Hordeum_vulgare Locus HORVU3Hr1G065510
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU3Hr1G065510
Hordeum_vulgare
HORVU3Hr1G065510
chr3H
snoR101, snoR101
4212..4274, 4586..4649
7512
CCGGCGAGGCGGAGGCCGAAGAGAGCTGCCGACGGCGCATACAAATGGGGGCGTCTGGC
AGTGGATAAGAGAAAGAGGATGCCACGACGGCGCGAGCCCGTCTCGCGGACGGCGGGCTT
CGGCAGGGGGCGGGGGCGGGGGCGGAGACAAGGGGGCGAGCAGGGGCCTGCCCCCCAATG
ATCGACAAAACCTGAAGTTCCTAGTGTATATTTAACTGATATACGTTAGTATGTATGTAT
TTGGCCCCCCTATCAACGACCATATCCAAATCCTGGCTCTGCCACTGGCAGGGGGCACGG
GGGGCTCCCCTTGGTCGGAGGCGCGCGCGAAGGAGAGGGAGGGCGGGGTCCGGCACCGGG
TCGCCCGCAGCTTGCCGGCGGAGGCCGGGGCGCCACGCGGGAGGAGCTCAAGCACGGCGG
GGAGCTGCGGCGCCGAGAGGCGGTGGTGGGGGCGGCACTTGACGGAGCAGGCGACCGCCG
CCGACATGGCTGCTGGTTGGCTTGGCGAGCTAGGGTTCGACGGGGGGAGTTGGTGGAGAT
TGGAGAAAGAGGCCCCTGGACCGCGGGTTAGTTTGGATTAAATATAGGGGGTTTGTGTAA
AATGTAAAAAACGATTCGTTCTCTGACTTAAATCCGGACTGCTGGTTGATTTCATGAAAC
GTCAGGGGCTTTTTTTATAAAAGTGGCACGACGGACGATAGAAGCAGTCGGCGCTTTATT
ACTAACTAAGGAGAGATTTTATATCATTTTTGAGAAGTAACGTGTTAACCCACTTATAGT
TGCTGTTTTCTGGATGTTTTTGGTTTTTCAGAAAACCAATACCAAACGTATTCCAAACGT
CATCAAACTTTTTGATGATTTTTAGATAAGGGTGAATCAGTATGTGTGGACCACAATTAG
TTTAAGTGGGACGTTGGATGTTGTCTAATCCCGCGACGTGCGTGCATCCGACACAACGTT
CGGCTGGCGCGCCGCATGCAAAAATTTCCTTTTTTTTTACATGAGATTTAAGCTGTATTA
GTAGATGATGTAAATATTATTCCTAGTTAATATCGACTTTCCTAGAAAAAAGAACTCTTC
TTCTAGTTAAAAAAATCATTTCCGGATATACTTATTTATTTTCGTAGAGCTACTAGGGGC
ACCTGCAAAACGGTAAAACTGGGTCACACCTTTTTCGCCTGCGCACGCCTTTCCATGGAA
ACCCTAGCAGACGAGCTCTCCATCTAGCTCCCAATCCCCGCCGCCTCGCTGGACATACTC
GAAGCGGAGGCGGAGGCGGAGGCGAAGGCAGACAGAACCATCGCCCATGGATCTGCAGAT
CGTGGGACGACACGCGTTGCTCTTTGACGACGACGCGGCGGCGGAGGTCGTGAACTCCGG
CGGTTCCCTCGTCCCCTGGTCCGCCGCCGGCGCGGCCGATCTCCTCCTCGACCGCCACGA
CGTCCGCCACCTCCTCGACCGCGTCCCTCCTCGTCCGAACCGCGCCTACTCCGTGGCCCT
CCTCTCCACCCCCTCTCCCGACGGCGTGTCCGAGGCCGAGCTTGACCACGAGCGCTTCCT
CGACCTCACCGCCGACGTAGGCACCGGAGATGCGTCTCCTTCAGGTATACACCCCTCTAC
CCTCTGTGTTTATTGGATATGACGCTACTCTCTGTAGCCATCAGCAGTTTTCCTTTTGCG
GTACCATTTTTATGTAATTGGATGCTGTTAGAAGTCTACTGTGTTTTAGCATTCCGAGAG
CCGTCTTGGGGAAATGGAACCATCGTATCTTGTAGAAGATGAGACCAAATGCTGTTTTCT
TTTCAAATGTCCGCATTTGCTATTTGCCTATGATATGATGTCATAAGGGAACTGGTCTGT
ATGAGCTGAAGTTAGGGTGGCTCAGCTGGAATAGAAGTTGGATTCGGTATGGTATGCTAT
GACAGTTATGCCTGGAGAAATATATCTGAAATGCTAAGAACTTAAGATAACTCGATGGGC
TCTTGCTATTGTTTGTCTGTAGCAAAGTTAATTGCATATGTTGGGTTCCTATAATAGCTG
TACTGTCTACCACGTTAATGAACAACATGATTTGGGGTACAATTTTGCAGTTCTACCCAA
TGAAACCGGCACATGTGGCAATGGTATTGGTGCTAGTTGAACTCCTATTATATTTCTTGT
CATATTTTTTTGTAAGTTTGCAGGAAGGATGCTTGATTTTATTTGATGAGCATCTTTAAT
CTGTTCAAAGTAAGGGACTTTCTTCGATTTCTCCTGAGATGTATCTTTGGATCTGCATTT
TTCTTCTCGAGGCAATCTTAGTTTGTGTGTCTTGATTATTATGTAACAATACCCAAACTG
GCATCTTTTCTTTCTGCAGGAAACGGGACAGATACTGGGCAGGCTGATTATAATGCCGTC
GCTTTCTCATATGGGGGACCTGCTGGTTTTGATGATCCCAATGATTCGGTCTCTTATTAT
CGCCCATCTTTTCCTGTGCCAGAAAGCCTTTCGAATAAGCTGGTGAGTCTACAAAGCCTA
CTGTCTGCTCTCAACATATATGCATCCTGTCAGATTATTTTTCCACTTCATATATTTTTA
TTAATCCTCTCCAGTTGATCCAGCAATAATTGTCCAAGGTGCATATGTTCTTCTAAGGAT
TAAATGTCTATTTCAGATGGTTGGAGCAGAGATGAAGTTCCTACTAGTGATCCACATTGT
TTCCTTACGATCTATCTTGACGTAAGGAATAGGCAGGTGGGATTAGAATGATGTACATGA
CACATATAACAAAAGAAGAGAATACTGCAACGGAATAGCTGTTCTTAAATTTTACTATGC
TGTACCAGCTCTATACTACTCCAGTTGTGTTAAGTCATATGGTTATGATTTTCTACTCTC
ATACCATTACTGAGACAAATTTCTTTTCGTAATTTTTAATTTGCAGCCTTCATCCGAGAA
GGTGCATCAGATAATTGCAAGAACTGCTCTATTTGTCAGTGAGCATGGGGGACGAATCAG
AGATTGTGTTAAGGGTGAAGCAGGGAAGTAATCCAACATTTGGATTCTTGATGCCTGACC
ATCATCTCCACAGCTACTTCCGCTACATTGTTGATCATCCTCAGCTGTTGAAAGATGGCT
CTGATGCTGACACCAGTAAAGGCAACAAAATTGTTATGGATGAGAGTGAGAATGCTGCCT
CGTCAAGCGGAGCTTTATCATTGCTTGGGGCCGTCTACGAGTCTGGAGATGAGGATGAAG
GCGTGGTGCTTCCAGCTACTTCAAAAAGCAAGGATCCTGGAAATGACCTTTTGCATGAGC
ATGACCACAAAGGATCATCGTTCCCTGTACATGACAATGAAGTGAAAAAAGATCAGACAG
TAACAATAGAAGCAGCCACTTCAGTAAAGGATAAACCTATTTTCACCAAGAAGAACCCAA
CAATTGCTGGAAACAGCATTGTTGCTGCTCAGCGGGAGAAGGCAAAAGATGGCATGGCAG
TGGTAACCACTTCTGCGAAGTCTGACAACTCTAAATTAGGTGTGTCTGACACAAAAGAAA
CTATATTGGAACCACCATCCTTTTTGAAGGGCACAATGGAGAAAATAGTTGAGTTTATTC
TCAGGAACGGGAAGGAGTTTGAACAAAAGCTGATTGAGCAAGACAGGATGACAGGGAGGT
TTCCATTTCTTCTGCCATCTAATCCATATCACTCGTACTATCTCAAGATGCTCCAGGAAA
CCCAAGAGGTAATTTGGATCACACTCATCTGCTACTATCTAGGACGTAAATATTGGCATA
ACTTTCCCTTCCTTGACCTGTTCGATAGAAGTCAAATCTTTTTTAGACATTTTTCAGATA
GTTAAATTGGGTTAAACATTTGCAATCTGTACTCCTTCCCTTTACACTTGTCTCTTATGG
AGATCTATTTGACTAAACATTTGTCAGAATTCACACCATTAATCGGTTGTTTCATCATTC
ATGCTTTGTTTAAGAGTGAGTTGTGAACCATTGGGCATGTTCACTCAAAGTTGCAGCAGC
CACCAGTGCTGTAATGAAATAAATATAAAGCTTTGGCCTAATGTTCTTCAGTTTCTGAGG
TTTATTTTGTTTCCTTTGTTCTTCTGGATCAATCGCTTTTGTATGGCTAATGTGTTATTT
TCCCATGCTTGGACTTGTGAATACCTTTCATGCTATCATTGCTTGTTTTTTTATTTCTAA
AGTGCACATGATGTCTTACACTTGATCTCTGAACTTAAGGTAAGTTCATGTGGACACTAT
ATCAATCCTGATGCACAGTTTATTCCTATTTATTCTATTCCAATCGATACACAGATATTT
TCTTCAATTGTGTATATGATTTGATTGATGTCATGGTTCTCTTCTTAGTTGGAAAGTTTT
TTAAAATTCTGGCTTATTTTCCTTATACAAGTGTTTTTGTAAACTGTAAGTTGCTTTGGT
CTGGTTGTTTCTTTTATATGTGCTGTTTTATATTTTCTGTTGAATGCGTACCATCAGGTT
TTAATGAATATTCATCTTATATGCTTATGGCCGGTTTATGCCAAGATTGCTTATTTCCTT
GGTCTTAATTTTCAAGTGCACATGGTGTCTTACACTTGATCTCTGAACTTCAGGTAAGTT
CTTATTCTGACAGTATGAATCACTGATGCACTGCCTTTTCCCTCTCTGTTCATATTTCCA
GCCAAGCACTGAAGTATTTGGTTTAACTGTATTGCATCACTATGTTTTTCTGGTATTTAA
GCGTTGATTTATTGTTTTCTTGTTACTTTGGATAGTTTAATACTGGAACTTTTTCTAAAT
TTCTAAGATGCAAGACTTTGTTTGGATATTGTGGCTCTGGCACCGACGGAAATTGTAACC
GCACTCTACTGTGTTTGCTGAATTTGCTGTGCAGTCCAAGTCCCGTGGTGGTTCTTCAGA
GCACAAAGACAGAAGGAGCTCTTCAGAGCACCAAGACAGGAGGAGTTCTTCAGAGCACAG
AGACAGGAGGAGTTCTGAACGTAAAGACAGAAGGTCTATGGAGCGCAAAGATAGAAGTTC
TTCAGACCTCGGAGACAGTGGCCATGACAAGGAAGTAACTAAAAGCAAGGGACGGGGAAG
TGCTAACAAGGACTCAAGTACTTCTGATAGAAGCTCTGCAGAACCATCACAGAAGCAGCT
TTCTGACAAACAAGGGGAGGGGAAGTTCCACTTGGTCACTGGTGGGGTCAAGAAGGAACT
TCCTCGGACGGTCACTGCAGATGAAGCTGCTGCTATTGTTATGGCGGCTACTCGTGGACT
GGGGCCTGCCAATCCTCAACCTAACACGCTAAAAGACACGAGTGACATTCGCCATATACA
GGGCCCAAGTGCAGTTTCCAAACCTGCTTCAAATAGTGAGTCTGGCACATCAGTCACAAG
TAGTGGTCAGCTAAAGAAGGAAGGTATTGGAATTATAGATGATGATTGGATCACAAATAC
AATCGCAAAAGCAGTTGCTGTTGCCGCCTCTAAAGAGGCAGATTCTTCTGAAGCTTCAGT
GACAAATGAGCAGAAGCTGAAGGCTGAAAGGCTTCGGCGTGCAAAGATGTTCACTTCAGT
TATTAGGAGTGGAGGTAACAAGAGCGATCTGGTGACCAGTGATCCAGTTAGTGAATCTGC
AAGGGTTGCTCCTGCTAATTTGAACCTCCCGGGGCCTGATCCAGAACCTTTGGCTGCTGA
ACGGGAATGTAGCCCTGTGCGTTTTGAACGTGAAGGTTCGAATATGATCAAGCAGGAGGA
GAAAGACTCTGATGATGAACAGAACAGGGCACGCAAGTACAGAAAGCATCAGCCGGAACC
CGATGAGGACAAAGATGATTCGGAGGAGGAAAGTTATGAACACTCGAGGAAGAGGCATCG
TTCGGAGCGTTCAAGAGGCCACAGTAAGGATGCACACGAACGTAAGCACAAGCAGCACTC
CAAAGAAAGGGAGTATAGGCATCGTAGGCACGATTATAGCTCTTCAGAAGACGAGCTGCG
CAGTTCCAAGTCAAGGCATTGGCATAGGGATGATCATCATTACGCTGAAGATGATGAGCA
TAGGAGGCACCGGAGGAAGCATCGCTCTGGTTCCAAAAGGAAACACAAGGATGACCGATA
TCTTGATGAGCAAACTCCTGGCGGTGCTGAAGCCTCCCAAAGCACGCCGGAGCACCGGCA
TGGATCAGAGAAGCCCCCTGCGGAAACTGTTCAATCTTCGCAGGCAGCAACTCAGGTCCC
AGATGAGCTGAAGGCGAAAATTAGGGCCATGCTATTAGAGACATTGTAGTACATTGTGCG
ATGTGATGTATCGCTGTACTATCCTGTTCTTCTCCATTCGGTGCTTTATTTGTTAAAATT
CAGTTCCTTATTTTGTTCAAGCATTTGTCTTGCCAAAATATCTATTGTCTGGCACTGGTT
TGCATTTATAGCTTCTGCCCTCTTGTGCTGGCGCACACAGAAGCATTATAGCATAGCACG
ATAACTGTTTCGAAATGATGTGTCTTACTTAAGTGGTCTATATATATCTTTGACTCTTTA
ACTGCGAATTTCGGATGCTTACCAGTGCGTCTTAATTGGAGAGGTTATTGCTTTTCATGA
CTGAAGGACATGAGGAGTAAAGTTAGATGATCAGTTGATGTGAAGAAAATGTTGCACCGT
TAACATATTATTTTACCAACCGAGGGGGGGATGGGTAGAGGCTTGTTGATTTTGCAAAAT
GCAGGGAAAGCGAATTTTTCTAGTAGAATAGCATTTTCACCTACCCCTAAATTGGGGACT
ACGAGACATAGTCGCAAGTTGTTACGATCTTAAACGTAGCAAGAGAAATCTGTTTCTGTC
TGAACACAATATCCAGCGTGTTTGTTTTGTTCGTATAAGCCAACGACATCAGAATATATT
TATTTATTTATTGCAAAGAGAATATTGATTTTTTTTACGACACAGTATATTCGACGCATT
TGTTTTGTGCCGATCCTACAATACCTGAAACGCTTATTATTTAAGCCATCGCACGATTTA
CTGCCAAAGCATTGCTACAATGCATATGATGGAAAATCTAGATTCCTTCCGCTAGCGCTA
CAACAAGTCAAAACCCTACCGGGCATGGCCATGGCCATGGCGGCGGAACCGGACGAGCAC
GACTTTATCAGCCTCCTCCCGGACGAGATCCTAGGCACCATCATCTCCCTCCTCCCCACG
GACGACGGCGCGCGCACCACCGCCCTCTCCCGTCGCTGGCGCCACCTCTGGCGCTCCTCC
CCGCTCAACCTCGACGACTACGACATCCTCAGTAATAGGCGCTGGGATTACCTCCTCTCC
TGCCCCTCCGACCGGCGTGGCCTCAACGCCAACCGCCTCCGCAAGAGTGAGCGCCAGCTG
ATCGCCGTCATCTCCAAGATCCTATCCAAGCACCAGGGCTCCATCCGCCGCCTCTCCCTC
CTCCACGACTACTTCTACATCAGCGACATCCACGACACGCTCGACGGCTGGCTCACGTCC
CCCGCCCTCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1603, 2359..2501, 2926..3727, 4894..6512
2984..3727, 4894..6288
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved