Hordeum_vulgare Locus HORVU3Hr1G080930
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU3Hr1G080930
Hordeum_vulgare
HORVU3Hr1G080930
chr3H
snoZ119, snoZ119, snoZ119, snoZ119, snoZ122, snoZ122
2144..2239, 2278..2373, 2413..2508, 2659..2759, 2816..2905, 2945..3031
4502
TGGCGGCCTGGGCACAGGCCAGGGTGGACCAGGGTCGACGCGATGCGCTCGAGCGCCGC
AACGGGGGCAGTGAGCGGGGAGAGGTACAGCCGCGGAGGCGGGTGGGTTGAGATCGACAG
CGGTGGCGGTTGAGGTCGGCCGCGGCGGCGAGTGGTGTGGCGGTGGCCTGGGCACACGTC
AGGGTGGCCCAGGGTCGACGGGAGGAGGCGATGTGTACGGGTATAATTTTTATAATGAAT
CATTTTTTTCCTTTTGCGTTGCAGATAAATGATGGAGCGCGGATTGAATAACAAAAATTA
CAGGAGCTCTTTTATAAAAATATCGTGGTGGGTTTTCCGAAGGAAGCAATAGCCGCTTTA
TTATTAGGTATAGATTTGAGAAGGATATTGCAAAACGCCACGACGGACTAAGAAACCAAT
TTCCTTTATTAGTAGGTATAAAAGTTTGCTGATGGGCCGGTCCAGTTGCTTGCGCGAGGA
GCAGTTCCCTTCAGCAAGAAACTTCCGTCACGCCTAATGTGAGACATAATTCTCGCGGGT
TTGTTGGGACTTGCGATGGAATTTATTTGCTGCGTGGGCTTACTTTTGGTCACATATGTG
GGTAAGGCAACCACCTGTGGGATGGGCCTAGAGAGCGACGGATGATGGCCCAAAGCACAC
TAGTCTCACAGTGGCGTTAGTCGCGTCCAAATCCTCACGCTGCCGTCAGCCCTAGCCGTT
TTGCCCCACCTCACGAGCTCTCACCACCCACGAACAAATCCCTGGCAGCCGTCCGATGCT
CCGCCACGTCATGAATCCGCGTGCCTGTTCTTGTACCCAACGACCAGGATCTGTTCTGGC
CCATCCGCCCAAACCTAGAGGCCTCTCGGCCCTCTTGTTCTTCCCCGCCGGCTACAAATC
GCGCAAAATTTCCCCTGAATTTTCCACAACCACAACGCCAACTTTAACCAGAGGAAGAAA
TTCTCTTGCGAGAGTTCGTGTCTAGTAGAAGAGTGGAGGAGATGAAGCCGGCGGTTGAAG
GCGACGAGCGTGCGGCGGAGATCGCCCGCATCAAGGCCGCCGCGGCCGCCGCCAAAAAGG
CGGCGGAAGAGGTGGTGGATGTGGACGATGAAGGTGAGGATGACGAGGAGGAGGCGGTTG
ACGGCGACGACGACGACGACGACGTCGACGACGATGGGGAAGAGGACGATGATGAGGGGG
TTGAGGGTGAGGAGAAGGGGTCGGCGCCGCAGCAGGTGGTCGACATCTCCGACGAGGACG
ACGACGGCGGCGATGAAGAGGACGGTGGTGACGATGACGATGACGATGACGACGACGACG
ACGATGACGAGGAGGACGACGATGAAGTGGATGAGGAGGAGGACCCCGAGGTATAAATTT
CTCATCGTCTCGTATTTTTTTAACATCTCAAATTTATCAGTAATTTCGGTTACGTTTAGT
CTATGAACATATGGTTCCGTTATGTTAGAGAAATTCCAGATCTGTCTTCAGATCTTGTCG
ATTTATGCTTTTCTTAAGTTGCCGTATTTCTCGTAGCTGGCGATAAATGTGTTCAGATCT
GGAAAAAAAGCGAGCCAGACGGGTTGCATCTGGTTAGGTAGATAGATTTAGGAACTGTGA
ATTTTTTCTTTTGCTCAACCTGCAGCTTTTTCTGTTGTGTTTGTTTAGATCTTGTCAATT
GTACTCTGCTATACCGTTTATTTTTTATCTGTTCAGCCTGTTGTGGTAATCGATATTCAG
TAGGCATACCGACCTGCCTTCCGTTGTTGTGTGGTGTCTAGTGTAGGCCGTCAGACTGGT
AGCACGTCCCTTTTCGAGAATAGTTGAGGACAAAGTATATGCTTCCTTTTTTCCTTTAAT
ATAAAGAAAAAAAACCTTGTGCAACTGATAAAAGAGAAACCGGGCCATGTTATGCTGTCC
ATGAATTATTTTACTATACTAAATCTGGCTCGTGGTATTGCTAAGATATCCTGTGGTCTA
TGAGTTATCTTGCTATACTAAATTTGCCTTGTGGTGTTCCTAAGATGGTCCTCAGGAAAT
CTCGCTATTTCACACTCAGATCCAAAGACACCTAGATATTCAAATTGTCTGGTGTAGATC
TGTCAGATTTGATAGTAGGCTTCTTTCTGGCCCTGTTTATGTGTGCTTGGAGATGATGAT
CATCAGAGGCTGTTTCTGAGGACGAGCCTATAGCTCTCCCTATGTTGCCAAATAACTGAT
TTGCCTATCTGATCCAAAGCACTAGTGAAATACTTTCTATTTTCTTCTCATTATTTTCTC
ATGGAGATGATGAATATCAGAGGCTGTTTCTGAGGACGAGCCCAGTGCTCTCCCTATGTT
GCCAAATAACTGATTTGCCTATCTGATCCAAAGCACTAGAGAAATATTTTCTATTTTCTT
ATTTTTATTTGGCCATGGGAGATGATGAATATCAGAGGCTGTTTCTGAGGATGAGCCTAG
AGCTCTCCGTATGTTGCAAAATTACTGATTTGCCTATCTGATCCAAAGGACTAGTCAAAC
ACTTTCAATTTTCTCTCTTCATTTATTTTGTGAAATAGATGATGAATATCTGATGCTGCT
TCCGGGTATGAGCCTTGAGCTCTCCCTATGTTGCAAAATTTCTGATCTGGCCCATAATAC
TTCTGTTTTCTCTTATTTATTTTGTAAAGGAGATGATGAACATCAGAGGCTGTTTCTGAG
GATGGGCCTAGAGCTCTCCCTATGTTGCACAATAACTGATTTGCCTATCTGATCCAAAGC
ACTAGTGGTAGATTTTTTTTTCTTGGCTTGTAGTCAGATGAGGGTTTTATTTTCGTTTGG
GGAAATGATGATTAATTCATCACAGATGCCCTTAATGGGCTTTCTTAAAGAATGGTGACA
AATTGCACGTCAGTCTGATCCCCTAATAGTTTTGTAAACTAAATTGTTAGTGGTATCCAC
TCTTATTTGGAAAGTGATGATTGTTTCATCTCAGATGTCCTTTATGGATTATTCAGAATG
ATGAGAAATTGCACGTCAGTCTGATTCCAAACTGTTGTTAAACTTTGATTTTGTTGAACT
TCGACTTGAATCCATCTGTCACTAGCTTATTTTATGTTGATAGTTGTCCCCAAATAATTG
GTTTTCGTTTCTCATCTGTTGTGACTTGAATCTATCTGTCACTAACTGTAATATGCAACT
AGCATAGTTGTGAGTAGTCAGACTAATTGACACTTGTACTATTTGTTGTTTGGCAGGAGG
AGTTAGGAACTAAATATCTCGTGCAGCCACTTGGCCGTGCTGAAGATGAAGAGCATTCCA
GTGACTTTGAGCCAGAAGAAAATGGTGATGGTGCTGATGATGAGGAGATTGAGGATGATG
ATGCTGAAGAAGATGGTGAGGATTCTGTTAAGGCACAATCCTCTTCAAAGAGAAAGAGGT
CTGGCGGGGAGGATGAAGATAATGATGACGACGATGGTGATGATGATGGTGATGATGATG
AGAAGCCTCCCTCAAAGCGATAGTCAATTTGTTCTGGCTGATCTGAGATCGTTTCTGCTG
AGGGCGAAGAAGGAAAATAATCCTCTTCAAGAGGATTGTTGGTAAATGCTGTAGTTTTAG
GACATCTGTGGTAGGTGTAGCAGCTCGAACTTGAGTCTACCCATGTTAGTTGTTAGTGCA
TACTGCTGATGTTGATTAGCAGCCTCTGGAAACTTCTGTATGAGCATGAGATATGGGGCT
TGTTATATGCTTGTGTAGCTTCTGATTAAAACCTGTGGAATGTGGATGCGCTTTGTTCCG
AATCTTGTATTCATGATATTTCTCTTCAACTGGTTATTGCCAGCTAGCTGTTATTACTCT
ACTGTTATGTCTGCTCTGACCTACTTTCTCTGTTCGAAAATACTTGTCATGTGTCTAGAT
GTGCTTTAGTTTTTGGACAGAGAATACTTGTCATGTGCCTAGATGTGCTTTAGTTTTTGC
TACCTATATGTGTTTTAGTTTTTGCGACAAACTTATGGTTCTGTCAAGTTTGATCTACTC
TGATCTTTCTTCACATTATCAACATGCTTTAACTGTTGGGAACCACTAGCAACCAGACTA
GTCTATCACCCTTTGATTGAATTGTTTTGAACCCTGGATTAAGCCAGGGAAGCACTGTCG
ATTAAGCTAGGGAAGCATGAATGCATCAACGTATTCTAAAATCAAAAATTGCTTCCCAGA
AATTATGATAATAACTCTATTTTTCTGTTTTTTTGGTAAGTCGTGATTTGCTTCTACCAA
ATAAATATATAAATTAGTGCTTCCTTGAAATTACGGAAAATAAATATTTCTGTAGATGCT
TCATATGTAGGGCATGTATGGCATGGAAAGTCCTATTTTGTTGATGGAAGTATAGTGCAA
TATGTTAAGGAAATAGAATATTTGATACTATGATTGATTTATTTGTTTCAGCGAAGCATT
ATTCAAGTTGCGCTACAATTTTTTAGATGCTTTGGAGACATTTTTTTGTGTAACAAAAAC
TAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1367, 3234..3502
1001..1367, 3234..3502
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved