Hordeum_vulgare Locus HORVU3Hr1G067060
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU3Hr1G067060
Hordeum_vulgare
HORVU3Hr1G067060
chr3H
snoZ199
2687..2769
5810
TTTCTAAGAACACTTATTTAAAATAAATGTCGTCTTACTAGTTTATTATTTTTCCTGGT
AACTTTGTCACATATAATGACACAATGCAATGGTTTTTCATTTTTTTGAATTTTTTTAAA
TTTTTCATGGTGTAATGACATAATGTAGCTGTAGTTCAAATTTGACCTGCTTTTAGGTGA
TTCAATGAAAATTTGTCTTTTTCACGAGAGGTCGATAAAAGACTTTAACACCCAACCATT
TGGTCAATTGTACATTAAATATGTCCTAGTATGTTAGAAAAATGATTTGGTCCAATTTTG
CTACAAATATATGGTAGGTCATTCAAAAAAAACTCATTTTGGGCACTTGAAAAATGAAAA
ATGAATTTTTCATACAAGAAAAATGAAAACTTCCTTAAGCAACATTGTTTGCCATTCCAA
TATGCACCCTTGTGCACAATATTAGATCTTTTGATGACCGCCTATTCATCCCAAATGAAA
AGGAAAATCTCAGGATGACCGGAAAGGTGATGGAAATGGGACCATGTTAAAATGGACTTT
GTCACTGGTTTTCCCAAATCTCAGAGAGGTAATGATGCCGGATATTATCCAACATGCCGA
ATATCAAGTCCACATTATTCAAAAAAATCTGAAGGCTGTTCAGAACAATTTGAATTTGAG
ATTTAAAAATAAAACAAAGCGGGAATAATTATGGAATGCGAAGATTAAGATATCGGGGGT
GATATGAAAATTCCCTAATATATTATAATTATAAATCGAACATTTTAAAATTAGTTAAAA
TTCTATATATTTAAAACAGAAATAATAAAAGAAATAATAATAATGATAACTAATAAAAGA
ATAAATAGAAAAAAAAAAGTATTTAAAAAAAAGAAAAAGAAAAAGACCCCCCTGGCCCAA
CTAGGCCAAGTGGCCCAGCTGGCCATCAACCGCCCCGGCCCATAACCACCCTCGGGTATA
AAGCCCTCCACGGGGCTAACCCTAGCCGACCCATTCACCCTCCCCACTCCCCTGGCCGCC
GCCACCCATCCCACACAACGCACCCGCTCGCCCCACCTACCCCTCGGCCTCTCCCTCCCC
AGATCGACCGACCCCCCCTCGTTCCGTCTCTCCCACCGACACCCAGCCCCACGCGCTCCC
TCCTCTCGCCTCCCTCCGATCCGTGGTGGACTTCCCGGGCTTCGAGGCGCACCTGATGGA
CTTCCCGGACGCGGCGGAGATGCACCCGCACGCGGACGCGGGCGAGCGGCTGCACGACGC
GGAGATCCGGTTCCGCGGCGAGATGCAGGGCCCTGAGAGCGTCGCCTTCGACCCGTGCGG
CCGCGTGCCGTACACGGGCGTTGCCGACGGCAGGGTCCTCGTCTGGGACGGCGTCCGGAA
ACAAGGGGAGGGCGATCGGCGTCGGGATGCTGAGGCGGCGGCTGACCTCCCTTCTTCTCC
GATCCCCGTGCTCCTCCTCCGTTGCTTCGCCCTACCACCAGCAGCAGCACCGCCTCCTCC
ACCCCACCCACGCCGAGGTATCCCCGCTGTTCCCCTTTATCTCCCTTCCACGCATTTCGT
CGAACGCCTCGCGCGCACGCACAACATGGGCCGGATCGAATCTGGCGTGCTCGCCTTTCT
CGCCCCGTTGGTGTCAATGCGTTCCTGCCATTTGTAGATGCTCACCCGCCTGAGATGATG
TTTTATCTGATGCAGTGACAACTCTGGCTTCAGCAGAGCAGCACAACTGCCTGCAGCTCA
AGATGAAGTATGTTGAGTTCATTGTTAGCACTCCTAGAATTCTTGATGCTGTGTTGGCGA
CGAACGAATATAAGCATCTGGAGGCAAGTTGTCCTATGGGGCAGAAAGGGTTGAAGGGTA
AAACTGAAAACTTATGCCCACTATACATATGTTATGAGCAACTTACTGCTCGAGTTTGCA
CTCCAGTTTGATTCTGTAGAGACTTGTGCTTTTCCAGTGATTCATATGTGTTCCCAGCAT
GGTAGAGACTTGTGCTTTTCCAGTGATGTTAAGAGTAGGATGATTCAGAATGTGCAGACA
TGACTTGCTCAGCCGCAGCCACACAATCCTAGTGTTTGTTTTCCAGAGTGTGCAGTATTG
TTCTATGCTTTGAATTCTGCTGAAGTTGAACGCACTCTTTGTCACCTACAAATTTTGGAA
TGGCATCAGGAAAATAAATACCATCTGATTGTGTTAGACTTGTGCAGTTGTATGCGTCCC
ACAGCATCCTGAGGGAATCTAGACATAGCCGATGGTGTAAATTTTCTTGTGCCATAGCGC
ATCGACTCTTGACCTGCATCGACTCTTGTGTCATAGCCGATGGACAGTATAGGCTAGGAG
TAATCAGTAATTCATCTATAACGTGCATCGATCTATGGTTTTGAGGAAGTGAGGACAGAG
AGGAGAAGGAAGGAGATGTACCTTCTCCTTGACCTGCAGTGCCCGACTAGGTGGCCATGC
AGCAGGGAGACTTGGGCGACAGCGATGGTGTGGTGATGGTGATGGCGCTTCCCATCACTG
TTGCGCTAAACTATGGTGATGAGATGATGTTTCATATCCTGAGACAAAAAAAACGTATTT
TCTTCTAGATAATTGCCAGACATTAGCTTTTATTCGTCTTTTGTGTTTCCCTATCTCCAT
AGTTAGTGGTGAGTACTTGTGTTGTCCATGCATGCTTATGCTTGTGAGGGTCAAGTTATG
AGGAATAAACTGCAACAATATGATGGAGCTAAGCTCCTCTAATTCTTAGTATTTAAGTAT
GCGATGACACCTCACCCTCACCATGTGATTTTCTATGCTGCCAACATACTGAAGGAAGTC
CTGCTCGTTTCTATCGATCGTAATCTGATATGATTTGATCTGTTGAACTATTGTGTTGGT
CGTCAATTTCAGTTGGATCCAGTGATAAAACTAAAATTTTATGTGACAAGAACCCAGACA
TGCATGCATGCACCAATTTTCTTTTTTATGTCTGAAATGATTTTCTTTACTGGTTTTATG
CACGTTCTACACCTTCATGTATGGCTCAGGTTAGCAGAAATATGTTGCTTTGTTGATTTT
TTTGTATGATGTGATGTTCGGTCACTTGCAAAAATAAAACATTTATTCAAGTCAGCAAAA
ATATCTTTGCTCACTCACTTAATGTAAGTTATGGTTTGTATATGTCATATGTCATATGTG
TATAGGTTTAGGTTTATCTTACTTGTGTTGTGGCTGCTTATGCTCTGCACATCCTCTTTA
TCAAATCATATAGTATTTGAGCTAATAGCATGACATCCTACCTCGGAAAGGTGGGGGGTT
AACCGTTTGGAAAAAAAGAAAAAAACTGTATCATGTGTGCAGAAAAAGAAAAAAGAAAAA
ATTGTATCATTTTTTTTCTGTTGCACTAATGTGGTTTGGGATTAAGGTCAATGGTTTGGG
GTATGTGATCTTGGTGAAAATATATTAGGTGCACACAGTAGTTTGATCTTTGATTATCAA
TGTGCAGCGCTTAATTAAGTCATGTATGATCCTTTTCATAGTTTTGTTTTTCTGGAAAGA
TCCTGTTGTCCTGTATGTCATCTGTCATATGTGTATATGTGTAGGTTTATCTTACTTCTG
TTGTGGCTGCTTATGCTCTGCACATCCTCTTAATCAAATCATATAGTATTTGAGCTAATA
GCATGACATCCTACCTCGGAAAGGTGGGGGGTTGACCGGTTCGAAAAAAAAGAAAAAACT
GTATCATGTGTGCAGAAAAAAGTAGCATCACATCCTACCTCGGAAAGGTGGGGGGTTGAC
CGGTTGGAAAAAAAGAAAAAACTGTATCATTTTTATTTCTGTTGCACTAATGTGGTTTGG
GATTAAGGTCAATATTTTGGGGTATGTGATCTTGGTGAAAATATATTAGGTGCACACAGT
AGTTTGATATTTGATTATCAATGTGCAGCGCTCAATTAAGTCTTGTATGATCCTTTTCAC
AGTTTTCTTTTTTTTGGAAAGATCCTGTTGTCTTTTCATGACTTACATTTGAGCCTATGA
AATATGCTAAAGTTGTCTATATTTCCTCCTCAAAACCATGGTGTAGGTTAAATTGACCTT
GTTAATGTGCTATTTCATTGTCAGTTGCTTACAATGTAAAATTCATTTCCCATATATGCA
ATCTTTTCTTTGCTTCCTCGGACTTTAGTAATTTGGATGGGAAGACATCTCCTTGATCTG
GATAAAACATGGATTATATGTATTTTGTATATTTATTTGATGTTTAGTTTTTCCCGTCTA
ATGATGATTTCTAATCTCGTGCAGGTTTTTGATCTGAGTCACTCATGTCTTTTGAAGTCA
GCGAGGGATCCCCTTATTTCCTCTCTTGCTACTTCTGGTTCATATATTGCATAAAATTCG
GAGATTTCACTTGATACAAGTGGAACATCTGGAGTTTTGTGCGAATATTTCCTATCATGT
GAATGAGTGGTAGTTGGATTAATTGGCAAACTCAAACTTCTCTCATCTGAGTTCAGAAAC
ATTTGTCGCTTCAAGATTTCCGCCATGGATTGCTTGTTTTTGTGCCTTGTTTCTATTCTT
GATCTGTATCTTATAGCTCTTAAAAATATGGTTGTTTCTTCTACAGGACCTCTAGGCCTA
AGAAAGTTGAAGTGCGAAGTCTTGAAGCCAATTGTGTGAAGCTCTACTTATCTAAGAATG
CATATTATATATTGTAATAATAGGCATATCTGCTTTGTAACAGATTGGAAAAATTGTAAT
ATTCTACCTTCGTGTTAATTTGATTAATTTCACATGTTCTTTCTGCTCTATTTGAAATAT
TCATATCGTACGCGATATGAAAATGTGTGAAATGAAAACCTGACCAGAACTTACATATGG
GACAAATTATGAGAAAAACATGAAAAGTGGGACCTACAGACAAAACTAAAATTCAAAAGG
CCAAAACTGCTCAAATTATAATGATACAAAAAAATTCGAAAAAAAAACAAAGTGGCTGTA
AATAGGCTAAGGCCCAAAAATAAGCCCAATAAGAAAAAGGCCAAAAAAATAAAATTAGCC
CAAAAAGAAGCCCAAAGAAATAAAATCAGCCCATGTGATCAATTGAAATGGGTTGGGCTG
ATTTCAACCATGACGTTTGATTTTGTCGTAATTTTGCCACGTAGGACAGCCACGTAGGAC
TGGGTTTGATTGCCAACGACGATTTAGGATCGTCGTAAAGGTTACGACGATCCAGGAATC
GTCATAAAAGTTACGGCGATTTTGATCAAAACGTCGCTGCTGTTCATTTGTGACGCTTCG
TTTTCGACGCTTGGTTTTTCGTCGTGAGATCGTCGTAAATTAAAAACCGTGATGATGTAG
CGACAAAAAAATAGCGTCGTGTATTAGCATATTCCTTGTAGTGTGCTCTTGAAGTTTCAT
CAATACCAGCCTTAGATGCTCGGCATGTTCTTGTTCGTTCTTCGAGTAGATGAGAATATC
ATCGAGGTATACTATGATGAATTTATCCAAATACTCCATGAAGATTGAATTCATCAAGCG
AGAGAAGCTGGCTGGGGCATTGGTTAAAGCGAAGGACATGACGGTCTACTCGTATTGGCC
ATAACGAGTGACAAAAGCCGTTTTTGGAATGTCCCCGTTCTTGATCTTGATTTGATGGTA
ACCCAACCTCAAATCCATTTTGGAGAAGATTGAGGATCCAGCAAGCTGATCATACAGGTC
GTTGATCCTGGGGAGCGGATACTTGTTCTTTATGGTGACCAGGTTAACTAGTCGATAATC
TACAACCATCCGATCCGTTTTGTCTTTCTTCTTGACAAAGAGGACGGCGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1516, 1695..1856, 4284..4810
1003..1516, 1695..1856, 4284..4291
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved