Hordeum_vulgare Locus HORVU2Hr1G087890
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G087890
Hordeum_vulgare
HORVU2Hr1G087890
chr2H
SNORD25, SNORD25
3450..3538, 3648..3736
6703
AAACCCATATATATTCAACGATGAAACACTAATATGAGCCTAAAAAATATGTTGTATTG
CATCTTTACAACAGAAAATATAAAATCAATTCAGTATACAGATTTCGAATCACAAACAAA
ATGCCTTCACATATAAATTCAGTATAGAAACCAGTGATGGTAACGTTCTGCCAAGAAAGT
CTAAAACCTACTGAACCAAAATTGGTGAAACATGAAATGAGCAACATTCACGTAAATAAG
AAACAAGTGTAGTGACGCTACCTCTAGATGAGAGATTCTCGAAAGTCCTGTTGGTGCTCA
CAGCAAACCTCTGGAAGGCACGGCTGCAAGGTAAAATAATATCATCTTACTTAGAATAAA
CAGCAAGGCAAGTAAAACAAAACTAACAGAAATCAAGGGAAATTGAGGTGTTTAAACAAA
GCAGATAGTAAGAGTGCTTCCTAGAGATCAGAGTAAAATATAACAAGGACACAAAACATC
TCAAGAAGTTCCACCTCATCCAAAAGCACAGGTCATAAAGCATCAAAATTTTAAAGGGAT
ATCAAAATTTTCATTTAAAGAGTCAGATTCAAAAGTCAATCAGCACAGGTCCACGAAAGC
GGACCCTAAGACTGGGGCGACAAATATGAAATCATCATCCTCTTGGATATTCATTGCTGA
CACTAAAGCATATTTCATACAATCATTAAAAGCAGCATTAGTTTAAATCATCAGTGCAGC
CAAATGAATTATTGGCAAAGTGCCACAGCTTGTCTTTCAGGATTGATTTGTTCCCATGAG
TAGAAACCGGCAAAATGCAAGAGTGAGTGGTATCTAAATAAAGCAGATAGAAAAATATCT
TAATCAGAAACAACAGCACACCAAGGCAGATAAAAAAAAAACAGAAACCAAGAACAAGGA
AACTGTGGTATCTAAGCAAGGCAGATAAAAATACATCATAAGGCACATGCAAGAGTTTGG
TTCTTGAACACCAGAGTAAAATTTAACAAGATCACAAGAAAGAAAAACTCACAGAAGCCT
CATCCAAAGTACAGAACACAAACTCATGCCAGTTAATGAGGAGCTAAGGCAATCACAATT
AAAAAAAAACATTTACAGAGTCAGATTCATTAGTATGTCAATAAGCACAGATCCACCAAA
GCAGACCCTAAGACTGGGGCGACAAATATAAAATCATCATCCTCTTGAAAATTAGTTGCT
GACATCAAATCATTTTTATATGCATCAGAAGTTGAAGGCAACTCAGCCAAATGAATCCTT
GGCTATGTGGCACAGCTCGCATGGATTTCCTCACATAGCATTCTCTTCAGTGTACTTGAT
CAAATTAAAATAATTTAACTAGCTAGGTTATGATTTCTAAAATGTGACTTTAATCAAAAT
TAAACAGGCAGACAAAGGCCGTCAGCTAGGAACGAAAAGACTATTTTGTTCAAGTAATCA
CAGTTTGGTCATCTGAACTATGCACTTAATAATCATCGACAGGACGATAAAAGGAAGTAC
AAAAAGAAACAGAGCTTTGACCTCATTGATAACTATGCTTTCCACATGAAGAAAGTTGAG
ACATATGCTTGTCTATTAGTTTAGTTTAATCATCGGTCAAACAAACTAAAACGGCAAACC
AAGAAGGTAATGTGATACGGGGACTCAGAATTTGGGTAGTCGGCAAGGCAAACAAATGCT
AGTTACGACGAACGAGACCAAATATAAATCTAAACCGTCCTCCATAACAATTCAGACAAT
TATGAACGAGACAAAATATATATTTTCACCGTTTTGTTGAAGGAGAAACAAAACCTTGAA
TATAGTCAGACAAAAAATAACATGTACAATAATCCTTACCTGTAGGGCAAATAAGGAACA
AAACACAAAACACAGATGTAATGCGAATGCTGCATGACAACTCAGTCCCTTAGATGTTCA
TTGAACTGTGCGATCATTTCCGCAAGAATCATTACAGGTCTGTAAGAACTCATCATTGTT
GCCATGCCCACGTCATTTCAACAAGACCATCAAACATAACAAGACTATCTAAGCCAATAG
CTCTGGTAACAGAATTTACATGACACCTGAACTAGGCCCCATTGGTTTACTATAACGACT
CAGTCCCTTAGATGTTCTTTGAATCAAGCGATCATGCCCGCAAGAATCATTACAGGTCTG
TAAAGGCTCATCACCGTCACGTACTCATGCGCACAACCCTACGATTTTGTGCGATTTGGT
CCAGAATAAAATTTGACCGTGTTCCTACATGCTAGAACAAATCACTACCGGCAATGTATG
TAAGAGCTTGCTGCGCCCTATGCCATAGGTAATTAACCCTACGACGAGCACACGAGAGGG
GGCAAGCCCACGATACAACGAGACGATGTGGCTTCAAGGGAACGAGTCCGCTGGGAACCG
ACCGGAGAAGCGATCTTCCCAAGGACCAGATGACGAAGCGCGAACGACATCAAGCCACAG
ATCAACGACGAAACCCTCGCGCGATGACGACGGGTAGATCCAATCTAAGTTACAGGGAGA
GGGATGGGGGAAAGTGGGAGCCGAGCATTACTTGTTGGCGAGGCCCTGGACGAGGAACTC
GTTGACGACGTAGCCCAGCGCCCTGCTGAAAATGCCGCCGCCGCCGCCGCACGCCATGGT
GGACACTTCGCAAAGGTGGCGGTCAATTGGAATGGCGATGCGATGCGACATTCGGGTGGA
TCGGCGCGATCATCTTTATATACGCGAACTGGGCTGGGTATTGCGGGCGAACGAACCCTA
GGGCGAAGGATCTGGTGGGCTTGTGGGCTAGGCCCAGTTGACGGCAACGGATTTGGGCCG
AACCGGTCCGCAACGGACTTCCATAAGTTCTGAGCCTGCCCATCGAGATCCGCTCCTGCC
GGCAGTTGGTAACCGTCGCACTGACCAGTACAGCACTGGAGACTGGAGTGAGTGATCGGC
GATCGCTGACCGACAACAATGGCCGGCTGGAGGAAGGCGTGGCTGTCCGTGCTGGACCGG
AGCGGCGGCGGCGGCGGCATTTTCAGCAGGGCGCTGGGCTACGTCGTCAACGAGTTCCTC
GTCCAGGGCCTCGCCAACAAGTAATGCTCGGCTCCCACTTTCCCCCATCCCTCTCCCTGT
AACTTAGATTGGATCTACCCGTCGTCATCGCGCGAGGGTTTCGTCGTTGATCTGTGGCTT
GATGTCGTTCGCGCTTCGTCATCTGGTCCTTGGGAAGATCGCTTCTCCGGTCGGTTCCCA
GCGGACTCGTTCCCTTGAAGCCACATCGTCTCGTTGTATCGTGGGCTTGCCCCCTCTCGT
GTGCTCGTCGTAGGGTTAATTACCTATGGCATAGGGCGCAGCAAGCTCTTACATACATTG
CCGGTAGTGATTTGTTCTAGCATGTAGGAACACGGTCAAATTTTATTCTGGACCAAATCG
CACAAAATCGTAGGGTTGTGCGCATGAGTACGTGACGGTGATGAGCCTTTACAGACCTGT
AATGATTCTTGCGGGCATGATCGCTTGATTCAAAGAACATCTAAGGGACTGAGTCGTTAT
AGTAAACCAATGGGGCCTAGTTCAGGTGTCATGTAAATTCTGTTACCAGAGCTATTGGCT
TAGATAGTCTTGTTATGTTTGATGGTCTTGTTGAAATGACGTGGGCATGGCAACAATGAT
GAGTTCTTACAGACCTGTAATGATTCTTGCGGAAATGATCGCACAGTTCAATGAACATCT
AAGGGACTGAGTTGTCATGCAGCATTCGCATTACATCTGTGTTTTGTGTTTTGTTCCTTA
TTTGCCCTACAGGTAAGGATTATTGTACATGTTATTTTTTGTCTGACTATATTCAAGGTT
TTGTTTCTCCTTCAACAAAACGGTGAAAATATATATTTTGTCTCGTTCATAATTGTCTGA
ATTGTTATGGAGGACGGTTTAGATTTATATTTGGTCTCGTTCGTCGTAACTAGCATTTGT
TTGCCTTGCCGACTACCCAAATTCTGAGTCCCCGTATCACATTACCTTCTTGGTTTGCCG
TTTTAGTTTGTTTGACNGGAGAACTACGCGTTCTACCCGCCGCGGTCGTGCCCCCACATC
GACGGCGACTTCAACTGCCACAAGAACGGCCGTCAGGACACCGGCTTCCTCAACTGGAGA
TGGCAGCCGACCGGCTGCAACATTCCCAGGTGCATGCTGCACCCCCTAACTAGCCTCTGG
TCGTAGCAAATGTTGGGCGCAATTGCATTATAATCGTCTTGCCTTGTTGCGTTGGCCAGG
ATGAACGTGACTGATTTCCTGGAGAGGCTGCGAGGCCAGAGGATCATATTCGTCGGCGAC
TCGCTGAACCGCAACATGTGGGAGTCTCTGGTCTGCATTCTGCGCCATGGCGTCAGGAAC
AAGAAGAACGTGTACGAGAGGTCGGGGAAGAACCAGTTCAAAACCAGAGGATACTACTCC
TTCAAGTTCAGGGTATCAGCTACCAGCCTCACTGAATATCAACTGTTTTGGTTTCTTTTC
TCATCTCACGTTCAAAACGATACAAAGAGAAACTCATTAGAATCTTGTTGTCGATCCAAC
TACTCAATGGCACTAGTTGATTGCAGGACTACAATTGCTCTGTCGATTTCATAAGATCGA
CATTTCTGGTGAAGGAGACGGTGCGGGAGAGCCCAAACGGCACCGTGCTCGACGAGAAAC
TGAGGTTGGACGAGCTAGACGCGACAACTCCGGCGTACCAGACCGCCGACATCGTCGTCA
TCAACACGGGGCACTGGTGGACTCACCCAAAGACATCAAAAGGGTCTGTACTCTGTATCT
GTAGTGCAACACTTGCCCAGAACTCTTCAAGTTACGCCGTATCTCTGCTAGTCAATCTGT
TTACATCCTGATTGATAAGAAGAAACATCTATCTGTGACTCCACAGGCTGAACTACTACC
AAGAAGGCAACCATGTGCACCACAGCCTTGAGGTGATGGACGCGTACAGGAAAGCACTGA
CCACATGGGCGAAATGGGTCGACAAGAACATCGACCCAGCAAGAACCCAGGTCGTCTTCA
GAGGATTCTCCCTAACACACTTCAGGTACTACGTACTATCAAGAGATTTTCACCACACGG
GCAGTTAGGTCATCTGTAAAATTAATCTTACTCTCATGATCGATCCATTTCACTGCAGGG
GAGGGCGGTGGAACTCGGGAGGGAGGTGCCACAGGGAGACCGAGCCGATATTGAACCAGA
CGTACCTCACAGAGTACCCCGAGAGGATGAGGATACTGGAGAAGGTGATGAGCCGGATGA
AGACCCCTGTGATATACCTCAACATCAGCCGGCTCACCGACTACCGGAAGGACGGCCATC
CGTCGGTGTACCGGGTGCGGTACGCCACGGAGGAGGAGCGGATGGCGGCGGCGGCGACCA
AGCAGGACTGCAGCCACTGGTGCCTGCCGGGCGTGCCGGACACGTGGAACGAGCTGCTGT
ATGCCTCGCTGCTGCAGGCAGGCAAAGGCTCCTGGAGACTATGATAGGGGTGGTTACATG
GATTTTGGTTCTCCTTTTTAGCTTTGCGAGGGGTAGATGGAATTTATATTTACGGGTAGT
TGACGAAGTTCAGTTCTGTCATTAGAGGTGGATGAACTGGCAGGAAATCTTGCATTCAGT
TAGTTAGACCTGGGTAGGGCATGTACGTACAACAGTTTAGACAACACCATCGATAATGTC
CTGATATGTCATCTATACACAGCCCTAAAGACAACGCCTACATTACGAACTTGTTTGCTC
GTCTAGAAAACACACGGTAAAAAGAACTGATAAATTAGATGGGTCGTGTGTATCCCCCGT
TTTTCTAGCCTCTTCCTCTCTCTTGATTCTCTCTTCCACATCATTCAAACTCTTAGTTGT
CATCCCTTCTAGACAGAAGACTGTGCATCATTGTACATGCCCTTAGCGGCTAAATCATTA
CAAGGCGGCGGCATTTTAGATACTACTCCCTCTGTAAAGTAATACGGAGTATAAGACTTT
TTAGATCACTACTTTAGTGACCTACTCCCTTCGTCCCAAAATTTTTGTCTTACGTTTGTC
TAGAAATGGATGTATCTAAATACTAACACATGACTAGATACATTCATATCTAGACAAAAC
AAAGACAAGAATTTTGGGACGGAGGAAGTTTAAAATGTCCTCGTATTAGTTTACAGAGGT
AGTACTTCATATAAATGGCATAATAAGTTAATAGTAGACACAAATAGTCAGATAACATTA
GTCGATATACAAATAATTGGGACAGATTAATTAATACTAATCAAAGAGGAATAATTATGC
AGTTTTGTAAACCACATGCAAGACAAAAACAGGTAAAATTGGGCAACAGGTACAGGACAG
ATTTTACTAATCAAAGACAAATAATTCTGCAGTCCAGATTCCAGAACATCCACGGCACAA
GAGCCATCAAACATGTCCTTCAAAGAGGATGTCCCCCTTGTTCTTAAGAAGTTGGGACCA
AGCCACAGTTATCTCCACCTTAGAGTCACCAATCTCACATATCGCTTGACTTATGTTGCA
GTATTTGGTCCTGAACTTGACACTACCTTGTCTAGCAATAGCATCACCAGACTGTGAGTA
GGCTTGTATGACAAATTGCAGGCTTTCTTCAAGTTCTACAGAAACAACATGCCTTGACAG
ATCAAGGTAACCATCTGAGCCCATTGGCATTTCTCCGCCATCAT
  Untranslated Region
  Coding Sequence
  snoRNA
3745..3791, 4026..4168, 4259..4451, 4586..4782, 4906..5064, 5158..5503
4260..4451, 4586..4782, 4906..5064, 5158..5503
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved