Hordeum_vulgare Locus HORVU2Hr1G116630
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G116630
Hordeum_vulgare
HORVU2Hr1G116630
chr2H
snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b
3373..3465, 3868..3960, 4211..4303
6018
NNNNNNNNNNAAAACTGAAATTCAACTTCCGAATTGTGTCCCGCCGTTGGAGTCAGTTT
AGCAGTTCAACATGATGAATAAAAAATGTAGAGGCAATGTTGTCATGCTGGTGTCACCAA
CTGATGGAGCCGATGAGATTGCCAAATCATAAGCCTTGTACTAGTTAATTGGTTAAAAGT
TGTGTTACGCAAAACATGTTTCAAACGAGCTTCTATTATTTTGAGAAAACTAATTATGCA
CATGTGTTGACATGTGCAGATGAATTTGTAAATTGTATCGAGCCTGAACATTGTTTGAGA
GCAACGATGGTAGCATGCATCTACATAGAATGGTACCATATTTTAGGAGAATGGCAGCAT
CCATACCGTGCTTCATCTATCTTGTATTCGCTTCAAGAAATATCAGGAAAATATACAAGT
TAACTAAAATAGCTCAATAATAATAATAATATGGGCCACAATATGTGTGATAGGTCTTTG
GAAGGTCCTCCCATCTAAAAATGCATTGTGAATTTTTTTTGAAAAATCAACTCCACGCCC
TTTGATCAAATTTATATAAAATGTTCATCACCAATATTTAATCTTGAAGATGTTTTAAAA
TCCTTCGATTGTTCATACAAATTTTGCAAACTCACATCGTTTTTTAGTCTATTTATATTG
AGGTACTCCCTCGTTCTTAAATATAAGTCTTTTAAGAGATTTTACTAAAGGTCTACATAC
GAAGCAAAATAAATAAATCTATATACTTTAAAATATCTCTATATACATTCGTATGTAGTT
TACTAGTGGAACCTCTAGAAAGACTTATAATTAGGAACGAAACGAGTATTTTTTAAGAGT
TTGGACTTTTTTTGTTATGGTTCTGTATTGGGCTAACTTACCTTGGCCCATGGGGCTATT
TCGGCCCTTTTCCTCTAGGGTTAGCCGGTTAGGTCAAGGTCTCTCATCCTTTCCCCACCC
CACCTCTATTAATACCCGCCGCCGCCGATTCCATCTCCATCACCTCATCCCGCCGGCGAT
TGCTCCCCACCACCCAACCCTAGATCCATAGACCCGGCGGCGGCGGCCAGGCCAAGATGG
TGTGCATCCGGCAGGCGACGATCGACGACCTGCTGGCGATGCAGGCGTGCAACCTGATGT
GCCTGCCGGAGAACTACCAGATGAAGTACTACTTCTACCACATGCTCTCGTGGCCGCAGC
TGCTGTTCGTCGCCGAGGACTACGGCGGCCGCATCGTCGGCTACGTGCTGGCCAAGATGG
AGGAGGACCCCTCGGAGCCCTGCCACGGCCACATCACCTCCCTCGCCGTCCTCCGCTCCC
ACCGCAAGCTCGGCCTCGCCACCAAGCTCATGTCGGCCGCCCAGGCCGCCATGGACCAGG
TCTTCGGCGCCGAGTACGTCTCCCTCCACGTCCGACGCTCCAACCGCGCCGCCTTCAACC
TCTACACCTCCACCCTCGGCTACCAGATCCACGACATCGAGGCCAAGTACTACGCCGACG
GCGAGGACGCCTACGACATGCGCAAGATGCTCCGCCAGCCCGTGCCCAAGAAGCACCATC
ATCACCACCACGCAGGCGGCGGCTGCTGCTCTCATGACGCCCTTCCTGCGCCGGCCGGAT
CGTCCCCGACTACCGCTTCGCCGGAGAAGAAGGCCGACTCATAAGAGGGTATGCTGCTGC
CGCCTCATCGATCTGTTACTTTTTGTATAATAAACTGCGGTAATTCGATACTTGTTGTTA
CTTAGAATCAACGATTTCCTGCAACTTAGTCGCGATTTTGCTAGGGAAATTATCATAGCC
AAATCTCGCTGTTGGATCTTGTGTATGCGGCGCCTCTCTCACCTTTGGCTTCTTGAGATT
GACCTTTCTCAAAGTTGCCCAGTCATGGAGGCGCACAGTGATCACTGGCCGGTTTAACGT
GGTTGCTAGCAGTTTGTTGCTATGCTTCCAAAATCTCTCGCCACATCTGCTTTAACCATA
ACAAGTTACAGATTAGATCTCGTGCGGTTTGATGAACATAAGTTAGTTCTGACCTCTTGC
TTGCCGGAGCTATAACGTGCTCCGGTGCCTCTCTCACCTTTGGCATCTTGAGATTGTTCT
TTCTCAAAGTTGCCCAGTCATAGTGGCACATAGTGATTCCTGGTGGGTTTAACGTGGGAG
GTAGCTGTTTATGGTTATGCTTCCAAAATCTCTCGCTACATCTGTTTATTAGAACACTCT
TTTGAACTGCTGTGGATTGTTCTGAACCTTGTGCTGCCTACTGTCTGAAGAACATATTTC
CGTCCATTGCCTCTTAATCATAGTGGTTATATTACTATACCTGAGTTTAGTCAGTGATGA
TCATGTCTGCAAAATGTATGCTCTGTGGATTCAAGCCCCTGTTTCAGGGAGAACCTCTTG
ATGAAGCAGATGTAATTTGACATTAATTGACACATCTGAGACATTCTATAATATTGTTGC
ATGCTGCCTAGTTAATTTTAGTAGTAAGATTGAATTGATTTGATTTCTGATTTAGAAACA
GCCTTTGCTGCACAATAGGTTTACTATTGTTTGCTGCCAATGATGATTCTGTCTGCAAAA
TGTATGCTCTGTGGATTCAAGCCCCTGTTTCAGGGAGNNNNNNNNNNGTGACATCAATTG
ACAGCTCTGAGGCAATTTATAGCATTGTTCTGCTTACTGCCTTGTCATTTTAGTAGGTAG
GATGTATTGAGGTGACTTTTGATTTTGCAACTGTCTCTTTTACTTGATACCTTAACCGTT
GTTTGCTTAAGTTTTGACAATGATGATTCTGTCTGCAAAATAGATGCTCTGTGGATTCAA
GCCCCTGTTTCAGGGAGAACCTCTTGATGAAGCAGATGTTATTTGACATTAATTGACAAA
TCTGAGACATTGTTGAATATTGTTTCATGCTGCCTAGTTAATTTTAGTAGTACGATTGTA
TTGATTTGATTTCTGGTTTAGAAACAGTCTTTTGCTGCATGATAGCTTGATTATTGTTTG
CTTAAGTTCTGCCATTGATGATTCTGTCTGCAAAATGTATGGTCTGTGGATTCAAGCCCC
TGTTTCAGGGAGAACCTCTTGATGAAGCAGATATAATATGACATCAGTTGACAAATCTGA
GACAATATTATGATATATTGCTGCTTGGTGTCTAGTGACTTTTATTATTCATGGTTTTCC
AATGATGATTCTGTCTGCAAAATGGATGCCCTGTGGACTCAAGCCCCTTTTTCAGGGAGA
ACCTCTTGAGAAAGCAGATGTAAAATGACATCAAATGACAAATCTGAGGTATTCTATATT
GTGCTTCCTAGTATTTGTAACATCAATTGACAAATGAGGTATTCCAGGACATTCAGCTTC
CTGCTGATGCAATAGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGAATCATCTC
TTTGTGCTGATAAACAAACTTACAACCCATTTTACATCTGAGCCACCTCATGGATACCTC
TTTTTGTATTTTTTCTTTATTTGCTTTTCATGCCATAGATGGTACTTCCTCTGTCCGTAA
ATACTTGTCATAGGAATTAATGTATTAGATCCTTTTTTATTAATTTGTGCGACGAGTAAT
TCCGGAGGGAGTAGTTTTTATAGTTTAGTTGGGGGAATGATGTACAGAACCAGATGACGA
GGGTTGCCCAAATGCAATCCTACCATGATGCGGACTGAAATTTCATTGAGGTCAAATACA
TTTGCTGCTGATGGTTCTTCACAACCCCGCATATTTTGAATGCCATGCTTTTCTTGGTAA
ATTGTTTTGTGAACCTTGTTGCATTGCATATGAATTACCTTGTTTTCTGTTGATAATTAT
GTCTGCAGTGCGTGCTCTGTAGATGCAAAGGCTATGATGAGAAAAGTCATGCACCACTCT
GAGGAGATTTACCTCCTTGTGCTGATAAACAAACTTACAACCCATTTTACATCTGAGCCT
CCTCACATTTTTGTATTTTCTGATTTATTTAGACGTATGTCAAATTGGTTTTTGAGAAAC
CAAATAGTTAAGGTAATAACTGGATTGGTGGGATAATATCGGAACCAGATGATGAGGGTC
GCCTATTGGTGATCCTACCATGATGCGGACTGAATTAACATTGAGGTCAAGTACATTTGC
CGCTGATGGTTCTTTTTCCAATCCCCCCATATCTTGAATTGATTTTCTCCTTGGTTTTTG
AATGTTGTTGTTGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGATTTATCTCTT
TGTGCTGATAAACAAACTTACAACCCATTTTACTTCTGAGCCGTCTCATGACTTTTGTAT
TTTTCTGATCTGTTTATTGGTTTTTAGAAAATGTTTCCAGCTTTTGCCTTTGTCAGAATA
CTGTGGTTTTGAAAGATAAGTCTTGCTGTTAACTGGATTGGACGAATAATGTAGAGAACC
AGATGATGAGGGTTGCTCTAGCGATCCTACCATGATGCGGACTGAGTTACATTGATGTCA
AAACATTTGCCGCTGATGGTTCATCTTTAATGTTTTTTGTCATCCCTATTTTCAGTGTTT
TGGAAGGAGTGCCCTTGTATCTGAATTACTTAAGGTTTTGCCAATGATGTTTCTGTCTGC
AAAATGGATGCTCGAGCCCCTGTTACAGGGAGAACCTCTTGAGATAATGACATCAATCGA
CAAGCCTGAGGCATCCTAAAACAAGAAAACGCTTACACGCAAATCATGTACTTTCAGCTT
TGCTTAGATGTGGTTTCTCAAATGTATCTTCTTTCTCCTGATTGCAGAAAGACATTTCAT
GTGTGAGGAGCTGCTGAACCTACCGGATTATATGAATCATGTGGTGCTCTTTTCTGGATG
ATGATTGTATCCATGTACCAATGATACAGAGGGAACATTGTACTGTGATTACATGTGTTT
TTGTAGGCTTGCCTGGTCAGGTCCCACACCTTTGGCAAGACTCCTTGTAATTCGAGAATT
AATGACATGCACATATTTTAACTACATCCCATTTTTGCCTTAAATGTGGACATTTCATTT
GTGTCCTAACTTCAAAGTATATTCGGGGATGTCCACTTCTAATAGTTAAAATTTTGTACC
TCAAACTTAGTTTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAAAGCTCTTCTGTTGCCAATATGGTACATCAGAGGAACTTCAATTTCCACAAGCCCAAA
GGAAAGAATTTTGTCCAACAGAATACCGACTTCAAGAAGAAGGGAAAGAAGACCTTCAAG
AAGAATAAGAAGGGAGATGGCTGCTATACTTGTGGTTCAGAGGAACATTGGGGAACAAAT
GCCCAAACAAGTACAAGAAGCCGGCGCATGACTCCAAGTCTGCCAATATGATTGTGGGCA
ACAATGAAAGTGGTGCATCTGGGTACGGTAATTTACTTACTATATTTTCAGTTTGTCAAT
CCACCGATTGGTGGGTGGACACGGGTGCAAATATTCATGTGTGTGCTGACATATCATTGT
TCTCTTCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCAGGCCACCGGTCGCGGTTCCGTATTGATGGGGAATGGCGCGAGTGCTTCTG
TTCTTGGTGTTGGCATGGTCGATCTGAAGTTTACTTTGGGAAGGATCGTGCAGCTGAAGA
ACATGCAGCATGTTCCCGCCATCAAGAAGAATCTCGTTAGTGGCTCCCTTCTGTGTAGAG
AAGGGTTTAAGTTGGTCTTCGAGTCTAATAAAGTAGTTGTTAGGTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1667, 4787..5018
1076..1663
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved