Hordeum_vulgare Locus HORVU2Hr1G094210
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G094210
Hordeum_vulgare
HORVU2Hr1G094210
chr2H
snoZ199, snoR64, snoZ103, snoZ103, snoZ199, snoR135
1181..1255, 1434..1527, 1604..1703, 1765..1864, 2110..2184, 2298..2443
5394
CCCGTCGGATGGAGCACGCCGCCGTTGCCTGGCATCCATCGACAACCCTAACACCGCCG
TCGCTGCCAGCCTGACACAGGCCACGCCGACGTGGGTCGACGTCGCGCGCTCCGGTACAT
CACTAAGAACGTCGCTCCAGCCCCACCCCCCGATGACCCCTTGGAGAAATCCATCGCGTC
ACAGTACATGGTGGCGATGGAGGATAGGCAGGAGATGGGGCTGCCCGGTATTGGGGATGC
GGTCGAAGGGAGGCCAGTTTCCTTTTTTTTCTGCAACTAACGCGCGATGGGAGGAGGTGC
GGATGCGTGATTTTCTTCTTGGTGGAGTACGTCAGCCAAGATAAATTGCTAAACGTACAC
CAGACTGTGATTAGATTAATGATAACGGCTAGATTTCAATTTATCGGACTAATCCTGTGA
TGCTTGTCGGTTGTGGGTCAACTTATTGGGTACATGTAAGAAAGTTCTTGTTTGCTTGTT
TAATAGTAGTATAGATTTTTTTAAAGACAATATTAGTATAGATATCGGAAATTGCTTTTG
GCTCCCGAGCTCCATGGAGACCTTTAAATTTAAAACTCAAATTTCATGAAAATTCGTATT
TTTATATTTCAAAAAATTCTGAAAAAAAACACAGGGATAAGTGAAGGCGTAACACACATG
TGTGTAATTTTTGCACACATACACATAATATGCTTCTTTACTTTCATACCTTTTTGAAAC
GAAAAATTTGAATTTTGAATTATTCAAAAATTTCGGCCTTCATGGAGGCCGAGCTCCAAA
CGTGCGCACTGGATAGATATAGATAATAACTTCTGGAAACTTCCTCACCTCGACCGAATC
GTATTATAAACTGGCCTGGCCATTTAATGTAAAGATAGCGGCCCGGCCCGTTACTCTAAA
GATAGCGGCCCAGCCCATATTGGACGGTCACGGCATCTTAGGGTTTCCTCGCCGCACAGC
TTTATAAAGAGGAGATCGGGCGAGCGTTCCCATCGCAAGCACAACCGGCTGCGTCGGCCG
CCATCTCTCCTCGTCTCGCAATTCCAATTTGTTTTGCGGTAGAGTTTCTTGCGGATTTTC
TAGTCTACGGCGTGGTTGGTTCATAGCTTCTGTATAATTTCTCCTCTGTTTCGTTCTTTT
TGCTCGTCGCATCTCGATTTTTGGCCGTCGCCATGGTGCATGTATCAGAGGATGAGAGAA
TACTGCAACAATATGATCCATGATCTGATTCTTAGTATTTAAGTCTCTGATGATCTCCGT
GCCATTGCGATTTTTTTACGTTGTTTGTTCGTTTATATATGTAATACAAGTGGTGGATGT
GATGAAGAAAAGTTGGTCCGTGTTTCTGATTTTCAGTGACTGATAACCATCCTTAATAGA
CTTCTTATCCCTTCTATTTGTTCTTTAGATGTTCTATTTTTATTTAGTTCTGTGTTATTG
CGGTGATGAATTATGAACATTCGCATGTCAGACTTCAGAGATGCCTCTGGCTTCTATGAG
ATAACATATCATATTACTGAGCAATAAATACATTATGTAATTTTTACGGGACTGTCGTTT
GCAACAGTGTTCACTTATTTGCCGGTTGAATGCTCAGAAAGTGAATGGATATGAGGACCC
TTTCCCCAAATGATCGACTATGATTATGCTGTGCGCAACTGTAATCCTTTATCAGAGGAT
TCCAAGCCAGAAGTCTGATCCATCTTGGCTTGTTTCATTTTCCTTTATCTTTAAATTTGT
ATTTGTTCTTTTTATTTGTAGTCTGGTGGATATGAGGATCCTTTCCCCAAATGATCGACT
ATGGTTAAACTGTGCGCACATGTAGCCCTTAATCAGAGGGTTCCAAGCCAGAAATCTGAT
CCGTCAATTCTGCTTTGTTTGTGCACTTTGTTGTGTCTTCTTTGTCTTTGTTGAGCATTC
ACATGCACGTTTTTACATGAATTGTGATCCTTGAGTAATAAACCTATCTGTTCTCTAAAA
GTGTAATGTTATTTGTCTTGTGTGCTGTCTAGATTTGCTCATGTTCTATGTTGCCAATGA
ATTTGGTTGGCTTAGAAAACAAAAAGTTTTTTAAAGCACTTACACAAAGTTTGCGTATCT
CTGTTTGTATGTATCAGAGGATGAGAGAATACTGCAACAATATGATCCATGATCTGATTC
TTAGTATTTAAGTCTCTGATGATCTACTGCACCGTTTTATTCTTTTGTGTTTCCATGACA
GCAAGACAATGGGCTTGCCTTTTCTGTCTTTGTTTGGGATTATTGAAATTTTTTCTGTTT
CACATTTTGTTTTTAGCCTTTGCAGGATAAGTGTGTATCGGTTAAATGCCTCGTCTGTGC
ATTTCTTGCCGAAAGTTTTTCCTTGCTATATTAATTTGAGGAAAATGGGCAGTTAGGTTG
GGCTTGATAATCTCTTTCACTAACAATCATTTTCCTCTCATTTTTCAAATGTACCCCCTT
GTGCTCATGAATTATAAGTTTGTGTTGTTTCAAATTTGATGAAGCATAATATGCTTTGCA
GACTTATTTGTTCGATCTCGGCTGATGATGAAAAAACTTTTAATCATACCATCTTTCGGG
ACTGATTGGTCGCTATGCGTCCATGCTGTTATTCTGCAATTCTGAGGCCAAATTGAAAAA
CTTATGATTGTCCACAGTTCCAACTTTTGATATGCAATTTGCTCTGAGCAGCAAACAATT
TTGTCGGTTCTGATTGTGATGCACTTGTGAGAGGCATCTGCAATTCTCTTTGTATGGAAG
CTATTTTTTAACCATTATAAGCACTAGTGCTGCATTGTACCAAGGCAAGCTACTCCGCTG
ACAACTACCCAACCACGACCTACAGACAAATCGGCTCTTTAGAAGCCATCATCGATGTTG
CAGACACCGCCTTCTTCACCTGATCTAGCAAAGCCAAATTTTGTATTTTCACTCGAGACC
AAGCAGAGATGTCAAAGAATGATGTTAGATTATCATCTGGAGATCAGCTACGATACACCA
TCTTGACATCCGAGGTCACCCTAGTGCCTGCCTGGCACTGGGTGGAGAAAGTTCACGACA
CTGCGCGCCACATCTGGCTGGGACCGCTGCCCGCGCATGTACGAGCTGCAGGTTGTTGCA
TTTTGTCAATTGGTTGTTACCATCTCTCCTGAACGGATTGCTTTTATATCTCTCTGGATA
GTTAACAATTAACAATTGACATTAATGAGCTGAAAAGTTTGACATCCAAAATTTTTGACA
TCTAAAACTTTGACATTAATTAACTTAATCATGTACTTTTTGATAGATGACATCATGTAG
TAAGACCCAAAATTGAAATTGTTGTGGTTGTTTACTTGTATTGGTGGTTTAATTTTTTAT
TTTTTAGAAAATTAGAAAATTGTAAATATCCATTTGAAAGGATATCATTACACCAATATG
AGTAAACAGCCCAACATTTTTGTCCTTTGGCTGTGTGTTATAAGCTATGATGGCTTCTAG
TCTGTGATTAAATCGCACCATTTGATGCACTTTAGCTGTGTAACATAAAACACTTTAGCT
GTTTAACTTCCTTTCTATGTTTTTATTTGTTTTTGGAGCTAAGTAATAACATGTTTTCAG
GATGAAGAAAATGCAGTATCTTTGCGTATCTGCATCTTGTTCTAGCATGCGGAGAGCTTG
ACTTTTCTTTTTTGGGCAGCATCATGATGCGAGTTGATGTTGCAAACCGCATGAATCAGC
ACCCAAATAGCTATTTTCATCGTCTGTTTGCCACTGGCGCTGTGCATCTGTATGAATGTA
TATAACAAAACGATTATTGAACTGGTGATTGCTAAGAGATGAGTTTCTTTTAGATGAATC
TGTTGATCCAAGTGTCACAAACAGACCTGTAGTGATAAAAATTCTAAACTGAAAATATGT
TGTACGAGCAACAAGAATTTTACATACTATGAAATTTGAGATCCAATTTGAAAACATGGC
ATTAGTAAACACAGAAGACAAATTCACAACTAGAAAATGGTTGCACAACATGATTTGTCT
TTTTTTTTGTTATTTCTAACTCTGTATGTTGAATTTGAATCTAAAATTTGTTTCTAACCC
TCACAAAATTTCAATTTTTTCAGGTCTATAAAGTGAGATACGGATATCGGTGCACCGGTA
GATTCCCAATGGCACCTAGATACTCCATGTCTATAACTTTAGACATGTTAGCCGATGACA
TCGGTGCACCTCAATAACCTTTGGTGACATCGGGTGCACCGTATCTCACTTTAGATACTC
CATGTCTACTGGTGCATTGAATTCTATGTCTATAAGTTGGTTAGATTTCCAATATCGTCT
AGATACTCCATGTCAACTCAAGTATTTATGGGTTAATTATTCATATTTATCATATTCAAT
CGAACAACTTCAAAGAATGCCTCAAGTTTTCTATCAGAGAAAATAAGAAAAAATGTGCGT
CAACCCATATGCATAGTTTATCGATTGTCACTAAAATGTATATCATGTGAATCAATAGAA
AACTCCATTGTCATCACGTGTATTTACATGCAGATTCATCAAGTGATCTCAAATCCAATA
TTCAACCTGACATAACAAAAGCTGAAAGGGAAGATTAAATTCGTCACAACAAGATGGTTG
CACTTGATCTAAAAATTAAGTGATTAATCCACTCAACAATTTATTCAAGCATCCATAAAG
CAGGGTCTGACTATGGACAAGATAAATAACAAAATAGCAATGAGTCTGTCTCTAGGCCCC
ACAGGTTACCAAGGACCTCTAACTATCGGGGTATGTCACGATGCCCACTTCCTTCATCGA
ACTCCCACTGCAACTGTGTAACATTAAAACATTCAGATCTGTTGTAAACTTACGTGAAAA
TGTGGTAAATTGAATGGTCTATGTATGACGCTTGTGAACTAGTAATAATCACTAAGTGAT
CCTGAACACGTACTTACGCCAGTCATAACAAAAAAGGAAACAAACACGGTTACGCACACA
ATTCACAGGTTTTTAATTAAGTTATTTCAAGTTATCTAGAACCGGGTGTTAAATAAAGTT
TTCATGTTGCCACATAATCGTATGCATGTTTTTTTAAAGATTTAACCCTGCAGGGTTGCT
TAAACTAATCCATCACAAATTAATACAAGCTGAATAGAAAGCCTTGACCACAAAGCTTGT
GATCTCCTCGGATTCCTTAGTGGAAAACCTCAACTTCGAGATAGCCCAACGTCTGATCGG
AATCCCAACGTGTCGACGACCCCGATTAGAGCCGTGTATCTTAGTCTTAGGACATGTCGG
ATTGTCCAAACTTTCGGTAGGCCAATCTCAGAGTTGCTCTTGGCGGCCACCGGTGGTTTA
CAGTTTGGACAAACACTCATGAGGAGCACTAGCCCCGGGGGTTGATTAGTTATCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1180, 2110..3097, 4103..4394
2948..3097, 4103..4216
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved