Hordeum_vulgare Locus HORVU2Hr1G087950
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G087950
Hordeum_vulgare
HORVU2Hr1G087950
chr2H
SNORD25, SNORD25, snoU31b
1668..1755, 1984..2073, 3391..3476
5648
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGA
AAACACATTTTTTCATGCAATAATAATTGATTTTTTTTCGTTCAAAAGCTAAGAAAGACC
GGTGAAAAACTGGAACACCAAAAAACCCTGCAAAACTCCAATCTAAAAAACCAAAAACGC
GTGCGAAAAAATAAAAAATCTAAATGAAACGTTCTAAACATGACATGTGGTGTCGGTTGA
AAACGCGCTGAGTGACGACATAGAAAGTGATGGTTAAAAGGCTTTTAAGAAAGTACTCCT
TAACTAGTTACTCTCAAGGCAGACTAGGTGATGGCGAGATATAGGCGTGCCCATCATAAA
CACGTGGGGTAGACCCAGAAGGACCGGATAAGACAAACCAATCCATGGTTGGATGGTTAG
GAGGACTGTGGTATCTCCTGTCTATAAGAGTTTAAGTCCGAGACTTGACGTTGGTGCTTG
CATTTTCCTGAATTTATTCCAGGTCTTCCGACGATGTGCTTTCAGTGGGAGGAGACGTTT
CCGTTAACAACGAAGGCGTTAGTGACGACTTCGTCAATCTCAAGATGATGTGCCGGCTTA
ATCTTTCGAAGGTGCTCATAGAGATAGGATGTGCGTGCGTGCGTTTATAGGGGTGAGTGT
ACGCTTATGTATGTGAACGACTTCGATTATACTATATGCTAAAAAAGAAAAAAAGACCGG
GCAAGTGGGCAATTGGGTTAACACGCCAGGAACGGCCCATTTGGCACCTTGTTTGGTTAA
AATTGCCATTCTTACGAGTGTGGCATCACATCGCCGTTCCAATTGACCAGTCGCCTGCCT
CCGCCCCCTTCGCGAAGTTTCCCCGCTCCACAATTCCGCCATGGCCGGCGGCGGCATCTT
CAGCAGGGCGCTGAGCTACGTCGTCAACGAGTTCCTCGTGGAGGGCCTCGCAAACAAGTA
TGCTTGCCTCCCCCCCCCCCCCCCCAGAACTTAGGTTAGATCTACCCGTCGTCCTCTCGC
GAGGGTTTCGTCGTTGATTTGGTTTGATTGATGTCATGCGGATTGGTAGCGCTTCGTCAT
CTGATCCTTGGGAGGATCGGCTCCCCGGTCGGTTCCCAGCGGATTCGTTCCCTTGAAGCC
ACATCATCTCGTTGTATCTTGGGCTTGCCAGTTCATCTGCCCTCGTAGGGTTTCCCCATG
ACGCATGGTGCAGCACAGCTCATACATACGTACATGCTACCGGTAGTGATTTTTTCTAGG
ATGCGTGCGGTCTGTTCATATTTTTGGGATTTGGGTTTAAATCATGTTAGGAAAAAGGTT
AATTTTTTTTTACTTTGGTCTGAAATCTCCCAAATCCCACAAGTTGAAAGCGATGGTGTG
AGCATTTGCAGACCTGTAATGGTTCTTGCGAGCATGATCGCTTGATTCAAAGAACATCTA
AGGGACTGAGTCGGCATAGAGATTTCCCAAGAAGCAAGGGCATCTGGATTCATCCTCAAT
TTTGTTTCTTTAGAAATTTGTTAGCTTCATATGGAATGGCCATCTGGATTCTGGTGGATA
GTTTCCCCTATATTGAATTAAACCAATGGGGTCCAGTTGAGGTGTCATGTGAATTCTGTT
GCTAGAGCTATTTGCTTTGATTGGCTCATTTTGTTTAATGGTTTCATTGAAACGATGTAT
TCATGGTAGCAGTGATTGAGTTCTTACAGACCTGTAATGATTCTTGCGGAAATGATTGCA
CAGTTCAAAGAACATCTAAGGGACTGAGTTGTTATGCAACATTTGCATTACATTTGTGTG
TTGTGTTTCATTCCCTGTTTGCCGAACAGTTAGTGTATGTGTTTGTGTCCTTTCTCTTGT
TTGACGATTATGAGCTGGTAATCAATTTGATTTTTCATGACAATGAAGATGTGTTCTAGC
AGACCTTAATGATTCTTGCGGGAATGATAAGACGATTCAAAGAACATCTAATGGACTGAG
TGTACATGTAGCATTTGCACTAGGTTTTTGGTATATTATGTCTTAATTTTGTCTGACGTA
TATTTATGGTTTTGTTGTCCCTTATTAGAACAAAAATAGTATTCCCTTCGTCCCACAATA
TATGACGCTTTTGCAAGCTATGGTAGCTTTTTAAAACGTCTTATATTATGAGACGGAGGG
AGTATTTTGCCCCTATCTGATGACCTTGGACACACCTCTTTTCTGGAGAATGAACACTTT
CTCTTTTGCCGCTGTTCAAGAAAATTGTCAGAATTGCCATGAAGGATGGTGAAGATTGAT
ATTTGGTCTTGTTCGTGGTAACTGACATTTGTTTGCCTTGCTGACTACCCAAATTCTTAG
TCCTGCTATCACATTATGTTCTTTGTTTGCCCTTTTGTTTGTTTGTGTGGCCGATGATTA
AACTAAAATGATAGATTATCTTGTCCCTCAACTCTCTTCAGGAATCTCTCTCTCTCAAAA
GAAAACTCTCTTCAGGAAAGCATAATTATCAATGAGGCCGAACTCTATTTGTTTTTGTAC
TTCCTTCTATCGGTCTGCAAGCTCGAATGATAATTACAAGTGCATAGTTCAGATGACCAA
ACTGTGATTACTTGAACAAAATAGTCTTGCACTCCTAGCTGATATGTGCTGATTGACATA
CTTCTGCATCTGACTCTGTAAATCAATTGTTTTGATTTTTCATTTTAAAATTATGATTGC
CTTAGCTCATCACGAGTTGGTGTGAGTTTGTGCCCTGTACTTTGGATGAGGCGGAGCTTG
TTGAGTTTATCTTGTGCCGTCTTGTTAAATCAGGAACCACACTCTTGCAGCCTTCTGAAA
TATTTTTATCTGCTTTGTTGAGATACCACAGTTTCCGTTGTTCTTGGTTTCTGTTTTACC
TGCCCTGTCGCTGTTCTTTCTGAGTAAGATGTTTTTGTATCTGCTTTATTTAGGTACAAC
TCTCTTGCATGTTGCTGATATCTACGTATGTGAACAAATCCATGCGAGGTGTGGCACTTA
GCCAATAATTCATTTGGCCGATCTGCCTTAAACTTCTGCTGCTTATAACCATTGTATTAA
ACATGCCTTAGTGTCAGCAATGAATGTCCAAGAGGATGATGATTTCATATGTCGCCCCAG
TCTTAGTGCCCGCTTTGGTGGATCTGTGCTGATTGACTTACTTCTGAATCTCACTCTGTA
AATGATTTTTTAGACATTTCTTTTAAAATTATGATTGATTGATGTCCTTGAGCTGGTATC
TGAGTTTGTTTCCTATGCTTTGGATGAGGTGGAGCTTATTCTTGTGCCATCTTGTTATAT
TTTACTCTGATGTCCAGTAACCACCCGGGGGTATTATTAACCGCTTTGTTTAGACACCAT
GTGTTTCCCTTGATATCCGTTAGTTTCTGTTTTACTTGCCCTGGTGCTGTTTGTTCTGAG
CAAGCTGTTTGTTTTTACTGTGCAGCCGTGCCTTCCAGAGGTTTGCTGTGAGGACCAACA
AGACTTTGGAGAATCTCTCAACCAAAGGTAGGGTCACTATACCGATTTCTTAATGCTTGA
GTGTTGCTCATTTAATGTTTAACCAATTTTGGTGATTATTGGTTTGAGAATATCTTGTCT
GAATGTTATGTAAAATCATTTTGTTTGTGGTAGAAAATGTGTCATATATCATTCATACTA
CACCACTTGCAGTTTATGTATTGAGTCTAGTTTATTTTCCTGTTATGAAGATGCTATACA
GTATGAAGATATTATTTATGCACATTTGTGTTTCATTGTTTATCACATTATGTGAAACTA
TGGTTTTGATTTTAATGGCTCATTTGTGCTAAAAAGCCGACAACTTTTGCTTCTGTATCT
TCAGCTAAACAAGTGAGGGAGGAGGTGTCGGAGCAATTTAAGGATGCTCGCGGACCCGAT
GATGTGAGTTAAACCAAACCTTTATGTGGTCCATTGGGAGTAGCTGTTGTTGGAAATGCA
ACAGTTAACTGAATAAATCTTTGTTCTTGCAGCGCTTCAAGCAGTGATACCTGCTATCAG
CGCTCCTGGTTGTCTGTTCTTGTTCTGGTTTTGGATGCCATCCGCAAGCGTCCATTGTAT
AAAATCCGGATCTAAATTATCTTATTTTCTATTTAGAAATTGAGAACTAGACGCAGAGCA
CTGTTAGATTTCTGTAGCCTGCCCAACGGAACTAATTCTAGAGGAGAGACTCTCCTTGGC
TGGGCCTTGGTTTTACAAATTTCTATGATGCTTAATGTTGTTTTATGAGTAATGCCATGT
ACCATTCGCAGTCTATCTGTTGTTATGCCCTTGCTTGGCAAATCTGTGTAACTGACTGCG
TTCATAACCTGGAAAGTTTTTGACGCTCAGTTTGTCGTTTGTTCTTCTTGCGACCCATGA
GTGTGCTTAAGTTTGAAAAGGGGCAATATAGGGATAATAATACGACCGCTCAAGTATAGA
GATGGCAATGGGTTGGGTTTGGAGCGGGTGGAGCTGGTCCAAATCCAACCCATGACCCAT
ATTCCTACCCTCTGCCCATCCACCAAAGTATCCATGGGCACAAACTGTGCCATGCCCAAA
CCCATTGACTTGGGGTTGTGGGGGATTAGGGAACATGGGTCACACTTTGAGCTCCATGGG
CACAAAAAAATCAACATGAAGCCTTCCCAAAGATTAAATTAACTCATCATCGTTTGTTAA
CTAAGATTAGGTTTAGTAATTATGTTAGTGGAGTTGTGGGGATTAGGAAACATGGGTCAT
ACTTTGACCTTCTCTGACTACGAATGAGTTGGGGTTGGACATTTTCTTAGTTTAATGTTA
CTATCATAGGGGCCTATTTGTCATATGGGTATCCACTAGATATCGGATATCCATGGAGCA
AAAATTAAAACCGTGTCCAACTCAACTGTTCATAGGTATCCATATCCACGGATCCATGGA
CAGAAATGCGCTCTATACCCTTGCCCAACCGGATCGGGTATCCACGGGTATCCAGATACA
TGGATAAAATTGCCATCCCTACTCAAGTATTTAGTGAAAGCAAAGCGGAGTGCCTTCCAT
AAAAGTAAAAACTCATACTCCTACAATGGAAACGAGAACCATAGATCAAAACATGAACTA
TCACAATGAGAATTTAACCGTGTATGCCTGCTAATTTTACTTGCAACTGGATTTCCTTTT
CTCGTTGTTCTTCTCCTGTCCTCCAGTCGTGCGAGAGTTCTTAAGAAATTTCTGTATATT
CGGCCGAACCCTCGGGCTTCGTGCTCCCGACTGACCGGTCGCCGTTGATGAAGGCCACCA
CCGCATCCATCTCCTTGGCCGCCTTCTCCCCGTCTGGCTTCAACAGAAAGTAGACGTGGT
ACTCGCCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1256, 3745..3806, 4144..4202, 4292..4648
1180..1256, 3745..3806, 4144..4202, 4292..4306
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved