGAGTTTTGTAGCTTCTCCTAACATGATTTCCATGAACG
TTCCACCTGAGGCGGAGTCCAAAATATTTCTAGAAGCGAATTCAAGCCAGCGTAAAAGAT
TTGTATAATCATCCAAAGACTCAAGCCATGAGCGGGACAATTTCTAATCATCAATTTCAT
CCTCTCCCAAGATTGTGCAACATGTTCATGATCAAGTTGCTTAAAATTCCTGATATCATT
ACAGAGAGAGATAATCTNCATTACGGAGAGAGATGATCTTATCCGGCGGAAAATACTTGG
ATATATAAGCATCTTTGCACTTATCCCAAGAATCGGTACTATTTTTGGGCAAAGAAGAAA
ACCAAGTTTTTGCTCGATCTCGCAACGAGAAAGGAAAAAGATTCAATTTAATCACATCAT
TATCCACATCTTTCTTCTTTTGCATATGCAAAGCTCAATGAAGGTATTAAGATGGGATGT
GGCATCTACACTGGGAAGGCCGGAGAATTGCTCTTTCATAACAAGATTCAACAAAGCAGC
ATTGATTTTGTAAGACTCCGCACTAGTGGCGGGAGCAATCGGAGTACTAATAAAATCATT
ATTATTAGAATTCAAGAAGTCACAAAGTTTGGTGTTTTCAGTCATGGTGACTTCAGCAAG
CTAGCAAGCACACAAGCAAATAGAAAGCAAGCGAGAGAAAAAGGCAAAGAAAAAAGGCAA
ACGAAAAAGGCAAATATTTTTGTAATTTTTTGTTTTTCAGAAGTGGGGGAGAGGAAAACG
AGAGGCAAGAAATTAATGCAAGAGATGAGTTTGCGACACTTACTTGGATGAGTTCTTGAC
TTGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATCTTTAGTTATCCTATGATTTGGA
AGAATAAAGTTCTAGTGTGATTTAGTTTTGAGTGTTTGCTTCGTGATCTATCTATCGATG
TAATCGAGCTTGAGAGTTATATAATAAAGAGTAGTTTCAGTTTGTTTGCTTTACTTTTGT
GCATCAACCCCATCAATAAAAAGAATAAATAAAAGATCATATGCTAATCCCATGGAGAGT
GGTCACTTTACATAAAAAGAGTATGATTTATGAAACTTGTTGGAAGTTGACGAACATAGT
ATTAGTCATTGAAGCTATTTCATGAAAAAGTAATAATGAAAGAGATGTTCCACATATAAA
TATACTATCTTCGACATCCTTTATGATTGTGATCCCCCATTAAATATTATATGCATGATC
AACTAGTTGACATTGGACAAGGAAGACAATGTATTGAGTTATGTTTGCTTATATTCACAT
AGAAGTTATATTGTTACGAATCCTCCAACATGTGTTACTTGGTCATAACCTTTGCTAGAC
AGAACTTCACACCAAGTAGAGATACTACTTGTGCATCCAAAATTTGTTAAACATGGTTTC
TTGCCATAAGAGGCCACCATACCTACCTATGGATTAAACAAGATTCTTCAAGTAAGTTTT
CATCATTACAAAAGCAATAAAAATTGCTCCTACATATGTATGATCTTTTATTGCAAGGGA
AAATAAGCTTTATACGAACTTGTGATGGCAAAGAAATAAAAGGGATGGGCTACATAATAA
ATGTTGCTATCACAAGGGGCAATATAAAGTGATGTTCTTTTCCTTTAAGAGCTTGCACAT
CTAATAAAAAGTGCATGACAACCTCTGCTTCCCTTTGCGAAGGGCCTATCTTTTACTTTC
ATGTATTTATTTTTATGCAAGAGTCATCAATGTTCATCCCTATTCCATCCTTATTTAATT
TGTACTTGGCAACCATCATGTGGTCGGGAAAGATCTAGGCATATATATATATATATCCAG
TTCAATGTATAGGTGATCATGAGTTATTATTGTTGAAATTATCCCCGAGATAGGTAGTTG
GGTGGTGAAAACTATAAACCCATATATTCATATGTGCCTGATTGATGCTTTTTGTTTCAC
AAATATGACGTGAATGTGAGCAATCATAGAAGACTAAATGACAGTTGAGTATGTGAACTT
GCTAAACAAAGCTCTAACATAGACTCTTTCTGAAATATGATGAATTGTAATTGCTTCAAT
GACTAAGAACATACCTTGTTAGTTTTCAATAAGGTTTGTGGTTTAAACTTTAGTGTGTGA
GTATATTACCACTTGTTCATGTGAAGTTTTATGATGATATATTGCTGCTATGATGACGAT
CATGATGCTATCATGTCCATATTTTTGTTTTTTATTGATACGTGTCTCTCTAAGCACGTG
GTCATTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGTTCACTA
GAGGCTTCTCTTAAAATAGCAATTAATACGGTGGGTGAACAAATTATTGTCGAGCAATTG
ATAGAACCGCGCAAAGTCATGACGATATATAAGGCAATGATCATACATATAGGCATCACG
TCCGAGACAAGTAGACCGATACTTTATGCATCTACTACTAGTACTCCACACATCGACCNG
CACTTCTCCCATTGCAAGAATCATAGATCAAGCTGGCCAAACAAAACCCACAACTCGAAG
AGAATTACAAGGATATGAAATCATGCATATAAGAGATCAGAAGATACTCAAATAAGATTC
ATTTGATCATAAATCCACAATTCATCGGATCTCGACAAACACACCGCAAAAGAAGATTAC
ATCGGATAGATCTCCATGAAGATCATGGAGAACTTTGTATTGAAGATCCAAGAGAGAGAA
GAAGCCATCTAGCTACTAGCTATGGACCCAAAGGTCTATGGTGAACTACTCACGCATCAT
CGGAGAGGTCATGGTGTTGATGAGGAAGCCCTCTGTATCCGAATCCCCCCTTCGGCAGGG
CACCAAAACGTGCCCGAGATGGGATCTTGCGGAGACAGAAGCTTGCGGCGGGGGAAAAGT
ATTTTCGTGGATCTCCTGATTTTTTCTGGGATTTTAGGGAATATATAGGCGAAAGACCTA
GGGAAGAGGATGCCCAGGGAGCCCACAAACCTGGGAGGCGCGCCCCCCTGGCCGCGGCTA
GGGGGCTTGTGGGGTCCCTGGTGGCCCTCTGCCTTGGTTCTCAAGTCTCCCGATCGTCTT
CTGTTTCAGAAAAAATCTTTTTGGAGGTTTCTTTTCGTTTGGACTCCGTTTAAAATCCTC
CTCTGAAAAGGGTCGAAAACACGGAAAAAATAGGAACTGGCACTTGGCATTGAGTTAATA
AGTTAGTCCCAAAAAAGATATAAGAGGCATACGAAACATCCAAAGTTTCACAAGATAATA
GCATGAAACCATCAAAAATTATAAATACGTTGGAGACGTATTAGTGCACCACCCTTGGCT
TGTTCCAAGCTTGAGGGAGGTACCCCAGTATTGTATCACGATCACTTTTACCATTGTTAC
TCATTTTCATTCAATCTTTAGTTATCCTATGATTTGGAAGAATAAAGTTCTAGTGTGATT
TAGTTTTGAGTGTTTGCTTCGTGATCTATCTATCGATGTAATCGAGCTTGAGAGTTATAT
AATAAAGATTAGTTTCAGTTTGTTTGCTTTACTTTTGTGCATCAACCCCATCAATAAAAA
GAATAAATAAAAGATCATATGCTAATCCCATGGAGAGTGGTCACTTTACATAAAAAAAGA
GTATGATTTATGAAACTTGTTGGAAGTTGACAAACATAGTATTAGTCATTGATGCAATTT
CATGAAAAAGTAATAATGAAAGAGATGTTCCACATATAAATATACTATCTTCGACATCCT
TTATGATTGTGATCCCCCATTAAATATTATATGCATGATCAACTAGTTGACATTGGACAA
GGAAGACAATGTATTGAGTTATGTTTGCTTATATTCACATAGAAGTTATATTGTTACGAA
TCCTCCAACATGTGTTACTTGGTCATAACCTTTGCTAGACAGAACTTCACACCAAGTAGA
GATACTACTTGTGCATCCAAAAACGGTTAAACCTGGTTTCTTGCCATAAGAGGCCACCAT
ACCTACCTATGGATTAAACAAGATTCTTCAAGTAAGATTTCATCATTACAAAAGCAATAA
AAATTGCTCCTAAATATGTATGATCTTTTATTGCAAGGGAAAATAAGCTTTATACGAACT
TGTGATGGCAAAGAAATAAAAGGGATGGGCTACATAATAAATGTTGCTATCACAAGGGGC
AATATAAAGTGATGGTATTTTCCTTTAAGAGCTTGCACATCTAATAAAAAGTGCATGACA
ACCTCTGTTTCCCTTTGCGAAGGGCCTATCTTTTAATTTCATGTATTTATTTTTATGCAA
GAGTCATCAATGTTCATCCCTATTCCATCCTTATTTACTTTGTACTTGGAAACCATCATG
TGGTCGGGAAAGATCTAGGCATATATATATATANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCAA
TGATAAAATAGTTATTATTATATTTCCTGTTTCAAGATAATCGTTTATTATCCATGCTAT
AATTGTATTGAATGAAAGCATAGATACATGTGTGGATATATAGACAAAACAATGTCCCTA
GTAAGCCTCTAGTTGACTAGCCAGTTGATCAAGGATGGTTAAGGTTTTCTGACCATGTGC
AAGTGTTGTCACTTGATGACTGGATCACATCATTAGGAGAATGATGTGATGGACAAGACC
CAAACTATGAACATAGCATGTGATCGTGTCATTTTGTTGCTATTGTTTTCTGCGTGTCAA
GTATTCATTCCTATGACCATGAGATCATGTAACTCACTGACACCGGAGGAATACCTTGTG
TGTATCAAATGTCGCAACATTACTGGGTGACTATAAAGGTGCTCTACAAGTATCTCCGAA
GGTGTCCGTTGAGTTAGCATGGATCAAGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTACCTATTATGGCATTTTCATAGCCATTTCGAGATATATTGCCATGC
AACTCCCACCGTTCCGTCTCATGACTTGTGCCGTCACTTTCATATTGCCTTTGCATGATC
GTAAGATAGCTACCGAGATGTGTCAACGTCATACGCTATGCTAGATCGTTGCACATCCCG
GTACACTGCCGGAGGCATTTCCTATAGAGTCATCATTGCTCTAAGTATTGAGTTGTGAGT
AAATAAAAGTGTGATGATCATCATTATTAGAGCATTGTCCCATGTGAGGAAATAAAAAAG
AGGCCAAAGATGCCCACAAAAAATTGAAAAGAGGCCAATGAGCCTAAAAAGAGAGAGAGA
AAAGAGAGAGAAGGGACAATGCTACTATCTTTTYCCACACTTGTGCTTCAAAATAGCACC
ATGTTCTTCATGATGGAGAGTCTCTTGTTTTGACACTTCCATATACTAGTGGGAATCTTC
ATTATATAACTTGGCCTGTATATTCGAATGATGGGCTTCCTCAAAATTGCCCTAGGTCTT
CGTGAGCAAGCAAGTTGGGTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGAGATTATCCCTCTACATCATGTCATCTTGCTTAAAGCGTTACTCTGTTCGTCATG
AACTCAATACACTAGATGCATGCTGGACAGCGGTCGATGTGTGGAGTAATAGTAGTAGAT
GCAGAAAGTATCGGTCTACTTGTCTCGGACGTGATGCCTATATGCATGATCATTGCCTTA
GATATCGTCATGACTTTGCGCGGTTCTATCAATTGCTCGACAGTAATTTTGACCCACCGT
AATACTTGCTATTTTGAGAGAAGCCTCTAGTGAACACTATTACCCCCAGGGTCTAGTCCT
CACCATATTTTCAACCTTACACTTTTTACTTCGTTGCTCTTACCGCCTTCAGATCTCACT
TTGCAAACAATCTTGAAGGGATTGACAACCCCTTTTGAAGCGTTGGGTGCAAGCTTGTTT
GTGTTTGCGCAGGTACTCTGGACTTGACGAGGCCCTCCTTCTGGATCGATACCTTGGTTC
TCAAATTGAGGGAAATACTTACTGCTCCTGTGCTGCATCACCCTTTCCTCTTCAAGCGAA
AAACCGACGCAAACCAGAGAAGTAACAAGAAGAATTCCTAAGCGCCAGGGAAGGACTTTT
GTTGCCATAGCAGTGGCTACCTGAACCACGACCTTTAAACATGGCATGCTTCTTCTCATG
CATGAAAGGACACCAATATTTTCCACCATATGTGCATGCTCATGGCAGGCCTCCATGCAA
AATTTGAAGGAACTCGAACACCGGACGGATGTTGTGTCACGTTTGGTTAGTGTGTTAAGG
GTTTTCACCGGGAAAACCCTAGAAAATGCATAAAATGTCAAANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAAGGATTTCTGGCGCCGTTGCCGGGGAGGAAGATCAAG
TCAAGAACTCATCCAAGTAGGTGTCGCAAACTCATCTCTTGCATTTACTTTGTTTGCTAG
TTGCCTCTCATTTCCCTCTCCCCCACTTCACCAATTTGCCTTTTTTGTTCGCCCTTTTTC
TCGCCTGCTCTTTGTTTGCTTGTGTGCTTGTTTGCTTGCAGAAGTCACCATGAACGAAAA
CACCAAACTTTGTGACTTCTTGAATACTAATAATAATGATTTTATTAGTACTCCGATTGC
TCCCACCACTAGTGCGGAGTCATACGAAATCAATGCCGCTTTGCTGAATCTTGTTATGAA
AGAGCAATTCTCTGGCCTTCCTAGTGAAGATGTCGCATCCATCTCAATACCTTCATTGAG
ATTTGCGATATGCAAAAGAAAAAAGATGTGGATAATGACGTGATTAAATTGAAGCTTTTT
CCTTTCTTGCTGCGAGATCGAGCAAAAACTTGGTTTTCTTCTTTGCCCAAAAATAGTACC
GATTCTTGGGATAAGTGCAAAGATGCTTATATATCCAAGTATTTTCCGCCGGATAAGATC
ATCTCTCTCCGTAATGATATCATGAATTTCAAGCAACTTGATCATGAACATGTTGCACAA
GCTTGGGAGAGAATGAAATTAATGATTAGAAATTGTCCCGCTCATGGCTTGAGTCTTTGG
ATGATTATTCAAATCTTTTACGCTGGCTTGAATTTCGCTTCTAGAAATATCTTGGAATCC
GCCTCAGGTGGAATGTTCATGGAAATCACATTAGGAGAAGCCACAAAGTTCTTAGACAAC
ATCATGACGAACTACTCTCAGTGGCACACTGAAAGGTCACCTACTAATAAGAAGGTACAC
GCTATAGAATAAATTAACTCGTCAAGTGTTAAGATGGACGAGTTAATGAATTTGATTGCT
AGTAGAAGTGCTCCTTTGGATCCTAATGATATGCCTTTGTCTTCTTTGATTGAGAGTAGC
AACGCTAGCTTGGACGTTAATTTTGTTGGTAGGAATAAGTTTGGCAACAACAACGCTTTT
AGAGGAAACTATGTTCCTAGGCCTTTTCCTAGTAACTCCTCTAACAACTTTGGCAACTCC
TACAACAATACTCATGGAAATTACAATAGATTACCCTCTGATCTAGAGAGTAATATCAGA
GAGTTCATCAACTCTCAAAAGATTTTCAATGCGTCCATAGAGGAAAAACTACTCAAAATT
GACGATTTGGCTAAGAGTGTGGATAGGATTTCTTGTGATGTTGATGCTTTGAAAGTTAGA
TGTGCTCCTCCCAAAATCAACATGGATGAAACTTTGAAAGCTATGCGTGTCTCCATGATT
GAGATCCAAGAAAGAACCGCCCAAATTCGTGCTAGACATGAATGGCTTAAAAAGGCATGT
TCTCCTGATGAGAATCACGAAGATCTTAAAGTGCTTGGTGTGACTCCCATTGAATCTTTG
TTTTATTGTGTCAAACCTAATGATTACGGGGGTGGATATGAATCCACTTTGGTTGAAAAG
TGCCCCAATGATTCGGAGTCCATCTATCTTGATGCTAAAAGCATTAAAAGTGGAGTAGAA
GACGTTAAAACTTTGAGTAGTAATGAAATTACTACCGTGAATTTCAAGGAATTCAATTAT
GATAGTTGTGCCTTGATTGAATGCATTTCTTTGATGCAATCCATGTTAAACTCTCCACAC
GCTTATAGCCAAAATAAAGCCTTTACCGATCATATCGTCGAAGCTATGATAAAAGCTCTT
GAAGAGAAACTTGAATTGGAAGTCTCTATCCCTAGAAAGCTTCATGATGAGTGGGAACCT
ACCATCAAAATCAAAAACTATGAGTTCAATGCTTTGTGTGATTTGGGTGCTAGTGTTTCT
GCGATTCCAAAGTCTTTATGTGATGTTCTGGGTTTTAATGAGATTGAAGAGTGTTCTCTT
AATTTGCATCTTGTTGATTCTACTGTCAAGAAACCCATGCGAAGGATCAATGATGTTCTT
ATTGTTGCAAATAGGAACTATGTACCCGTGGATTTCATTGTGCTTGACATTGATTGCAAT
CCTACATGCCCTATTATTCTTGGTAGACCTTTCTTAAGGACTATCGGTGCTATCATCGAT
ATGAAGGAAGGGAATATTAGATTTCAATTTCCTTTAAGGAAGGGCATGGAACACTTTCCT
AGAAAGAAAATAAGATTTCCTTATGAATCCATGATGAGGGCCACTTATGGTTTGAGCACC
AAAGACGACGATACGTGATTCTATCGCTTCTATGCCTAGCTAAGGGCGTTAAACAATAGC
GCTTGTTGGGAGGCAACCCAATGGATTTATCTTTTTCTTTCTGTTTTGTTGCGTCCATGC
TTTCCACAATTCTATTGTGATTGTGTTTTTTGTGTTTCTTTTTGTGTTTGATCCAAGCAA
AACCTTTATGACTAGTCTTGGTAATGGTTGTTTGATCCTGGTGGAAAAGGACAGAAACTT
TTCGCTCAGGAGATGATTTTTCATTTTTATTCAGAACTAGGTTTTGAGTTGATTATTTTT
TCTGCTGATTGATATCTTTTTCCCTAGGCCGTCGTAATTTTTCAGATTTTTTGAGGTACC
AGAAGTATACGAAGTATACAGATTGCTACAGACTGGTCTGTTTTTGACAGATTCTGTTTT
TGTTGGGTTGGTTGCTTATTTTGATGAAACTATGGATAGTATCGGGGGGGTACTAGCCAT
ACAAAAGTGAGAATATATTAATCTAACACCAATATTAATATAATTCAAGTTTGCTACAGT
ACCTAAGGAGGTGGTAATTTGTTTTCTTGTGCTAATGATTTCACGAGTTTCTGTTTAAGT
TTTGTGTTGTGAAGTTTTCAAGTTTTGGGTGATGTTCTCATGGACAAAGAGATAAGGAGG
GGAAAGAGCTCAAGCTTGGCGATGCCCAAGGCATTCCAAGCCAAATTCAAGGACATCAAA
AAGCCTAAGCTTGGCGATGCCCCGGGAAGGCATCCCCTCTTTCGTCTTCAATCCATCGGT
AACATTACTTGGAGCTATATTTGTATTCACCACATGATATGTGTTTTGCTTGGAGAATCT
TGTATCTTAGGAGTCTTTTATTTTTGTTGTGTCACAATCATCCTTGCTGCACACCTTTTT
GAGAGAGAGACATGCACTCATCGTGATTTTGCTAGAATGCTCATAGTGCTTCACTTATAT
CTTTTGAGCTAGATACTTTTTCTCTAATGCTTCACTTATATCTTTTGAGCTAGATACTTT
TGTTCTTGTGCTTCACTTATATCTTTAGAGCACAGCGGTGCATGACTTGGTAGTTGGCTT
ATGCTATGAAAGAAGTCCCAAATGTGCTAGGTACCCAAAGAGGACGCAAAAACCTCCATC
TTCATGTGCATTGAGTAGAAAGAGAAGTTTTGATTCCTCTCAATTAGTTTTGAGATGTGG
ATTTGGTAATATTGAGAGTTATGTTAGTAGGGTGTTGTGAATCTAGAAATACTTGTCTTG
AAGTTAGAGATTCCCGTAGCATGCACGTATGGTGAACCGCTATGTTAGGAAGTCGGAGCA
TAATTGATCTATTGATTGTCATCCTTTGTGTTGAGGTCAGGATCGCGCGATGGTTAAAAC
CTATCAACCCTTTCCCTCGTAGTATCCCTTTAGCACTTTGTTTCAATTACTAATAAAAAC
TTTCACAATAAGTATGTGAGTTCTTCATGACTAATGTGAGTCCATGGTATAGATGCACTT
TCACCTTCCACCATTGCTAGTCTCTCTAGTGCCGCGCAATTCTCGCCGGTGCACAAACCC
ACCAAATTCCTTCCTCAGAACATCCACCATACCTACGTACTATGGCATTTTCATAGCCAT
TCCGAGATATATTGCCATGCAAATCCCACCGTTCTGTCTCATGACTTGTGCCGTCACTCT
CATATTGCCATTGCATGATTGTAAGATAGCTGGCGAGATGTTTCAACGTCATACGCCATG
CTAGATCATTGCACATTTCGGTACACTTCCGGAGGCATTTCCTATGGAGTCATCATCATT
GTGATCTTTGAGCTGTGAGTAAATAAAAGTGTGATGATCATCATTATTAGAGCATTGTCC
CATGTGAGGAAATAAAAAAAGAAGGCCTAAGAGCCCAAATGAAAAAAAAGAGAAAAAGAG
AGAAGGGACAATGCTACTATCTTTTTCCAAACTTGTGCTTCATGATAGCACCATGTTCTT
CATGATTGAGAGCTTCTTGCTTTGTCACTACCATATGCTAGTGGGAATCTACATTTTATA
ACTTGGCTTGTATATTCCAATGATGGGCTTCCTCAAAATTTCCCTAGGTCTTCGTGAGCA
AGCAACTTGGATGCACACCCACTAGTTTTCCTTTTGAGCTTTCACATACTTATAGCTATA
GTGCATCTCTTGTATGGCAATCCATACTCATTCACATTGATATCTATTAATGGGCATCTG
CATAGCCTATTGATACGCCGAGTCAATATGACCATCTCCTCCTTTTTGTCTCACAACCAC
CACCACACTCTGTTCCACCTATAGTGCTATATCCATGGCTCACGCTCATATATTGCGTGA
TAGTTATAAAAGGTTTGAGAAAGTAAGAGTGTGAAAACAATTACTTGGCCAACTCCGGGG
TTGTGCATGATTTACATTAGTTGTGTGAGGATGATGGAGCATAGTGAGACTATATGATTT
TGTAGGGATAACTTTCTTTGGCCTTGTTATTTTGAAAGTTCATGATTACTTTACTAGTTT
GCTTGAAGTATTACTATTTTCATGTCAATAGCAAACTATTGTTTTGAATCTTACGGATCT
GAACATTCATGTCACGTGAAAGAAGTTGCAAAGGAAAACTATGCTAGGTAGCATATTCCA
CATTAAAAAATCATTGTTTATCACTTCCCTACTCGAGGACGAGCAGGAGTTAAGCTTGGG
AATGCTTGATACGTCTCCAACGTATCTATAATTTTTGATGGTTTCATGCTATTATCTTGT
CAAACTTTGGATGTTTTGCATGCCTTTTATATAATTTTTGGGACTAACTTATTAACTCAG
TACCAAGTGCCAGTTCCTATTTTTTCCATGTTTTTTGACCCCTTTCAGAGGAGATTTTGA
AACGAAGACCAAACGGAAGAAAATCCCCGAAAAGATTTTTTCTTGGAACGGAAAAAGATC
GGGGAACTTGGGATCCAAGCCACAGGAGCTCCAGGGGCCCCACAAGCCCCCACCCCGCGG
ACAGGGGGGCGCACCATCCAGGCTTGTGGGCCCCCTGGAGGTCCCCTGACCTAGGTCTTT
CGCCTATATAATCCCAAAAATTCCAGAAAAAATCAGGAGATCATCGCAATCGCTTTTCCG
CCGCCGCAAGCTTCTGTCTCCGCAAGATCCCATCTGGACGTGCCCTGCCGGAGGGGGATT
CGGACACGGAGGGCTTCTTCATCAACACCATGACCTCTCCGATGATGCGTGACTTGTTCA
CCATAGAGCTATGGGTCCATAGATAGTAACTAGATGGCTTCTTCTCTCTCTTGGATCATC
AATACAAAGTTCTCCATGATCTTCATGGAGATCTATCCGATGTAATCTTATTTTGTGGTG
TGTTTGTCGAGATCCGATGAATTGTGGATTTATGATCCGATTATCTATGAATCTTATTTG
AGTTTCTTTTGATCTCTCTTATGCATGATTTCATATCCTTGTAATTCTCTTTGAGTTGTG
GGTTTTGTTTGGCCTAACTATATCTATGATTCTTGCAATGGGAGAAGTACTTGGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTATGGCTGGCCTCACCAGACCACT
AAGGGCTGGTGCACACCCCTGGGCCACTAGGCTCACTCCCGGGTGGATGGGCCCCTCCCA
GTGAAGATCTGGAACCCATTCGTCACTCCCGGTACACTGCCGGTAATGCCCGAAATCTTT
TCGGAGCCCAAATGAAACCATCCTATATATCATTCTTTGTTTCCGGACCATTCCGGAAAC
CCTCGTGATATCGATGATCTCATCCGGGACTCCTAACAACATTCGATAACCAATACCTAT
AACTCAACTATACTGAAACGTCATCGAACTTTAAGTGTGCAGACCCCGCGTGTTCGAGAA
CTATGTAGACATGACCCGAGACACTCCCCGGCCAATATCCAATAGCGGGACCTGGATGTC
CATATTGGATCCTACATATTCTACGAAGATCTTATCGCTTGAACCTCTATGCCAAGGATT
CATATAATCCCGTATAACATTCCCTTTGTCCTTTGGTATGTTACTTGCCCGAGATTTGAT
CGTCGATATCCCTATACCTATTTCAATCTCGTTACGAGCAAGTCTCTTTACTCATTCCCT
AATACAAGATCCCGTGACTAACAGTTTAGCCACATAGCTTGCAAGGCTTATATGTGATGT
TGTATTACCGAGTGGGCCCGATGATACCTCTCCGTCACACGGAGTGACAAATCCCAGTCT
TGATCCATGCTAACTCAACGGACACCTTCGGAGATACTTGTAGAGCACCTTTATAGTCAC
CCAGTAATGTTGCGACATTTGATACACACAAGGTATTCCTCCGGTGTCAGTGAGTTACAT
GATCTCATGGTCATAGGAATGAATACTTGACACGCAGAAAACAATAGCAACAAAATGACA
CGATCACATGCTATGTTCATAGTTTGGGTCTTGTCCATCACATCATTCTCCTAATGATGT
GATCCAGTCATCAAGTGACAACACTTGCACATGGTCAGAAAACCTTAACCATCCTTGATC
AACTGGCTAGTCAACTAGAGGCTTATTAGGGACATTGTTTTGTCTATATGTCCACACATG
TATCTATGCTTTCATTCAATACAATTATAGCATGGATAATAAACGATTATCTTGAAACAG
GAAATATAATAATAACTATTTTATCATTGCCTCTAGGGCATATTTCCAACGTAAAAGGCA
TTAGAATTGCATAATAAAGTAGAATAATGACCAAAAACAATATAAAAAAGTAGAAAATCA
TGGTGCAACATGGACATATCAACTCCCCCAAGCTTATACCTCGCTTGTTCTCAAGCGAAA
GTTGAACTCGATAATTGTTGGGGAACGTCGCATGGGAAACAAAAAATTTCCTACGCGCAC
GAAGACCTATCATGGTGATGTCCAAATACGAGAGGGGATGTGTGATCTACGTACCCTTGT
AGACCGTACAGCAGAAGCGTTAGTGAACGCGATTGATGTAGTGGAACATCCTCACGTCCC
TCGATCCGCCCCGCGAACCGTCCCGCGATCAGTCTCACGATCTAGTGCCGAACGGACGGG
ACCTCCGCGTTCAGCACACGTATAGCTCAACGATGATCTCGGCCTTCTTGATCCAGCAAG
AGAGACGGAGAGGTAGAAGAGTTCGCCGGTAGCGTGACGGCGCTCCGGAGGTTGGTGGTG
ATCTTATCTCAGCAGGGCTCCGCCCGAGCTCCGCAGAAACGCGATCTAGAGGAAAAACCG
TGGAGGTATGTGGTCGGGCTGCCGTGGAAAAGTCGTCTCAAATCAGCCCTAAAACCTCCG
TATATATAGGGGGAAGAGGGGGAGCCTTGCCTTGGGGTCCAAGGACTCCTAAGGGTTTCG
GCCGAGCCAAGGGGGGCAGCCCTCCCCTTCCAAACCGAGTCCAACTAGGTTTGGAAGGAG
GAGTCCTTCCCCCTTTTCCCACCTCCTCCTTTTTTTCTTTTCTCTTTGATTTTCTTCCTA
TGGCGCATAGGGCCTTGTTGGGCTGTGCCACCAGCCCACTAAGGGCTGGTGTGTCACCCC
CAAGGCCTATGGGCTTCCCCGGGGTGGGTTGCCCCCCCGGTGAACTCCCGGAACCCATTC
GTCATTCCCGGTACATTCCCGGTAACTCCGAAAACCTTCCGGTAATCAAATGAGGTCATC
CTATATATCAATCTTCGTTTCCGGACCATTCCGGAAACCCTCGTGACGTCTGTGATCTCA
TCCGGGACTCCGAACAACATTCGCTAACCAACCATATAACTCAAATACGCATAAAACAAC
GTCGAACCTTAAGTGTGCAGACCCTGCGGGTTCGAGAACTATGTAGACATGACCCGAGAG
ACTCCTCGGTCAATATCCAATAGCGGGACCTGGATGCCCATATTGGATCCTACATATTCT
ACGAAGATCTTATCGTTTGAACCTCAGTGCCAAGGATTCATATAATCCCGTATGTCATTC
CCTTTGTCCTTCGGTATGTTACTTGCCCGAGATTCGATCGTCAGTATCCGTATACCTATT
TCAATCTCGTTTACCGGCAAGTCTCTTTACTCGTTCCGTAATACAAGATCCCGCAACTTA
CACTAAGTCACATTGCTTGCAAGGCTTGTGTGTGATGTTGTATTACTGAGTGGGCCCCGA
GATACCTCTCCGTCACACTGAGTGGCAAATCCCAGTCTCGATCCATACTAACTCAACGAA
CACCTTCGGAGATACCTGTAGAGCATATTTATAGTCACCTAGTTACGTTGCGACGTTTGA
TACACACAAAGTATTCCTCCGGTGTCAGTGAGTTATATGATCTCATGGTCATAGGAACAA
ATACTTGACACACAGAAAACAGTAGCAACAAAATGACACGATCAACATGCTACGTCTATT
AGTTTGGGTCTAGTCCATCACGTGATTCTCCTAATGACGTGATCCAGTTATCAAGCAACA
ACACCTTGTTTATAATTAGAAGACACTGACTATCTTTGATCAACTGGCTAGCCAACTAGA
GGCTTGCTAGGGACAGTGTTTTGTCTATGTATCCACACATGTATATAAGTCTTCATTCAA
TACAATTATAGCATGGATAATAAACGATTATCTTGATACAGGAATTATAATAATAACTAT
ATTATTATTGCCTCTAGGGCATAATTCCAACAGTCTCCCACTTGCACTAGAGTCAATAAT
CTAGCCCTCACATCATCATGCGAATTACATTGTAATAAATCTAACACCCATACAGTTCTG
GTGTTGATCATGCTTTGCCCGTGGAAGAGGTTTAGTCAGCGGGTCTGCTTCATTCAGATC
CGTGTGCACTTTGCATATATTCACGTCCTCCCCTTCGACGTAGTCGCGGATGAGGTTGAA
GCGTCGTTTGATGTGTCTGGACTTCTTGTGAAACCGTGGTTCCTTTGCTAAGGCAATGGC
ACCCGTGTTGTCACAGAACAAGGTTATTGGATTCAGTGCACTTGGCACCACTCCAAGATC
CGTCATGAACTGCTTCATCCAGACACCCTCCTTAGCTGCCTCCGAGGCAGCCATGTACTC
CGCTTCACATGTAGAATCTGCTACGTGGCTTTGCTTGGAACTGCACCAGCTTACCGCACC
CCCATTAAGAATAAATACGTATCCGGTCTGCGACTTAGAGTCGTCCGGATCTGTGTCGAA
GCTTGCATCGACGTAACCTTTTACGACGAGCTCTTCGTCACCTCCATACACGAGAAACAT
CTCCTTAGTCCTTTTCAGGTACTTCAGGATATTCTTGACCGCCGTCCAGTGATCCACTCC
TGGATTACTCTGGAACCTACCTGCCATACTTATGGCCAGGCTAACGTCCGGTCTAGTGCA
CAACATTGCATACATGATAGAACATATGGCTGAAGCATAGGGGACGGTGCTCATATGCTC
TCTATCCTCATCAGTTGCTGGGCACTGAGTCTTACTCAATCTCGTACCTTGTAAAACTGG
CAAGAACCCTTTCTTAGACTGTTCCATTTTGAACCTCTTCAAAACTTTATCAAGGTATGT
GCTTTGTGAAAGTCCTATCAGGCGTTTTGATCTATCCCTGTAGATCTTAATGCCTAGAAT
GTAAGCAGCTTCTCCTAGGTCCTTCATAGAGAAACTTTTATTCAAATAATCCTTTATGCT
CTCCAAAAACTCTATGTTGTTTCCAATCAGCAATATGTCATCCACATATAATATTAGAAA
CGCCACAGAGCTCCCACTCACTTTCTTGTAAATACAAGATTCTCCAACCACTTGTATAAA
CCCAAATGCTTTGATCACCTCATCAAAGCGTTTGTTCCAACTCCGAGATGCTTGCACCAG
TCCATAAATGGATCGCTGGAGCTTGCACACCTTGTTAGCATTCTTAGGATCGACAAAACC
TTCGGGTTGCATCATATACAACTCTTCCTTAGGGAAACCGTTAAGGAACGCCGTTTTGAC
ATCCATCTGCCAGATTTCATAATCGAAAAATGCAACTATTGCTAACATGATTCTGACGGA
CTTAAGCATCGCTACGGGTGAGAATGTCTCATCGTAGTCAACTCCTTGAACTTGTGAAAA
ACCCTTTGCCACAAGTCGAGCTTTATAAACGGTCACATTGCCGTCAGCGTCCGTCTTCCT
CTTAAAGATCCATTTGTTCTGAATAGCCTTACGGCCCTCAGGTAGTACTTCCAAAGTCCA
CACTTTGTTCTCATACATGGATCCTATCTCGGACTTCATGGCTTCTAGCCATTTGTTGGA
ATCTGGGCCCACCATTGCTTCTTCATAATTTGCAGGTTCATTGTTGTCTAACAACATGAT
TGATAAGACGGGATTACCGTACCACTCTGGAGCAGTACGTGGTCTCGTCGACCTGCGTGG
TTCGATAGAAACTTGAATCGGAGTTTCATGATCATCATCATTAACTTCCTCCTCAACCGG
CGTCGCAATGATAGAGGTTTCCCCTTGCCCTGCGCCACCATCCAGAGGGATGAGAGGTTC
GACAACCTTGTCAAGTTCTATCTTACTCCCACTCAATTCTCTCGAGAGAAACTCCTTCTC
GAGAAAAGCTCCGTTTTTAGCAACAAACACTTTGCCCTCGGATTTGAGATAGAAGGTGTA
CCCAACTGTCTCTTTTGGGTAACCTATGAAGACGCACCTTTCCGCTTTGGGTTCCAGCTT
TTCAGGCTGAAGCTTTTTGACATAAGCATCACATCCCCAAACTTTAAGAAACGACAACTT
TGGCCTTTTGCCATACCATAGTTCGTATGGTGTCGTCTCAACGGATTTTGATGGTGCCCT
ATTTAAAGTGAATGCAGTTGTTTCTAATGCATAACCCCAAAATGATAACGACAAATCGGT
AAGAGACATCATAGATCGCACCATCTCTAATAAAGTACGATTACGACGTTCGGACACACC
ATTACGCTGTGGTGTTCCAGGCGGTGTTAACTGTGAAACAATTCCACATTGTCTTAAGTG
AGCACCAAACTCGAAACTCAGATATTCACCCCCACGATCAGACCGTAGGAACTTGATCTT
CTTGTTACGATGATTTTCTACTTCACTCTGAAATTGCTTGAACTTTTCAAATGTTTCAGA
CTTGTGCTTCATCAAGTAGACATAACCATATCTACTCAAATCGTCAGTGAAGGTGAGAAA
ATAACGATATCCGCCGCGCGCCTCTACGCTCATCGGACCACACACATCGGTATGTATGAT
TTCCAACAAGTCACTTGCACGCTCCATAGTTCCGGAGAACGGAGTCTTAGTCATCTTGCC
CATGAGGCATGGTTCGCACGTGTCAAGTGAATCAAAGTCAAGTGACTCCAAAAGTCCATC
AGCATGGAGTTTCTTCATGCGCTTTACACCAATATGACCTAATCGGCAGTGCCACAAAAA
TATGGCGCTATCATTGTTAACTCTAACTCTTTTGGTCTCAATGTTATGTATATGCGTATC
GCTATCAAGATTCAATATGAACAATCCTCTCACATTAGGTGCATGACCATAAAAGATGTT
ACTCATAGAAATAGAACAACCATTATTCTCTGACTTAAAAGAGTAACCGTCTCGCAATAA
ACAAGATCCAGATATAACATTCATGCTCAACGCAGGCACTAAATAACAATGATTTAAGTT
CATCACTAATCCTGATGGTAACTAAAGTGAAACTGTGCCGACGGCGATTGCATCAACCTT
GGAACCATTTCCTACGCGCATCGTCACTTCATCTTTCGCCAGCCTTCGTCTATTCCGCAG
TTCCTGTTTCGAGTTGCAAATATGAGCAACAGAACCGGTATCGAATACCCAGGCACTACT
ACGAGAGCTGGTTAAGTACACATCAATAACATGTATATAAAATATACCTGATTTTTCTTT
GGCCGCCTTCTTATCTGCCAGATACTTGGGGCAATTGCGCTTCCAGTGACCCATACCCTT
GCAATAGTAACACTCTGTTTTAGGCTTAGGTCCAGCTTTGGGTTTCTTCGTCGGATTGGC
AACAGGCTTGCCGCTCTTCTTCGAATTACCCTTCTTGCCTTTGTCGTTTCTCTTGAAACT
AGTGGTCTTATTCACCATCAACACTTGATGTTCTTTACGGAGTTCAGACTCTGCGACTTT
TAGCATCGCAAACAACTCGCCGGGTGACTTGTTCATCCCTTGCATGTTGTAGTTCAACAC
AAAGCCTTTATAGCTTGGCGGCAGTGATTGAAGGATTCTGTCAGTGATAGCCTCTTGCGG
GAGTTCAATCCCCAGCTCAGCTAGACGGTTTGAGTACCCAGACATTTTGAGCACATGTTC
ACTCACACATGAGTTTTCCTCCATCTTGCAAGCATAGAATTTATCGGAGGTCTCATACCT
CTCGATCCGGGCGTTCTTCTGAAAGATAAACTTCAACTCCTGGAACATCTCAAATGCTCC
ATGATGCTCAAAGCGAAGTTGAAGTCCCGGTTCTAAGCCATACAATACTGCACATTGAAC
TACTGAGTAGTCCTCCTTACGTGCTAACCAAGCGTTCTTAACATCCTGATCAGCCGTAGC
GGGTGGTTCATCTCCTAGCGCAGCATTAAGGACATAATCCTTATTCCCATCTTGTAAGAT
TAGCTTAAGAATACGAGCCCAGTCTACAAAGTTGCTTCCATCATCTTTCAACTTAGCTTT
CTCTAGGAACGTATTAAAATTCAGGGTGACTGTCGCATGAGCCATGATCTACAACACAAA
TATATTCAAAGTGGACTTAGACTATGTTCAAGATAATTAGAGTTTAACTTAATCAAATTA
TTTGCTAAACTCCCACTCAAAAAGTACATCTCTCTAGTCATTTGAGTGGTTCATGATCCA
CTTACACTAGCTCAAGTCCGATCATCACGTGAGTTGAGTATAGTTTCAGTGATAAGCATC
CCTATGCTAATCATATCATCTATATGATTCATGATCGACCTTTCGGTCTCATGTGTTCCG
AGGCCATGTCTGCACATGCTAGGCTCGTCAAGCTTAACCCGGGTGTTCCGCGTGCGCAAC
TGTTTTGCACCCGTTGTATGTGAACGTTGAGTCTATCACACCCGATCATCACGTGGTGTC
TCGAAACGACGAACTGTAGCAATGGTGCACAGTCGGGGAGAACACAATTTCGTCTTGAAA
TTTTAGTGAGAGATCACCTCATAATGCTACCGTCGTTCTAAGCAAAATAAGGTGCATAAA
AGGATTAACATCACATGCAATTCATAAGTTACATGATATGGCCATCATCACGTGCTTCTT
GATCTCCATCACCAAAGCACCGGCACGATCTTCTTGTCACCGGCGCCACACCATGATCTC
CATCAACGTGTTGCCATCGGGGTTGTCGTGCTACTCATGCTATTACTACTAAAGCTACAT
CCTAGCAAAATAGTAAACGCATCTGCAAGCACAAACGTTAGTATAAAGACAACCCTATGG
CTCCTGCCGGTTGCCGTACCATCGACGTGCAAGTCGATATTTTCTATTACAACATGATCA
TCTCATACATCCAATATATCACATCACATCGTTGGCCATATCACATCATAAGCATACCCT
GCAAAAACAAGTTAGACGTCCTCTTATTTTGTTGTTGCATGTTTTACGTGGTGACCATGG
GTATCTAGTAGGATCGCATCTTACTTACGCAAACACCACAACGGAGATATATGAGTTGCT
ATTTAACCTGATCCAAGGACCTCCTCGGTCAAATATGATTCAACTAAAGTTGGAGAAACC
GACACTTGCCAGTCATCTTTGAGCAACGGGGTTACTCGTAGCGATGAAACCAGTCTCTCG
TAAGCGTACGAGTAATGTCGGTCCAAGCCGCTTCAATCCAACAATACCACGGAATCAAGA
AAAGACTAAGGAGGGCAGAAAAACGCACATCACCGCCCACAAAAACTTTTGTGTTCTACT
CGATAAGTCATCTACGCATGAACCTAGCTCATGACGCCACTGTTGGGGAACGCGCATGGG
AAACAAAAAATTTCCTACGCGCACGAAGACCTATCATGGTGATGTCTATCTACGAGAGGG
GATGAGTGATCTACGTACCCTTGTAGACCGTACAACAGAAGCTTTAGTGAACGTGGTTGA
TGTAGTGGAACGTCCTCACGTCCCTCGATCCGCCCCCCGAACAATCCCGCGATCAGTCCC
ACGATCTAGTACCGAACGGACGGCACCTCCGCGTTCAGCACACGTACAGCTCGACGATGA
TCTCGGCCTTCTTGATCCAGCAAGAGAGACAGAGAGGTAGAAGAGTTCTCCGGCAGCGTG
AAGGCGCTCCGGAGGTTGGTGATGACCTTGTCTCAGCAGGGCTCCGCCCGAGCTCCGTAG
AAACGCGATCTAGAGGAAAAACCGTGGAGGTATGTGGTCGGGCTGCCGTGGAGAAGTCGT
CGTAAATCAGCCCTAAAAACCTCCGTATATATAGGTGGGAGCGAGGGAACCTTGCCTTGG
GGCTCAAGGAGCCCCAAGGGGGTCGGCCGAGTCCAAGGGGGAAGGCTCCCCCCCCAAACC
GAGTTGGACTTGGTTTGGTGGGTGGGAGTCCTTCCTTCCCTTCCCTCCTCCACCTTTTTT
TTTCTTTTCTCTTTGATTTTCTTTCCTAGGCACATAGGGCCCTTTTGGGCTGCCCCACCA
GCCCACTAAGGGTTGGTGCACCACCCTCATGGCCTATGGGCTTCCCCGGGGTGGGTTGCC
CCCCCCGGTGAACTCTCGGAACCCATTCGTCATTCCCGGTACATTCCCGGTAACTCCGAA
AACCTTCCGGTAATCAAATGAGGTCATCCTATATATCAATCTTCGTTTCCGGACCATTCC
GGAAACCCTCGTGACATCCGTGATCTCATTCGGGACTCCTAACAACATTCGGTAACCAAC
CATATAACTCAAATACGCATAAAACAACGTCGAACCTTAAGTGTGCAGACCCTGCGGGTT
CGAGAACTATGTAGACATGACCCGAGAGACTCCTCGGTCAATATCCAATAGCGGGACCTG
GATGCCCATATTGGATCCTACATATTCTATGAAGATCTTATTGTTTGAACCTCAGTGCCA
AGGATTCATATAATCCCGTATGTCATTCCTTTGTCCTTCGATATGTTACTTGCCCGAGAT
TCGATCGTCAGTATCCGTATACCTATTTCAATCTCGTTTACCGGCAAGTCTCTTTACTCG
TTCCGTAATACAAAATCCCGCAACTTACACTAAGTTACATTGCTTGCAAGGCTTGTGTGT
GATGTTGTATTACCGAGTGGGCCCCGAGATACCTCTCCGTCACACGGAGTGACAAATCCC
AGTCTTGATCCATACTAACTCAACTAACACCTTCGGAGATACCTGTAGAGCATCTTTATA
GTCACCCAGTTAAGTTGCGACGTTTGATACACACAAAGCATTCCTCCGGTGTTAGTGAGT
TATATGATCTCATGGTCATAGGAATAAATACTTGACACGCAGAAAACAGTAGCAACAAAA
TGACACGATCAACATGCTACGTCTATTAGTTTGGGTCTAGTCCATCACGTGATTCTCCTA
ATGACGTGATCCAGTTATCAAGCAACAACACTTTGTTCATAATCAGAAGACACTGACTAT
CTTTGATCAACTGACTAGCCAACTAGAGGCTTGCTAGGGACGGTGTTTTGTCTATGTATC
CACACATGTAAATGAGTCTTCATTCAATACAATTATAGCATGGATAATAAACGATTATCT
TGATACAGGAATTATAATAATAACTATATTCATTATTGCCTCTAGGGCATAATTCCAACA
CTACCCCCATCGGGTATCTTGCAAATCCTATTGAAATCCTCCAAATCCATGGTGTAGGAT
TATCATACAGATCAAACAGTATGGATGAGTCACAGCCGACTGAAAATTTAAATCTACGCA
CGAAAGGGGCAGTGAGCATAGCATACTGTTCACATTTATCTGAGAGGAATTCTGCTAACC
CGATGTTGCGGACAAGTCTATCAAACTCATCCTTGAAGCCTGCTTCGATCATGAACTCAT
CGGAAGGCCATTCACATGGTTGTACGAGTGCGTCCCTTAGTTGATAAGGTTCGGGCTCCC
GAAAAGACAGACGGGGACCCTTCTTACTTGAGGAACCACCATGAAACTTCCTCCTGAACA
TAATTTCCTTTTGCTGAAATTTTTGAAGTTCAAGAGAAAAAGTGAATGAAGACAAACCAC
ACCTTGTAGCAATTACTCCTACTAGTTCCTAGAGACCGTATCACGCGCAAAAACTACTTG
GGACCAGCTAAAATCAATATTTCAAGCTCAAGAATAGGTTCACCAAGGTAACAAGAATAC
GCGAAGGATAAAGCACTAGAGCAAAAACTAATTGGACCAATGGAGGAGTCACTTACCAAG
GAGTAATTTCCCCAAAACGGTTCAGAGAATGATGCTTTGAGCAAGGAGATCGAAAATCAC
AGGCAAATGAGCAAGAACACGGGTTTGAGCTGCGAAAGAATTTTTTCTGGAGGTGGAAGA
AAAGGATGGGAGCTGGAATGAGTGGAGGGGATCCCTGTGGGCCCCACAAGCTTGCCAGCC
GCCACCAGGGGGGCGGCTGCAGGGCTTGTGTCCCACTGGTTTGGCCCCCAGGCCAGCTCT
TAGGCCGAGTCTTTTTCAAATATTCCAGAAAAAATCATACTAGATTTTCAGGACCATGGG
ATAACTTTTTATTTTCGGGGTATTTTTCTCCGGGACGCTAAAACAGAAAACAGAAAAAAC
TAAACTAAATCTATCATTTTTCTTCTAAGCAACAGAAAGTGAAAGCTTAAAAACAGAGGT
ATGTGACTCTTTGATTCATCCATTTCATGGTCATCGAAAGAAATCCGTCAATGGGGTTGA
TCAAACCCTCATGACAAAACCTCTCAAATCGCAAAAAGAGAACGGCGAATTTTTGAATAG
CCACTAAGTCACCTCAATGGGGATATGAATCTCCCCAACAAGCAAATCGTACTTCATCTT
GACACGAGGAATAGGGCATTCAAAGCTCCCAATAAGAATCGATGAAGTCTTTTCGATAGC
ATTGATGAAATGTACTTGATATCGTCTCTTCGGAAAGTGCACTGTATGCTCATTGCCGTT
GACATGGAAAGTGACATTGCCTTTGTTGCAATCTATAACAGCCCCTGCCGTGTTTAATAA
GGGTCTTCCAAGGATGACAGCCATGGCATCGTCCTCGGGAATATCTAAGATAACAAAGTT
TGTTAAGATAGTGGTGTTAGCAACCACAACAGGCACATCCTCGCAAATGCCGATAGGGAA
AGCAGTTGATTTGTCGGCCATTTGCAGAGAAATTTCAGTGGCTGTCAACTTATCCAATTC
AAGTCTACGATAAAGAGAGAGTGGCATAACACTAACACCGACTCCAAGGTCACATAGGGC
AGTTCTTACGTAGTTTCCTTTAATGGAGCAAGGTATAGTGGGCACTCCGGGATCACCAAG
TTTATTAGGAGTTCCACCTTTGAAAGTGTAATTGGCAAGCATGGTAGAGATCTCAAGATC
TGGTATCTTCCGTTTATTGGTCACGATATCTTTCATGTACTTGGCATATGGAGACATTTT
GAGCATATCAGTTAACCGCATCTGCAGGAAGACGAGTATTATCATCTCAACGAAGCGCTC
AACATCCTCATCATCCTTTTTCTTGGATGGCTTAGGAGGAAAGGGCATAGGTCTCCGAAC
CCATGGCTCCCTTTCTTTACCATGCTTCCTAGCAGCGAAGTCATTCTTATCGTATCTCTT
AGGTTGTGGGTTATCAGGATTAACCGTAGGTTCAATCTCCACATCCTCAGCATTGCTAGG
TTGAGCATTATTATGAAAATCGTTGTCCATATTGTCACGAGGTTCATGTTCGTCACCAGT
TTGTGTTTGTGCATCAGACGCAGAAATATCATTTGGTTCTTCAGGTGTGACAGTATTTGG
TGAACTAACATGTAGGTTTCTATCATCCTTCTTCTTCTCCTTAGGATGACTAGGTGTATC
AGCATTAATTCCTTGAGAATCTTGATCAATTCTCTTAGGATGGCCTTCAGGATACAAAGG
TTCCTGAGTCATTTTGCCTCCTCTAATAATGACTCTGACAGAGTTGTCATTTAATTCATT
GAGCAAGTCATTCTGAGCTTTAAGTACTTGTTCTACCTGAGTAGTAATCATAGAGGCATG
TTTACTCAGAAGCTTCAGGTCATTGACATTTCTGTCTACACAAGCACTTAAATGGCTAAG
AATATGAGTACTTTGTTCCAAATGTCTGCTAACATAATCATTGAAACTCTGTTGTTTGGC
AGCAAAGTTGTCAAATTCATCAAAGCATAGGCTAGCAGGTTTATCAAAAGGAATATCACT
CTCGTCAAACCTACGCAGAGAATTCACTTCTACTACCTATATCGGGTTATCGAGACCATG
GATCTCTTCGATAGGTGGTAGATTTTTGACATCTTCAGATCTAATGCCTTTCTCTTGCAT
AGATTTCTTGGCTTCTTGCATATCTTCGGGACAGAGGAATAGAATACCTCTTTTCTTAGG
AGTTGGCTTAGGAGGTGGTTCGGGAATAGTCCAAGCATTATCGTTGATCAAGAGGTTATT
CAGTAGGGTCTCAGCTTGTTCTACAGTTCGTTCCCTAAAAACACAACCGGCACAACTATC
TAGGTGGTCTCTAGAGGCATCGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCACTTGGTGAACACATGAACTCCTCAAACTATGGTCATCACCGGGAGTGGTTC
CGGTTATTGTCACTCCGGGGTTGCCGGGTCATAACACATAGTAGGTAACTACAACTTCTA
AGATCGGATCTAAAACACACATATATTAGTGACAACATAATAATTTCAGATCTGAAATCA
TGGCACTCGGGGCCTAGTGACAAGCATTAAGCATGGCAAAGTAGTAGCAACATCAATCTG
AGAACATAGTGGATACTAGGGATCAATCCCCGTCAAAACTAACTCGATTACATGATAGAT
CTCATCCTACTCATCACCGCCCAGCGAGCCTACGAATAGATTACGCACGGACGATGAAGA
GCTTCATGGAATTGGAGAGGGAAGAAGGTTAATGATGTCGATGGCGATGATTTCCCCTCT
CCGGAGCCCAAAACGGACTCCAGATCTGCCCTCCAGATGAAGAAGAGGATGTGGCGGCGC
CTCCGTATCGCAAACGCGACGAAATCTTCTCTCTTAAATTTTTCAGGGACGAAAGTGAAT
TTATAGAGCCGAGTTTGGGGGCGGCAGAACCACGTGGGCCCCACAAGCTTGCTAGCCGCC
ACCGAGGGGGGGGGGGGTGCGGCTAAAGGGCTTGTGGCCCACTGGCCCATCCCCTCCGGT
GGATCTTTGCGCAGGTATTTTTCATATTTTCCAGAAATATTCTCCGTAAATTTTCACGAC
GTTCCGAGAACTTTCATTTCTGCACAAAAACAACACCAAGGCAATTCTGCTGAAAACAGC
GTCAGTCCAGGTTAGTTCCATTGAAATCATGCAAATCAGAGTCCAAAACAAGGGCAAAAG
AGTTTGGAAAAGTAGATACGATGGAGACGTATCAACTCCCCCAAGCTTAAAACCTTGCTT
GTCCTCAAGCAACATGCTTTCATTGTCAACGCAATGACCAAGAGTTCTCAATATCTTCCA
TGCTACTCATGCTATAGGTGGTTCCCAAACATAAAAGTAAAGTTTTAACTCCCCCACCAC
CAATCAATCACACTCCACGGCGAGCCGAATCCTCGGGTACCGTCCATACTAACATCAATC
CGGGGGAGTCTTGTTTTACAGTTATGTTTTTGATTTAAGCGTGGAACTGGGCATCCCAAT
TACCGGCCCCTTTCTCGTGAAAGACAATGAATAAACACATGTCGAGGATAACACGCCTAA
CATGGAAGATACCAATAGCCCCCTGTAATCACTTGAGCAATTCGGGCATGCAAAACAGAT
TATTTCTTGAAGGTTTGGAGAATGGCACGTGCAAATTTACTTGGAACGGCAGGTAGATAC
CGCAAATAGGTAGGTATGGTGGACTCTCATGGAAAAACTTTTGGGTTTTTGGAAGTGGAT
GCACAAGCAGTATTCCGCTTAGTACAAGTGAAGGCTAGCAAAAGACTGGGAAGCGACCAA
CTAGAGAGCGACGACAGTCTTCAAGATGCAATGAGTTTGACTAACATTGAATGCAAGCAT
GAACAGGATATAAATCACCATGAACACAAACATCATAGAGACTATGTTGATTTTGTTTCA
ACTACATGCATGAACATGCGCCAAGTCAAGCCACTTGAATCATTCAAAGGAGAATACCAT
CCTATCATACTACATCATAGTCATCTCAAAATCTATGTTGGCATTCAAGACAAACCATTA
TAAGCTCTCAGCTAGTTAAGCATGGCATCAGAAACTATGATCTCTAAGTTGTCATTGCAA
ACATGGTTCTCTCACAACAAGGCTGAATCACGCATGACAAGCTAGTCATATTTACAAAAA
CAAAATAGATAGAGTTCATACCAGCTTTTCCAGTCTCAGTCACTTCATCATATATCATCA
TTATTGCCTTTCATTTGCACGATCGAACGATGTGAACAATAATAAGAGTGCTCGTGCATT
GGACTAAGCTCAATCTGCAGGCAAACACAAAGGAGAAGACAAAGTAATATGGCTCTTTGA
AAGCTAAACAAGTATGCATACAAGAGCCACTAAACATTGTAACCAATATCTTCTACCTTG
ACCCAAAGAAAAAGAAAACTATTTACACGGGAAAACTCCCAACAAGCAAAAAGAAGAAAG
GAAAATCATTTTGGGTTTTCTCAAAAGGACACAAAACAAGAAAACAAGAAAACGAAAATA
AACTAGCGTGGATAATACAGTAGGCAAAGTGTAAACACCGACTAACAAAGTGAAAGCATA
AGCATGAATGTAAGGTTGGTGAGAACMAGTACCCCCCCCCCAAGCTTAGGCTTTGGCCTA
GCTTGGTCTACTCCCAAGGATGGTCCTGGCGAAACCCAAAATCATAATGGGTGTTATACG
AGAGTGCTGTAGCCACTGCCTGAATAGTTGCCTCACGAAGTCGAGCAGCCGTCGCCTCCC
TCTCATACTCCTCTGCCTCTCCTATGGTTCTGTAGTATCTTCGTTTTACCTGAAAGTCAA
AGAAAGCAGGAGCAGGAAGGGTAATATGGAAAATATGTTGCGGGTTAAATATCAAGCGGT
ATAGGAGGGATCCATCATCCCTCTCAAGGAACTGGTAGCGTGTTAGAGCGACACGATCAA
GGTAGGCTGTACGGAGAGGGGGGTCTCCTGAACGGATGGATACTCCAAGAAAATTTGCTA
AGCGTGTAGCATAAATTCCACCAAAGAAATCGCGCTCAATGGCATTATTGTTTAGCCTCC
TTGCTATTATAGCTCCCATGTTGAAGCTCCTGTCACCTGTTACTGCGCTCTTAAGGATAC
TAAGGTCGGAAGCGCATAGGTGACAATGTGCACCCTTGCCGTTAATGCACCTACCTATGA
AGAGGGCAAAGTAGTGCAAGGCAGGGAAATGAATGCTTCCTATGGTAGCTTGCGTGATAT
CTCTAGTTTCTCCAACAGTTATACTGGAGACAAAGTCTCTGACCGAAGACTTAGCAGGAT
CATTAATACTACCTGTTGGGAACGTCGCGTGGGAAACAAAATTTTTCCTACGCGCGCGAA
GACCTATCATGGTGATGTCCATCTACGAGAGGGGATGAGTGATCTACGTACCCTTGTAGA
CCGTACAGCAGAAGCGTTAGTGAACGCGGTTGATGTAGTGGAACGTCCTCACGTCCCTCG
ATCCGCCCCGCGAATAATCCCGCGATCAGTCCCACGATCTAGTACCGAACGGACGGCACC
TCCGCGTTCAGCACACGTACAGCTCGACGATGATCTCGGCCTTCTTGATCCAGCAAGAGA
GACGGAGAGGTAGAAGAGTTCTCCGGCAGCGTGACGGCGCTCCGGAGGTTGGTGATGACC
TTGTCTCACCAGGGCTCCGCCCGAGCTCCGCAGAAACGCGATCTAGAGGAAAAACCGTGG
AGGTATGTGGTCGGGCTGCCGTGGAAAAGTCGTCGTAAATCAGCCCTAAAACCTCTGTAT
ATATAGGTGGGAGGGAGGGGACCTTGCCAAGGGGGTCGGCCGAGTCCAAGGGGGAAGGCT
CCCCCCAAACCGAGTTGGACTTGGTTTTGTGGGTGGGAGTCCTTCCTTCCCTTCCCACCT
CCCCCTTTTTTTCTTTTCTCTTTGATTTTTCTTTCCTAGGCACATAGGGCCCTTTTTGGG
CTGCCCCACCAGCCCACTAAGGGCTGGTGCGCCACCCTCATGGCCTATGGGCTTCCCCGG
GGTGGGTTGCCCCCCCGGTGAACTCCCGGAACCCATTCGTCATTCCCGGTAACTCCGAAA
ACCTTCCCGTAATCAAATGAGGTCATCCTATATATCAATCTTCGTTTCCGGACCATTCCG
GAAACCCTCGTGTCGTCCGTGATCTCATCCGGGACTCCGAACAACATAAGGTAACCAACC
ATATAACTCAAATACGCATAAAACAACGTCGAACCTTAAGTGTGCAGACCCTGCGGGTTC
GAGAACTATGTAGACATGACCCGAGAGACTCCTCGGTCAATATCCAATAGCGGGACCTGG
ATGCCCATATTGGATCCTACATATTCTACGAAGATCTTATCGTTTGAACCTCAGTGCCAA
GGATTCATATAATCCTGTATGTCATTCCCTTTGTCCTTCGGTATGTTACTTGCCCGAGAT
TCGATCGTCAGTATCCGTATACCTATTTCAATCTCGTTTACCGACAAGTCTCTTTACTCG
TTCCGTAATACAAGATCCCGCAACTTACACTAAGTTACATTGCTTGCAAGGCTTGTGTGT
GATGTTGTATTACCGAGTGGGCCCCCGAGATACCTCTCCGTCACACGGAGTGACAAATCC
CAGTCTTGATCCATACTAACTCAACTAACACCTTCGGAGATACCTGTAGAGCATCTTTAT
AGTCACCCAGTTACGTTGCGACGTTTGATACACACAAAGCATTCCTCCGGTGTTAGTGAG
TTATATGATCTCATGGTCATAGGAATAAATACTTGACATGCAGAAAACAGTAGCAACAAA
ATGACACGATCAACATGCTACGTCTATTAGTTTGGGTCTAGTCCATCACGTGATTCTCCT
AATGACGTGATCCAGTTATCAAGCAACAACACTTTGTTCATAATCAGAAGACACTGACTA
TCTTTGATCAACTGGCTAGCCAACTAGAGGCTTGCTAGGGACGGTGTTTTGTCTATGTAT
CCACACATGTAAATGAGTCTTCATTCGATACAATTATAGCATGGATAATAAACGATTATC
TTGATACAGGAATTATAATAATAACTATATTCATTATTGCCTCTAGGGCATAATTCCAAC
AGTCTCCCACTTGCACTAGAGTCAATAATCTAGCCCTCATATCATCATGCGAATTACAAT
GTAATAAATCTAACACCCATACAGTTCTGGTGTTGATCATGCTTTGGCCGTGGAAGAGGT
TTAGTCAGCGGGTCTGCTACATTCAGATCCGTGTGCACTTTGCATATATTTACGTCCTCT
CCCTCGACGTAGTCGCAGATGAGGTTGAAGCGTCGTTTGATGTGTCCGGTCTTCTTGTGA
AACCGTGGTTCCTTTGCTAAGGCAATGGCACCCGTGTTGTCACAGAACAAGGTTATTGGA
TTCAATGCGCTTGGCACCACTCCAAGATCCGTCATGAACTGCTTCGTCCAGACACCCTCC
TTAGCCGCCTCCGAGGCAGCCATGTATTCCGCTTCACATGTAGAATCTGCTACGACGCTT
TGCTTGGAACTGCACCAGCTTACCGCACCCCCATTAAGAATAAATACGTATCCGGTTTGC
GACTTAGAGTCGTCCGGATCTGTGTCAAAGCTTGCATCGACGTAACCTTTTACGGCGAGC
TCTTCGTCACCTCCATACACGAGAAACATCTCCTTAGTCCTTTTCAGGTACTTCAGGATA
TTCTTGACCGCTGTCCAGTGATCCACTCCTGGATTACTCTGGAACCTACCCGCCATACTT
ATGGCCAGGCTAACATCCGGTCTAGTGCACAACATTGCATACATGATAGAACCTATGGCT
GAAGCATAGAGGACGGAGCGCATATGCTCTCTATCTTCATCAGTTGCTGGGCACTGAGTC
TTACTCAATTTCGTACCTTGTAAAACTGGCAAGAACCCTTTCTTGGACTATTCCATTTTG
AACCTCTTCAAAACTTTATCAAGGTATGTGCTTTGTGAAAGTCCTATCAGGCGTTTTGAT
CTACCCCTATAGATCTTAATGCCTAGAATGTAAGCAGCTTCTCCTAGGTCCTTCATAGAG
AAACTTTTATTCAAGCAATCCTTTATGCTCTTCAAAAACTCCACGTTGTTTCCAATCAGT
AATATGTCATCCACATATAATATTAGAAACGCCACAGAGCTCCCACTCACTTTCTTGTAA
ATACAAGATTCTCCAACCACTTGTATAAACCCAAATGCTTTGATCACCTCATCAAAGCGT
TTGTTCCAACTCCGAGATGCTTGCACCAGTCCATAAATGGATCGATGGAGCTTGCACACC
TTGTTAGCATTCTTAGGATCGACAAAACCTTCGGGTTGTATCATATACAACTCTTCCTTA
AGGAAACCGTTAAGGAACGCCGTTTTGACATCCATCTGCCAGATTTCATAATCGAAAAAA
TGCAGCTATTGCTACCATGATTCTGACGGACTTAAGCATCGCTACGGGTGAGAATGTCTC
ATCGTAGTCAACTCCTTGAACTTGTGAAAAACCCTTTGCCACAAGTCGAGCTTTATAAAC
GGTCACATTGCCGTCAGCGTCCGTCTTCCTCTTAAAGATCCATTTGTTCTGAATAGCCTT
ACGGCCCTCAGGTAGTACTTCCAAAGTCCACACTTTGTTCTCATACATGGATCCTATCTC
GGACTTCATGGCTTCTAGACATTTGTTGGAATCTGGGCCCACCATTGCTTCTTCATAATT
TGAAGGTTCATTGTTGTCTAACAACATGATTGACAAGACGGGATTACCGTACCACTATGG
AGCAGCACGTGGTCTCGTCGACCTGCGTGGTTCGACAGAAACTTGAACCGGAGTTTCATG
ATCATCATCATTAACTTCCTCCTCAACCGGCATAGCAACTACAGAGGTTTCCCCTTGCCC
TGCGCCACCATCCAGAGGGATGACAGGTTCGACAACCTCGTCAAGTTCAATCTTCCTCCC
ACTCAATTCTCTCGAGAGAAACTCCTTCTCGAGAAAAGCTCCGTTTTTAGCAACAAACAC
TTTGCCCTCGGATTTGAGATAGAAGGTGTACCCAACTGTCTCTTTTGGGTAACCTATGAA
GATGCACTTTTCCGCTTTGGGTTCCAGCTTTTCAGGCTGAAGCTTTTTGACATAAGCATC
ACATCCCCAAACTTTAAGAAACGACCACTTTGGCCTTTTGCCATACCACAGTTCGTATGG
TGTCGTCTCAACGGATTTTGATGGTGTCCTATTTAAAGTGAATGCAGCTGTTTCTAATGC
ATAACCCCAAAACGATAACGGCAAATCGGTAAGAGACATCATAGATCACACCATCTCTAA
TAAAGTATGATTACGACGTTCGGACACACCATTACGCTGTGGTGTTCCAGGCGGTGTCAA
CTGTGAAACAATTCCACATTGTCTTAAGTGAGAACCAAACTCGAAACTCAGATATTCACC
CCCACGATCAGACCGTAGGAACTTGATCTTCTTGTTACGATGATTTTCAACTTCACTCTG
AAATTGCTTGAACTTTTCAAATGTTTCAGACTTGTGCTTCATTAAGTAGACATAACCATA
TCTACTCAAATCGTCAGTGAAGGTGAGAAAATAACGATATCCGCCGCGTGCCTCTACGCT
CATCGGACCACACACATCGGTATGTATGATTTCCAACAAGTCACTTGCACGCTCCATTGT
TCCGGAGAACGGAGTTTTAGTCATCTTGCCCATGAGGCATGGTTCACACGTGTCAAGTGA
ATCAAAGTCAAGTGACTCCAAAAGTCCATCGACATGGAGTTTCTTCATGCGCTTTACACC
AATATGACCTAAGCGGCAGTGCCACAAAAATATGGCGCTATCATTGTTAACTCTAACTCT
TTTGGTCTCAATGTTATGTATGTGTGTATCGCTATCAAGATTCAATATGAACAATCCTCT
CACATTGGGTGCATGACCATAAAAGATGTTACTCATAGAAATAGAACAACCATTAATCTC
TGACTTAAAAGAGTAACCGTCTCGCAATAAACAAGATCCAGATATAATGTTCATGCTCAA
CGCAGGCACTAAATAACAATGATTCAAGTTCATAACTAATCCTGATGGTAACTGAAGTGA
AACTGTGCCGACGGCGATTGCATCAACCTTGGAACCATTTCCTACGCGCATCGTCACTTC
ATCTTTCGCCAGCCTTCGTCTATTCCGCAGTTCCTGTTTCGAGTTGCAAATATGAGCAAC
AGAACCGGTATCGAATACCCAGGCACTACTACGAGAGCCGGTTAAGTACACATCAATAAC
ATGTATATCAAATATACCTGTTTTTTCTTTGGCCGCCTTCTTATCAGCCAGATACTTGGG
GCAATTGCGCTTCCAGTGACCCATACCCTTGCAACAGTAACACTCTGTTTGAGTCTTAGG
TCCAGCTTTGGGTTTCTTCGTCGGATTGGCAACAGGCTTGCCGATCTTCTTTGATTTACC
CTTCTTGCCTTTGCCGTTTCTCTTGAAACTAGTGGTCTTATTCACCATCGACACTTGATG
TTCTTTACGGAGTTCAAACTCTGCGACTTTCAGCATCGCAAACAACTCGCTGGGTGACTT
GTTCATCCCTTGCATGTTGTAGTTCAACACAAAGCCTTTATAGCTTGGCGGCAGTGATTG
AAGGATTCTGTTAGTGATAGCCTCTTGCGGGAGTTCAATCCCCAGCTCAGCTAGACGGTT
TGAGTACCCAGACATTTTGAGCACATGTTCACTGACAGACGAGTTCTCCTCCATCTTGCA
AGCATAGAATTTATCGGAGGTCTCATACCTCTCGATCCGGGCGTTCTTCTGAAAGATAAA
CTTCAACTCTTGGAACATCTCCAATGCTCCATGATGCTCAAAGCGTCGTTGAAGTCCCGG
TTCTAAGCCATACAAGACTGCACATTGAACTACCGAGTAGTCCTCCTTACGTGCTAACCA
AGCGTTCTTAACATCCTGATCAGCTGTAGCAGGTGGTTCATCTCCTAGCGCAGCATTAAG
GACATAATCCTTCTTCCCAGCTTGTAAGATTAGCTTAAGATTACGAGCCCAGTCTACAAA
GTTGCTTCCATCATCTTTCAACTTAGCTTTCTCTAGGAACGTATTAAAATTCAGGGTGAC
TGTCGCGTGAGCCATGATCTACAACACAAATATTTTCAAAGTGGACTTAGACTATGTTCA
AGATAATTAGAGTTTAACTTAATCAAATTACTCGCTAAACTCCCACTCAAAAAGTACATC
TCTCTAGTCATTTGAGTGGTTCATGATCCACTTACACTAGCTCAAGTCCGATTATCACGT
GAGTTGAGCATAGTTTCAGTGGTAAGCATCCCCATGCTAATGATATCATCTATATGATTC
ATGATCGACCTTTCGGTCTCATGTGTTCCGAGGCCATGTCTGCACATGCTAGGCTCGTCA
AGATTAACCCGAGTGTTCCGCGTGCGCAACTGTTTTGCACCCGTTGTATGTGAACGTTGA
GTCTATCACACCCGATCATCACGTGGTGTCTCGAAACAACGAACTGTAGCAACGGTGCAC
AGTCGAGGAGAACACAATTTCGTCTTGAAATTTTAGTGAGAGATCACCTCATAATGCTAC
CGTCGTTCTAGGCAAAATAAGGTGCATAAAAGGATTAACATCACATGCAATTCATAAGTG
ACATGATATGGCCATCATCACGTGCTCCTTGATCTCCATCACCAAGCACCGGCACGGTCT
TCTTGTCACCGGCGCCACACCATGATCTCCATCAACGTGTCGCCATCGGGGTTCTCGTGC
TACTCATGCTATTACTACTAAAGCTACATCCTAGCAAAATAGTAAACGCATCTGCAAGCA
CAAACGTTAGTATAAAGACAACCCTATGGCTCCTGCCGGTTGCCGTACCATCGACGTGCA
AGTCGATATTATCTATTACAACATGATCATCTCATACATCCAATATATCACATCACATCG
TTGGCCATATCACATCACAAGCATACCCTGGAAAAACAAGTTAGACGTCCTCTAATTTTG
TTGTTGCATGTTTGACGTGGTGACCATGGGTATCTAGTAGGATCGCATCTTACATACGCA
AACACCACAACGGAGATATATGAGTTGCTATTTAACCTCATCCAAGGACCTCCTCGGTCA
AATCTGATTCAACTAAAGTTGGAGAAACTGACACCCGCCAGTCATCTTTGAGCAACGGAG
TTACTCGTAGCGATGAAACCAGTCTCTCGTAAGCGTACGAGTAATGTCGGTCCGAGCCGC
TTCGATCCAACAATACTGCGGAATCAAGAAAAGACTAAGGAGGGCAGCAAAACGCACATC
ACTGCCCACAAGAACTTTTGTGTTCTACTCGAGAAGACATCTACGCATGAACCTAGCTCA
TGATGCCACTGTTGGGGAACGTCGCATGGGAAACAAAAATTTTCCTACGGGCACGAAGAC
CTATCATGGTGATGTCCATCTACAAGAGGGGATGTGTGATCTACATACCCTTGTAGACCG
TATAGCAGAAGCGTTAGTGAACACGGTTGATGTAGTGGAACGTCCTCACGTCCCTCGATC
CGCCCCGCGAACCGTCCCGCGATCAGTCCCATGATCTAGTGCCGGACGGACGGCACCTCC
GCGTTCAGCACACGTACAACTCGACGATGATCTCGGCCTTCTTCATCCAGCAAGAGAGAC
GGAGAGGTAGAAGAGTTCTACGGTAGTGTGACGGCGCTCCGGAGGTTGGTGGTGATCTTA
TCTCAGTAGGGCTCCGCCCGAGCTCTGCAGAAACGCGATCTAGAGGAAAAACCGTGGAGG
TATGTGGTCGGGCTGCCGTGGAAAAGTCGTCTCAAATCACCCCTAAAACCTCCGTATATA
TAGGGGGAAGAGGGGGAGCCTTGCCTTGGGGTCCAAGGACCCCTAAGGGTTTCGGCCGAG
CCAAGGGGGGCAGCCCTCCCCTTCCAAACCGAGTCCAACTAGGTTTGGAAGGAGGAGTCC
TTCCCCCTTTTCCCACCTCCTCCTTTTTTTCCTTTTCTCTTTGATTTTCTTCCTACGGCG
CATAGGGCCTTCTTGGGCTGTCCCACCAGCCCACTAAGGGCTGGTGTGTAACCCCCAAGG
CCTATGGGCTTCCCCGGGGTGGGTTGCCCCCCCGGTGAACTCCCGGAACCCATTCGTCAT
TCCCGGTACATTCCCGGTAACTCCGAAAACCTTCCGGTAATCAAATGAGGTCATCCTATA
TATCAATCTTCGTTTCCGGACCATTCCGGAAACCCTCGTGACGTCCGTGATCTCATCCGG
GACTCCGAACAACATTCGGTAACCAACCATATAACTCAAATACGCATAAAACAACGTCGA
ACCTTAAGTGTGCAGACCCTGCGGGTTCGAGAACTATGTAGACATGACCCGAGAGACTCC
TCGATCAATATCCAATAGCGGGACCTGGATGCCCATATTGGATCCTACATATTCTACGAA
GATCTTATTGTTTGAACCTCAGTGCCAAGGATTCATATAATCCCGTATGTCATTCCCTTT
GTCCTTCGGTATGTTACTTGCCCGAGATTCGATCGTCAGTATCCGTATACCTATTTCAAT
CTCGTTTACCGGCAAGTCTCTTTACTCGTTCCGTAATACAAGATCCTGCAACTTACACTA
AGTCACATTGCTTGCAAGGCTTGTGTGTGATGTTGTATTACCGAGTGGGCCCCGAGATAC
CTCTCCGTCACACGGAGTGACTAATCCCAGTCTCGATCCGTACTAACTCAACGAACACCT
TCGGAGATACCTGTAGAGCATCTTTATAGTCACCCAGTTACGTTGCGACGTTTGATACAC
ACAAAGTATTCCTCCGGTGTCAGTGAGTTATATGATCTCATGGTCATAGGAACAAATACT
TGACACGCAGAAAACAATAGCAACAAAATGACACGATCAACATGCTACGTCTATTAGTTT
GGGTCTAGTCCATCACGTGATTCTCCTAATGACGTGATCCAGTTACCAAGCAACAACACC
TTGTTTATAATCAGAAGACACTAACTATCTTTGATCAACTGGCTAGCCAACTAGAGGCTT
GCTAGGGACAGTGTTTTGTCTATGTATCCACACATGTATATAAGTCTTCATTCAAGACAA
TTATAGCATGGATAATAAACGATTATCTTGATACAGGAATTATAATAATAACTATATTAT
TATTGCCTCTAGGGCATAATTCCAACAATAATAATGACCACGTGCTTAGAGAGACACGTA
TCAATAAAAACAAAAATATGGACATGATAGCATCATGATCGTCATCATAGCAGCAATATA
TCATCATAAAACTTCACATGAACAAGTGGTAATATACTCACACACTAAAGTTTAAACCAC
AAACCTTATTGAAAACTAACAAGGTATGTTCTTAGTCATTGAAGCAATTACAATTCATCA
TATTTCAGAAAGAGTCTATGTTAGAGCTTTGTTTAGCAAGTTCACATACTCAACTGTCAT
TTAGTCTTCTATGATTGCTCACATTCACGTCATATTTGTGAAACAAAAAGCATCAATCAG
GCACATATGAATATATGGGTTTATAGTTTTCACCACCCAACTACCTATCTCGGGGATAAT
TTCAACAATAATAACTCATGATCACCTATACATTGAACTGGATATATATATATATATGCC
TAGATCTTTCCCGACCACATGATGGTTGCCAAGTACAAATTAAATAAGGATGGAATAGGG
ATGAACATTGATGACTCTTGCATAAAAATAAATACATGAAAGTAAAAGATAGGCCCTTCG
CAAAGGGAAGCAGAGGTTGTCATGCACTTTTTATTAGATGTGCAAGCTCTTAAAGGAAAA
GAACATCACTTTATATTGCCCCTTGTGATAGCAACATTTATTATGTAGCCCATCCCTTTT
ATTTCTTTGCCATCACAAGTTCGTATAAAGCTTATTTTCCCTTGCAATAAAAGATCATAC
ATATGTAGGAGCAATTTTTATTGCTTTTGTAATGATGAAAACTTACTTGAAGAATCTTGT
TTAATCCATAGGTAGGTATGGTGGCCTCTTATGGCAAGAAACCATGTTTAACAAATTTTG
GATGCACAAGTAGTATCTCTACTTGGTGTGAAGTTCTGTCTAGCAAAGGTTATGACCAAG
TAACACATGTTGGAGGATTCGTAACAATATAACTTCTATGTGAATATAAGCAAACATAAC
TCAATACATTGTCTTCCTTGTCCAATGTCAACTAGTTGATCATGCATATAATATTTAATG
GGGGATCACAATCATAAAGGATGTCGAAGATAGTATATTTATATGTGGAACATCTCTTTC
ATTATTACTTTTTCATGAAATAGCTTCAATGACTAATACTATGTTCGTCAACTTCCAACA
AGTTTCATAAATCATACTCTTTTTATGTAAAGTGACCACTCTCCATGGGATTAGCATATG
ATCTTTTATTTATTCTTTTTATTGATGGGGTTGATGCACAAAAGTAAAGCAAACAAACTG
AAACTACTCTTTATTATATAACTCTCAAGCTCGATTACATCGATAGATAGATCACGAAGC
AAACACTCAAAACTAAATCACACTAGAACTTTATTCTTCCAAATCATAGGATAACTAAAG
ATTGAATGAAAATAAGTAACAATGGTAAAAGTGATCGTGATACAATACCGGGGTACTCCC
TCAAGCTTGGAACAAGCCAAGGGTGGTGCACTAATACGTCTCCAACGTATCTATAATTTT
TGATGGTTTCATGCTATAATCTTGTGAAACTTTGGATGTTTCGTATGCCTTTTATATCTT
TTTGGGGACTAACTTATTAACTCAATGCCAAGTGCGAGTTCCTATTTTTCCGTGTTTTTG
AACCTTTTCAGAGCAGGATTTTTAAACGGAGTCCAAACGGAAAGAAACCTCCAAAAAGAT
TTTTTCTAAAACAGAAGACGATCGGGAGACTTGAGAACCAAGGCAGAGGGCCACCAGGGA
CCCCACAAGCCCCCTAGCCGCGGCCAGGGGGGCGCGCCTCCCAGGTTTGTGGGCTCCCTG
GGCTTCCTCTTCCCTAGGTCTTTCGCCTATATATTCCCTAAAATCCCAGAAAAAATCAGG
AGATCCACGAAAATACTTTTCCCCCGTCGCAAGCTTCTGTCTCCGCAAGATCCCATCTCG
GGCACGTTCTAGTGCCCTGCCGAAGGGGGGATTCAGATACGGAGGGCTTCTTCATCAACA
CCATGACCTCTCCGATGATGCGTGAGTAGTTCACCATAGACTTTCGGGTCCATAGCTAGT
AGCTAGATGGCTTCTTCTCTCTCTTGGATCTTCAATACAAAGTTCTCCATGATCTTCATG
GAGATCTATCCGATGTAATCTTCTTTTGCGGTGTGTTTGTCGAGATCCGATGAATTGTGG
ATTTATGATCAAATGAATCTTATTTGAGTATCTTCTGATCTCTTATATGCATGATTTCAT
ATCCTTGTAATTCTCTTCGAGTTGTGGGTTTTGTTTGGCCAGCTTGATCTATGATTCTTG
CAATGGGAGAAGTGCTTGGTTTTGGGTTCATACCGTGCGGTGACCTCACCTAGTGACAGA
AGGGGTAGCGAGGCACGCATCATGTTGTTGCCCTCAAGGGTAAAAAGATGGGGTTTTCAT
CATTGGTTTGAGTTTATCCCTCTACATCATGTCATCTTGCTTAAGGCGTTACTCTGTTCG
TCATGAACTCAATACACTAGATGCATGCTGTATAGTAGTCGATGTGTGGAGTAATAGTAG
TAGATGCATAAAGTATCGGTCTACTTGTCTCGGATGTGATGCCTATATGTATGACCATTG
CCTTAGATATCGTCATGACTTTGCGCGGTTCTATAAATTGCTCGACAATAATTTGTTCAC
CCACCGTATTAATTGCTATTTTAAGAGAAGCCTCTAGTGAACACTATGGCCCCCGGGTCT
ACTTCACATCATATTTTCAGTCTTACACTTTTACTTTGTTGCACTTTGTGCCTTCAGTTC
TCACTTTGCAATCAATCTTGAAGGGATTAACAACCCCTTTATAGCGTTGGGTGCAAGCTC
TTTTGTGTTTGTGCAGGTACTCTCGACTTGACGCGATTCTCCTACTAGATTGATACCTTG
GTTCTCAAACATAGGGAAATACTTACTGCTCCTGTGCTGCATCGCCATTTCCTCTTCAAG
GGAAAAACCAACGCATGCTCAAGAGACGACAGAAGATTTCTGTCGCCCTAGCAGAAGAAT
TTCTGGCACCGTTGCCGTGGAGGATCAAGTCAAGAACTCATCCAAGTAAGTGTCGCAAAC
TCATCTCTTGCATTAATTTCTTGCCTCTCGTTTTCCTCTCCCCCACTTCTGAAAAACAAA
AAATTACAAAAATATTTGCCTTTTTCGTTTGCCTTTTTTCTTTGCCTTTTTCTCTCGCTT
GCTTTCTATTTGCTTGTGTGCTTGCTAGCTTGCTGAAGTCACCATGACTGAAAACACNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATCCCTGATGCCAATGCAACA
GCTCTCTACCCTTCGGATATTCACGACTTCACACACTTGCGCAACGTAGCCGTCGACCAC
GAAACGGCTAGAATTGCAATATACTAATTCCCAATGGAACAACATATCACACTTGACTTG
TAGTATATAATCTCCAGATCGATACGAATTGGAGACAAGAATTCAAGATGAATGCTTATA
GCAGTCTCATGAACTAGGGTTTATCTTAAACGTGGTCTATCTAACTAATCTGAGAGCAGC
CCTCTATATAAGAGGGGCTGGGTGATGCGCCCGAAGGGGGGGGGGCGCTAGGTCTGGTGC
GCCCAGCCTGGTCCTCCTCACTTGGTGCAACCTAAACTGGTTCGACTCAAAACGTGGTTC
GACTCAACTTGATACAAACTGACCCAACTTGGGTTCAACCCCTTGGCACGCAGGCCATGT
ACTTGAGGTATGGCGCTGCAACATGGTGTTGGTGCGCCTGGGTGTTACTCGACGTGGGGA
TCCTCACTGCCTCTCCTCCCTCGCGCCCTCTTGCTTGTACTCCACGTCATGCTCCTCTTG
CTGCAACTCCTCGCTCCCTCGTGCTATGCCTTCTTCTCCCATGCACCTGAGTATGCANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTTCAATGTATAGGTGATCA
TGAGTTATTATTGTTGAAATTATCCCCGAGATAGGTAGTTGGGTGGTGAAAACTATAAAC
CCATATATTCATATGTGCCTGATTGATGCTTTTTGTTTCACAAATATGACGTGAATGTGA
GCAATCATAGAAGACTAAATGACAGTTGAGTATGTGAACTTGCTAAACAAAGCTCTAACA
TAGACTCTTTCTGAAATATGATGAATTGCAATTGCTTCAATGACTAAGAGCATACCTCGT
TAGTTTTCAATAAGGTTTGTGGTTTAAACTTTAGTGTGTGAGTATATTACCACTTGTTCA
TGTGAAGTTTTATGATGATATATTGCTGCTATGATGACGATCATGATGCTATCAGGTCCA
TATTTTTGTTTTTTATTGATACGTGTCTCTCTAAACACGTGGTCATTATTATCGAGTTCA
ACTTTCGCTTGTGAACAAGCGAGGTATAAGCTTGGGGGAGTTGATACGTCCATGTTGCAC
CATGATTTTCTACTTTTTTATATTGTTTTTGGTCATTATTCTACTTTATTATGCAATTCT
AATGCCTATTACGTTGGAAATATGCCATGGAGGCAATGATAAAATAGTTATTATTATATT
TCCTGTTTCAAGATAATCGTTTATTATCCATGCTATAATTGTATTGAACGAAAGCATAGA
TACATGTGTGGATATATAGACAAAACAATGTCCCTACTAAGCCTCTAGTTGACTAGCCAG
TTGATCAAGGATGGTTAAGGTTTTCTGACCATGTGCAAGTGTTGTCACTTGATGACTGGA
TCACATCATTAGGAGAATGATGTGATGGACAAGACCCAAACTATGAACATAGCATGTGAT
CGTGTCATTTTGTTGCTATTGTTTTCTGCGTGTCAAGTATTCATTCCTATGACCATGAGA
TCATGTAACTCGCTGACACCGGAGGAATACCTTGTGTGTATCAAATGTCGCAACCTTACT
GGGTGACTATAAATGTGCTCTACAGGTATCTCCGAAGGTGTCCGTTGAGTTAGCATGGAT
CAAGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGCCCATAA
TACTTCTGTTTTCTCTTATTTATTTTGTAAAGGAGATGATGAACATCAGAGGCTGTTTCT
GAGGATGGGCCTAGAGCTCTCCCTATGTTGCACAATAACTGATTTGCCTATCTGATCCAA
AGCACTAGTGGTAGATTTTTTTTTCTTGGCTTGTAGTCAGATGAGGGTTTTATTTTCGTT
TGGGGAAATGATGATTAATTCATCACAGATGCCCTTAATGGGCTTTCTTAAAGAATGGTG
ACAAATTGCACGTCAGTCTGATCCCCTAATAGTTTTGTAAACTAAATTGTTAGTGGTATC
CACTCTTATTTGGAAAGTGATGATTGTTTCATCTCAGATGTCCTTTATGGATTATTCAGA
ATGATGAGAAATTGCACGTCAGTCTGATTCCAAACTGTTGTTAAACTTTGATTTTGTTGA
ACTTCGACTTGAATCCATCTGTCACTAGCTTATTTTATGTTGATAGTTGTCCCCAAATAA
TTGGTTTTCGTTTCTCATCTGTTGTGACTTGAATCTATCTGTCACTAACTGTAATATGCA
ACTAGCATAGTTGTGAGTAGTCAGACTAATTGACACTTGTACTATTTGTTGTTTGGCAGG
AGGAGTTAGGAACTAAATATCTCGTGCAGCCACTTGGCCGTGCTGAAGATGAAGAGCATT
CCAGTGACTTTGAGCCAGAAGAAAATGGTGATGGTGCTGATGATGAGGAGATTGAGGATG
ATGATGCTGAAGAAGATGGTGAGGATTCTGTTAAGGCACAATCCTCTTCAAAGAGAAAGA
GGTCTGGCGGGGAGGATGAAGATAATGATGACGACGATGGTGATGATGATGGTGATGATG
ATGAGAAGCCTCCCTCAAAGCGATAGTCAATTTGTTCTGGCTGATCTGAGATCGTTTCTG
CTGAGGGCGAAGAAGGAAAATAATCCTCTTCAAGAGGATTGTTGGTAAATGCTGTAGTTT
TAGGACATCTGTGGTAGGTGTAGCAGCTCGAACTTGAGTCTACCCATGTTAGTTGTTAGT
GCATACTGCTGATGTTGATTAGCAGCCTCTGGAAACTTCTGTATGAGCATGAGATATGGG
GCTTGTTATATGCTTGTGTAGCTTCTGATTAAAACCTGTGGAATGTGGATGCGCTTTGTT
CCGAATCTTGTATTCATGATATTTCTCTTCAACTGGTTATTGCCAGCTAGCTGTTATTAC
TCTACTGTTATGTCTGCTCTGACCTACTTTCTCTGTTCGAAAATACTTGTCATGTGTCTA
GATGTGCTTTAGTTTTTGGACAGAGAATACTTGTCATGTGCCTAGATGTGCTTTAGTTTT
TGCTACCTATATGTGTTTTAGTTTTTGCGACAAACTTATGGTTCTGTCAAGTTTGATCTA
CTCTGATCTTTCTTCACATTATCAACATGCTTTAACTGTTGGGAACCACTAGCAACCAGA
CTAGTCTATCACCCTTTGATTGAATTGTTTTGAACCCTGGATTAAGCCAGGGAAGCACTG
TCGATTAAGCTAGGGAAGCATGAATGCATCAACGTATTCTAAAATCAAAAATTGCTTCCC
AGAAATTATGATAATAACTCTATTTTTCTGTTTTTTTGGTAAGTCGTGATTTGCTTCTAC
CAAATAAATATATAAATTAGTGCTTCCTTGAAATTACGGAAAATAAATATTTCTGTAGAT
GCTTCATATGTAGGGCATGTATGGCATGGAAAGTCCTATTTTGTTGATGGAAGTATAGTG
CAATATGTTAAGGAAATAGAATATTTGATACTATGATTGATTTATTTGTTTCAGCGAAGC
ATTATTCAAGTTGCGCTACAATTTTTTAGATGCTTTGGAGACATTTTTTTGTGTAACAAA
AACTATATTCATGTTCGATGGAAACATTTGCTTGGCAATGAAACTTCTATGGATCAATGA
CATGAATGTACACGGTGCAAATTCATTTGATATGAAAATTTACAAGTCTTTTTTTTGTAA
CAACACAAATTTTACTTCTACATGGATGCATGAGTGTTKTTTTTGTTTTGTTTGTGATGT
AGTAGAAATATACTTAAAAAAACCAGATAATTTCTTCCACTGTATCACGCTTCCAAGGAT
GTTTGTTTCCATGCAGATTTATTTACCATTGAAACACATCATTGGTTTAAAACAAAGTGA
ACTATTGCTTCCATAGAAACTATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1452, 56937..57525
1086..1452, 56937..57205
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved